Immune response and protective effect against chronic Toxoplasma gondii infection induced by vaccination with a DNA vaccine encoding profilin

A total of 108 specific-pathogen-free (SPF) grade female Kunming mice aged six to eight weeks were purchased from Lanzhou University Laboratory Animal Center (Lanzhou, China). All mice were handled in strict accordance with good animal practices according to the Animal Ethics Procedures and Guidelines of the People’s Republic of China.

Total RNA was extracted from T. gondii bradyzoites using E.Z.N.A. Total RNA Kit I (Omega, America). The complete open reading frame (ORF) of TgPF gene was amplified by reverse transcription-polymerase chain reaction (RT-PCR) using a pair of specific primers (prfF: 5′- CGG GGTACC ATGTCCGACTGGGACCCTGTTGTCAAGG -3′, prfR: 5′- CCG GAATTC TTAGTACCCAGACTGGTGAAGATACTCG - 3′), designed according to the corresponding sequence of the ME49 strain (ToxoDB: TGME49_293690), in which the Kpn I and EcoR I restriction sites were introduced and underlined. The RT-PCR was performed following the instruction of PrimeScript® One Step RT-PCR Kit Ver.2 (TaKaRa, China). Briefly, the program was initiated at 50 °C for 30 min to synthesize the first strand cDNA, followed by 35 cycles of 94 °C for 35 s (denaturation), 65.5 °C for 45 s (annealing), 72 °C for 50 s (extension) and a final extension of 72 °C for 10 min.

The obtained DNA was ligated into pET-30a(+), and then transformed into E. coli BL21 (DE3) strain. The positive recombinant plasmids were identified by both restriction enzyme digestion using Kpn I and EcoR I and sequencing (Sangon, China). The recombinant TgPF (rTgPF) protein was expressed at the condition of 0.8 mmol/L IPTG (Sangon, China), shaking for 8 h at 37 °C. The rTgPF protein was purified using Ni-NTA His bind resin (Novagen) according to the manufacturer’s instructions and were visualized by the sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

The obtained TgPF gene and the eukaryotic expression plasmid pVAX I (Invitrogen, USA) were digested by restriction enzymes, Kpn I and EcoR I, respectively. After purification of the two DNA fragments using the Universal DNA Purification Kit (TIANGEN, China), the TgPF gene was linked to pVAX I by T4 DNA ligase (TaKaRa, China). After identification by sequencing, the positive recombinant plasmid pVAX-TgPF was constructed. The pVAX-IL-15 plasmids were preserved in our laboratory as described previously [21], and were identified by sequencing before use (Sangon, China). Both of the two eukaryotic plasmids were transformed into E. coli DH5α and then were purified by anion exchange chromatography (EndoFree Plasmid Giga Kit, Qiagen Sciences, MD, USA) following the manufacturer’s instructions and stored at − 20 °C until use. The concentrations of the two plasmids were determined by spectrophotometer at OD260 and OD280.

Mice were inoculated intramuscularly at bilateral quadriceps with 100 μg of pVAX-PF + pVAX-IL-15 (group I), 100 μg of pVAX-PF (group II), 100 μg of pVAX-IL-15 (group III), 100 μg of pVAX I (group IV), or sterile phosphate buffered saline (PBS) alone (group V) (each 100 μl) for three times at two-week interval. Mice which were not inoculated constituted the blank control (group VI). There were 18 mice in each group. Mice from group III, group IV, group V and group VI were treated as controls. Two weeks after the last immunization, splenocytes were aseptically harvested and the red blood cells were removed. All analyses were performed in triplicate.

To measure the tissue cyst burden in mice, 2 weeks after the third vaccination, six mice in per group were inoculated orally with 10 tissue cysts of the PRU strain and the brain cysts were determined at 4 weeks post-infection.

Blood samples were collected from mice in each group at 0, 2, 4 and 6 weeks from the tail vein for analysis of specific antibodies. The IgG subclasses (IgG1 and IgG2a) were examined using the sera collected at 6 weeks. The levels of TgPF-specific immunoglobulin G (IgG), IgG1 and IgG2a were measured by ELISA using SBA Clonotyping System-HRP Kit (Southern Biotech CO., LTD, Birmingham, USA) following the manufacture’s instruction. Briefly, the purified rTgPF protein (5 μg/mL) was coated on the 96-well plates over night at 4 °C. After blocking the non-specific sites by 0.5% BSA in PBS, the wells were incubated with 100 μL of mouse serum sample from each group at 37 °C for 1 h. Then, the horseradish-peroxidase (HRP) conjugated anti-mouse IgG antibodies (1: 2500 dilutions, 100 μL), or anti-mouse IgG1 or IgG2a (1: 500 dilutions, 100 μL) were added into each well. The absorbance of each well was examined at 450 nm after incubating with substrate solution (pH 4.0) (1.05% citrate substrate buffer; 1.5% ABTS; 0.03% H₂O₂) in the dark for 20 min.

The harvested splenocytes from each mouse were cultured in triplicate at a density of 2 × 10⁵ cells per well in complete medium (DMEM medium + 10% FCS + 100 U/mL penicillin/streptomycin). The cells from each group were stimulated with rTgPF (10 μg/mL) and medium alone, respectively, at 37 °C in a 5% CO₂ incubator. The proliferative activity was measured using MTs method (Promega, USA) after four days. After examining the OD₅₇₀ value of wells, the stimulation index (SI) was calculated using the formula OD_570TLA/OD_570M.

The concentration of the purified splenocytes were adjusted into 1× 10⁵ cells/mL. Then the phycoerythrin (PE)-labeled anti-mouse CD3 (eBioscience) (5 μg/mL), Allophycocyanin (APC)-labeled anti-mouse CD4 (eBioscience) (5 μg/mL) and fluorescein isothiocyanate (FITC)-labeled anti-mouse CD8 (eBioscience) (5 μg/mL) antibodies were used to stain the T cell subclasses (CD4+ and CD8+) for 30 min at 4 °C. After washing by PBS, the cultures were fixed with FACScan buffer (1% FCS and 0.1% Sodium azide in PBS) and 2% paraformaldehyde. The T cell subclasses were measured for fluorescence profiles on a FACScan flow cytometer (BD Bio-sciences) and analyzed by SYSTEM II software (Coulter).

To further evaluate the role of the DNA vaccination, the levels of cytokines including IL-2, IL-4, IL-10 and IFN-γ was carried out. Briefly, the purified splenocytes of mice from each group were co-cultured with rTgPF as positive control and medium alone as negative control at 24 h for IL-2 and IL-4, 72 h for IL-10, and 96 h for IFN-γ. The supernatant was evaluated to the concentration of each cytokine using the commercial ELISA kits (Biolegend, USA). 50 μL of Assay Buffer A and equal volume of the supernatant of each cell culture were successively added in to microplate well, incubating for 2 h at room temperature. Then, 100 μL of detection solution was added into each well. After washing the plate for 4 times, Avidin-HRP A solution was added and incubated for 30 min, and subsequently the substrate solution E was added. The reaction was stopped after adding 100 μL of stop solution into each well. The absorbance was read at 450 nm. The sensitivity limits for the assays were 20 pg/ml for IFN-γ, 10 pg/ml for IL-4 and IL-10, and 50 pg/ml for IL-2, respectively. The assay was performed in three independent experiments.

All statistical analyses were performed following the procedure of GraphPad Prism 5.0. The differences of the data regarding antibody responses, lymphoproliferation assays, percentages of CD4+ and CD8+ T cells, cytokine production and brain cyst loading were compared by one-way ANOVA. The difference compared in pairs was calculated by the t-test. The results in comparisons between groups were considered different if P < 0.05.

After identification by restriction enzyme digestion, the positive pVAX-PF plasmids were then confirmed by sequencing. The resulting sequence of pVAX-PF plasmids had 100% nucleotide sequence identity with the corresponding sequence of the RH strain (GenBank accession No.: AK223678.1). Sequencing of pVAX-IL-15 showed that no base deletion or change was detected after alignment with the corresponding sequence in GenBank (accession no. NM_008357.1).

The expression of pVAX-PF was identified by IFA. Cells transfected with the eukaryotic recombinant plasmid pVAX-PF showed specific green fluorescence. However, there was no green dot in the cells transfected with the same amount of pVAX I (Fig. 1).

The significantly increased anti-TgPF IgG antibodies after the last booster were detected only in the mice immunized with pVAX-PF [t(3) = 9.721, P < 0.01] or pVAX-PF + pVAX-IL-15 [t(3) = 13.99, P < 0.0001]. Two weeks after the last immunization, the antibody levels in mice immunized with pVAX-PF (P < 0.01) and pVAX-PF + pVAX-IL-15 (P < 0.05) were significantly increased than those in the control groups (Fig. 2). Mice from group II produced a slightly higher level of IgG antibody after the third vaccination compared to that from group I, but the difference was not significant (P > 0.05).

The IgG isotypes were examined to determine whether a Th1 or Th2 response was elicited in the immunized mice by DNA vaccination. As shown in Fig. 3, both IgG1 and IgG2a antibodies in the sera of mice from group I, II and III were significantly increased at 2 weeks after the last immunization, with higher levels of IgG2a to IgG1. These results indicated that pVAX-IL-15, pVAX-PF and pVAX-PF + pVAX-IL-15 are able to elicit a Th1 type immune response.

As shown in Table 1, splenocytes from mice in Group I [F(4,10) = 4.531, P < 0.01] and Group II [F(4,10) = 7.675, P < 0.01] were significantly increased after stimulating with rTgPF compared with that in mice from the control groups. The difference in SI between Group I and Group II was not statistically significant [t(4) = 1.823, P > 0.05].

The T cell subclasses of mice immunized with various vaccinations were identified by flow cytometry analysis. Percentages of CD3+ CD4+ T lymphocytes from Group I [F(3,8) = 11.28, P < 0.01], Group II [F(3,8) = 10.87, P < 0.01] and Group III [F(3,8) = 49.51, P < 0.0001] were significantly higher than those in mice received pVAX I, PBS or nothing, and were not statistically different among mice in the three control groups. The ratios of CD3+ CD8+ T cells in the spleens of mice vaccinated with pVAX-PF [F(4,10) = 1.519, P = 0.27] and pVAX-PF + pVAX-IL-15 [F(4,10) = 0.28, P = 0.88] was slightly higher than that in all control groups, but the difference was not statistically significant.

As shown in Fig. 4, splenocytes in mice from Group I induced significantly higher levels of IL-2 (P < 0.001) and IL-10 (P < 0.01) compared to that in mice from Group IV, V and VI, but the levels of IFN-γ (P > 0.05) and IL-4 (P > 0.05) were not significantly different. The levels of IFN-γ, IL-2, IL-4 and IL-10 in spleen cell cultures from pVAX-PF immunized mice were significantly higher than that in the control groups (P < 0.01). Mice immunized with pVAX-PF induced significantly higher levels of IFN-γ (P < 0.01), IL-2 (P < 0.001), IL-4 (P < 0.01) and IL-10 (P < 0.0001) than that in mice immunized with pVAX-PF + pVAX- IL-15.

To evaluate whether pVAX-PF with or without pVAX-IL-15 could induce sufficient protection against the formation of T. gondii tissue cysts in brain, mice of all the groups were challenged with 10 cysts of T. gondii PRU strain and the brain cyst loadings were assessed 28 days after challenge. The number of tissue cysts in mice of Group I (1843 ± 215.7) and group II (1897 ± 337.8) were reduced 40.82% and 39.08%, respectively, compared to that in mice received nothing (3114 ± 168.8). Immunization with pVAX-PF + pVAX-IL-15 [F(4,25) = 64.53, P < 0.0001] and pVAX-PF alone [F(4,25) = 42, P < 0.0001] significantly decreased the brain cyst formation in mice compared with all the control groups (Fig. 5). The brain cyst numbers in mice from Group I were slightly lower than that from Group II, but the difference was not statistically significant [t(10) = 0.33, P > 0.05]. Brain cyst loadings in mice immunized with pVAX-IL-15 were significantly lower compared to that in mice vaccinated with pVAX-PF + pVAX-IL-15 [t(10) = 6.73, P < 0.0001] and pVAX-PF [t(10) = 4.30, P < 0.01], but were significantly higher than that in mice received pVAX I, PBS or nothing [F(3,20) = 21.11, P < 0.0001].