Background
Stem cells (SCs) are a type of cells that scattered in the body tissues of multicellular organisms. SCs have the ability to self-renew and differentiate into several types of cells and thus can develop into tissues and organs [
1]. The unique features of SCs have been exploited in clinical applications. Mainly in the tissue engineering, cell therapy, and regenerative medicine [
2]. The differentiated cells have been used in stem cell research to repair the damaged cells and to evaluate the efficiency and toxicity of new drugs [
1].
Medicinal plants are rich in highly biologically active compounds, and at least 25% of the active compounds in current synthetic drugs are isolated from plant sources [
3]. It has been estimated that approximately 80% of the world’s population depends on plant-based traditional medicines [
4]. Plants contain a high concentration of secondary metabolites such as flavonoids, glycosides, and lignans that involved in different biological activities of plant extracts [
5]. Phytochemical screening and extraction are promising for new crude extract or pure compounds that modulate stem cell self-renewal and differentiation. Several bioactive molecules isolated from medicinal plants affect SC proliferation and differentiation. Examples of these molecules include lignin [
6], naringin (
Rhizome drynariae) [
7], ginsenosides (
Panax notoginseng) [
8‐
10], garcinol (
Garcinia indica) [
11], curcumin (
Curcuma longa) [
12‐
14], and Kuwanon V isolated from the mulberry tree (
Morus bombycis) [
15]
Embryonal carcinoma (EC) stem cells are considered a good model for studying embryonic stem (ES) cell differentiation during embryonic development [
16] as they share similar gene expression profiles such as the transcription factors Oct4, Sox2 and Nanog, which are the master regulators of pluripotency and self-renewal [
17]. Additionally, the human EC and ES cells express specific embryonic antigens such as SSEA3, SSEA4, TRA-1-60 and TRA-1-81 [
16,
18,
19]. TERA2 is one of the oldest extant cell lines that was isolated by Fogh and Trempe [
20] from a lung metastasis originating from a testicular germ cell tumor. TERA-2 cells were injected into a nude mouse to form xenograft tumors for clonal sublines. Of these clones, NT2 cells appeared to ‘rescue’ persisting EC cells within the culture [
21]. NT2, the best-studied clone that responds in culture to small molecule retinoic acid (RA) by forming postmitotic neurons, was reported for the first time by Andrews [
22] and later improved by Pleasure et al. [
23] to obtain pure fractions of neuronal cells.
Saudi Arabia contains a diverse array of plant species that are widely used in Saudi’s traditional medicines. [
24]. To the best of our knowledge, and based on an internet survey, there is a lack of research showing the effect of Saudi’s plant extracts on stem cell differentiation. Therefore, in the current study, we have investigated the effect of extracts derived from
Rhazya stricta species on NT2 proliferation and differentiation.
Methods
Plant collection and extraction
The
Rhazya stricta plant was collected between January and February in the spring of 2014 from the Raudhat Al- khafs desert near Riyadh city, Saudi Arabia. The plant was identified and authenticated at the herbarium of the Department of Botany and Microbiology, College of Science, King Saud University, Saudi Arabia. Plants were separated into fruits, stems and leaf parts. First, the plant parts were washed thoroughly with distilled water, air-dried at room temperature and then crushed into powder using an electric blender. The dried powder of each parts (30–50 g) was successively extracted with different polarity of solvents namely n-hexane, chloroform, ethyl acetate, and methanol for 24 h using a Soxhlet apparatus. The crude extracts were centrifuged at 4000 rpm, for 10 min and the supernatants were concentrated to dryness under low pressure at 45 °C in a rotary evaporator. Finally, the crude extracts were dissolved in MeOH, filtered and stored at −80 °C until used. The extraction yield was calculated using the following equation:
$$ Total\ extract ion\ yeild\ \left(\%\right)=\frac{Mass\ of\ the\ extract\ }{Mass\ of\ sample}\times 100 $$
Cell culture
The NTERA2 cl.D1 [NT2] (ATCC® CRL1973™) human pluripotent embryonal carcinoma cells were cultured in high glucose Dulbeccoʼs Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12, Thermo Fisher Scientific) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Thermo Fisher Scientific), 2 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin (Thermo Fisher Scientific) in a humidified incubator (Sanyo, Japan) at 37 °C and 10% CO2. The medium was replaced with fresh medium daily. The NT2 cells were passaged every 2–3 days with 0.25% trypsin-EDTA (Thermo Fisher Scientific).
Assessment of cell viability using the MTS assay
Cell viability was assessed by colorimetric assay using the MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H–tetrazolium) assay according to the instructions provided by the manufacturer (Promega). Briefly, cells were seeded in 24-well plates (4 × 104/well), allowed 24 h to adhere, treated with different concentrations of plant extract (10, 50, 100, 250, 500, 700, and 1000 μg/ml) and incubated for 48 h in a humidified 10% CO2 atmosphere. Methanol (0.01% MeOH) served as the vehicle control. MTS was added at a concentration according to the manufacturer’s instructions for 2 h. The absorbance was measured using a plate reader (BioTek, USA) at a wavelength of 490 nm. The percentage of cell viability after treatment was calculated by assuming 100% viability for the absorbance recorded in the vehicle control. The IC50 value was generated from the dose-response curves using Origin 8.5 data analysis and graphing software.
Induction of the NTERA-2 cell line (NT2) differentiation
The differentiation of SC was induced according to the method of Andrews [
22]. The cells were imaged every 2 days using a 1X 50 fluorescence microscope (Olympus, Japan) to observe the cellular differentiation.
NT2 cell differentiation by retinoic acid (RA) & plant extract
The cells were plated at a density of 15,000 cells/cm2 in DMEM/F-12 supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin. RA-induced cell differentiation was a positive control prepared using 10 μM RA for 3 weeks in a humidified incubator at 37 °C and 10% CO2, and the medium was replaced every 2 days. During the RA-induced differentiation process, the NT2 cells were seeded in 3 different T75 flasks, and the time period allowed for differentiation was one week for the 1st flask, two weeks for the 2nd flask, and three weeks for the 3rd flask. Dimethyl sulfoxide (DMSO) was adjusted to 0.001% as a vehicle control for 3 weeks. For extract treatments, NT2 cells were treated with several concentrations of plant extracts (5, 10 and 25 μg/ml) per well of 6-well plates for 2 weeks in a humidified incubator at 37 °C and 10% CO2, and the medium was replaced every 2 days. The MeOH (0.001%)-treated cells served as a vehicle control.
Gene expression analysis by RT-PCR
Total RNA was extracted from NT2 cells treated with chloroform extract of
Rhazya stricta stems (RS1S CHCL
3), RA, and vehicle control using Tri-reagent (Sigma) as described by Chomczynski and Mackey [
25]. One microgram of RNA was used for cDNA synthesis according to the manufacturer’s instructions (Reverse Transcription System, Promega). PCR amplification reactions were performed in a total volume of 25 μl using GoTaq® Green Master Mix (Promega). The PCR reactions were incubated in the ProFlex PCR system (Applied Biosystems, USA) with the following conditions:94 °C hot start (5 min), denaturation at 94 °C (30 s), annealing temperature of 53–60 °C (30 s; temperature based on the primer), extension at 72 °C (40 s) and post-extension at 72 °C (10 min). The primer sequences and product size are summarized in Table
1. β-actin was used as an internal control, and stem cell markers, including Oct4, Sox2, Nanog, and Klf4, were used to determine the gene expression levels in both undifferentiated and differentiated cells. PCR products were loaded on a 1.2% agarose gel in Tris-acetate-EDTA (TAE) buffer containing SYBR Safe DNA gel stain. The agarose gel was imaged, and the intensity of the gel bands was measured using a Gel Doc XR+ system (Bio Rad, USA). All gene expression was determined for two independent experiments, normalized to β-actin, and the relative levels of stem cell markers after treatment were presented in comparison to the vehicle control.
Table 1
List of the primers used in this study
h-Oct4 | F-CCTCACTTCACTGCACTTGTA R-CAGGTTTTCTTTCCCTAGCT | 165 |
h-Sox2 | F- ATGTCCCAGCACTACCAGAG R- GCACCCCTCCCATTTCCC | 141 |
h-Kf4 | F- GGTCGGACCACCTCGCCTTACAC R- CTCAGTTGGGAACTTGACCA | 172 |
h-Nanog | F- TTTGTGGGCCTGAAGAAAACT R- AGGGCTGTCCTGAATAAGCAG | 116 |
h-β-actin | F- AAACTGGAACGGTGAAGGTG R- AGAGAAGTGGGGTGGCTTTT | 171 |
Immunocytochemistry (ICC)
To detect protein expression levels in both undifferentiated and differentiated cells, the monoclonal antibody TRA-1-60 (Santa Cruz Biotechnology) was used as the primary antibody to assess surface antigens on the NT2 cells and the changes that occur upon differentiation induced by RS1S CHCL3 extract. Following the treatment, cells were washed and then fixed in 4% paraformaldehyde (20 min) at room temperature. Fixed cells were incubated with blocking buffer (3% FBS in 1× Phosphate buffer saline (PBS)) for 40 min, and then the cells were incubated overnight at 4 °C with TRA-1-60 primary antibody diluted 1:100 in blocking buffer. After incubation, the cells were washed 3 times with 1× PBS and then incubated for 1 h at room temperature on a shaker with FITC-conjugated goat-anti-mouse IgM (Santa Cruz Biotechnology) secondary antibody diluted 1:500 in blocking buffer, and the cells were then washed 2 times with 1× PBS. For nuclei staining, the cells were incubated with 1× PBS containing 0.5 μg/ml Hoechst (Sigma) for 5 min. The stained cells were imaged using an In Cell Analyzer 2000 System (GE Healthcare Life Sciences, USA). For the negative control, conditions were kept the same, except that the primary antibody was omitted.
Phytochemical analysis of plant extract
Phytochemical screening was performed using standard procedures as described by [
26‐
28]. The
Rhazya stricta extracts were screened for the following phytoconstituents: alkaloids, saponins, flavonoids, and amino acids.
GC-MS (gas chromatography –mass spectrometry) analysis
Phytochemical investigation of RS1S CHCL3 extract was performed on an Agilent 7890A/5975C GC-MS system (Agilent Technologies, USA). The experimental conditions of the GC-MS system were as follows: HP-88 capillary standard column, dimension: 100 Mts, ID: 0.25 mm, film thickness: 0.20 μm. The flow rate of the mobile phase (carrier gas: He) was set at 1.0 ml/min. For the gas chromatography, the temperature program (oven temperature) was 50 °C raised to 250 °C at 5 °C/min, and the injection volume was 2 μl. Samples dissolved in methanol were run fully at a range of 50–650 m/z.
Statistical analysis
The results are presented as the mean ± standard deviation (± SD) of two independent experiments, and statistical analysis was performed using Student’s t-tests.
Discussion
The effects of 12 plant extracts obtained from different parts of
Rhazya stricta on the proliferation and differentiation of NT2 cells were investigated. Parts of
R. stricta (leaves and flowers) are used in traditional medicine for the treatment of rheumatism and allergy [
29]
, and it has also been reported to have antioxidant activity in rats [
30]. Additionally, the crude alkaloid extract of
R. stricta has been found to induce apoptosis in human lung cancer cells [
31]. Until now, no studies have shown the induction of SC differentiation by
R. stricta extract. Therefore, this study is the first to demonstrate the induction of SC differentiation by
R. stricta extracts. It was found that only RS1S CHCL
3 induced the differentiation of the NT2 cell line at a concentration of 5 μg/ml. NT2 cells are a pluripotent human embryonal carcinoma cell line, which may differentiate into many different cell types if exposed to certain stimuli [
22,
32,
33].
The morphology of NT2 cells is characterized by little cytoplasm, prominent nucleoli and growth in the form of clusters [
34,
35]. In the presence of RA, NT2 cells undergo neuronal differentiation and rapidly lose their morphology to exhibit a single axon with multiple dendrites, which is a typical neuronal morphology [
23]. Moreover, gene expression profiles were assessed for the NT2 cells exposed to RA for 2–4 weeks. In the first phase of differentiation, on day 3, there was high expression of hat1, which remained constant, and rapid accumulation of nestin, suggesting a marker of neuroprogenitors, although it then decreased dramatically. In the second phase, neurod1 exhibited expression on the 7th–14th days of differentiation, which indicates the neuroprogenitors exited the cell cycle. There was enhanced neural differentiation and the synaptophysin showed expression on the 3rd day and gradually increased until the third phase of differentiation [
36]. The RS1S CHCl
3 extract changed the NT2 cell morphology during the 14 days of the treatment. The differentiated cells exhibited the neurite formation (cells with more than 3 neurites). In accordance with these reports and the characterization of neuronal morphology, the differentiated cells tended to be differentiated into a neuronal lineage.
Cell viability was monitored by MTS assay to distinguish a cytotoxic response from an induction of differentiation. The toxicity of RS1S CHCL3 extract started approximately 10 μg/mL after 2 days of treatment with IC
50 =
33.3, while the high concentrations were highly cytotoxic. However, the proliferation of NT2 cells typically decreases during cellular differentiation, and the RS1S CHCL3 extract at a concentration of 5 μg/ml over 14 days of treatment affected cell proliferation.
The expression of transcription factors, including Oct4, Sox2, and Nanog, in pluripotent cells is important in self-renewal and differentiation [
37]. These factors, along with other transcription factors such as Klf4 and c-myc, can be used to reprogram somatic cells to become induced pluripotent stem cells (iPSCs) [
38]. The activation of pluripotency markers was found to effectively maintain SC in the undifferentiated state. In contrast, if the expression of pluripotency markers is downregulated, it will initiate differentiation [
37]. Based on these reports, our results are in accordance with the published literature, as the treated cells had significantly downregulated transcript levels of Oct4 and Sox2 compared to the vehicle control. However, Nanog and Klf4 were also downregulated, although not significantly, after 14 days of treatment by RS1S CHCL
3. RA also showed significantly downregulated transcript levels of stem cell genes, including Oct4, Nanog, Sox2, andKlf4, on the 7th -14th day of differentiation. The downregulation continued until the 21st day of differentiation except for the Nanog gene, which showed a higher expression at day 21 compared to day 7 and day 14, although this could be due to different stages of differentiation. In previous studies, Reynertson found that ethyl acetate fractions of
Suriana maritime leaf and stem extracts downregulated Oct4, Nanog and Rex1 genes at 18, 48, and 96 h of treatment and induced differentiation [
39]. Lignin suppressed the undifferentiation markers Nanog and Rex1 and promoted the expression of the neuroectodermal markers sox1 and Otx2 that differentiate mouse ES cells into neuroectodermal cells [
6].
Various studies have reported that NT2 stem cells are characterized by expression of the surface antigen TRA-1-60 in the undifferentiated state [
40,
41]. When the NT2 cells are induced to differentiate into neurons by RA, the differentiation was marked by downregulation of this surface antigen as described by Andrews [
22]. This loss of TRA-1-60 expression is accompanied by the acquisition of another antigen such as A2B5, a marker for neural differentiation [
42]. TRA-1-60 protein expression was checked by immunocytochemistry to confirm the differentiation. Upon exposure to RS1S CHCL
3 extract, treated cells showed downregulation of the surface antigen TRA-1-60 after 14 days of treatment in comparison to the vehicle control where TRA-1-60 was highly expressed, which indicates that the cells are in the undifferentiated state.
Phytochemical substances isolated from plants have untold biological and therapeutic potential. They are a rich source for drug discovery, food supplements, and nutraceuticals [
43]. Many alkaloids and a few flavonoids have been structurally elucidated from
R. stricta (mostly from the leaves but also from other parts of the plant) found in Saudi Arabia, Pakistan, India and United Arab Emirates [
44]. Some of the alkaloids isolated from
R. stricta are antirhine, geissoschizine [
45], 16-e-Z-isositsirikine, vallesiachotamine, sewarine, tetrahydrosecamine, polyneuridine [
46,
47], aspidospermiose, strictibine, 1-carboxymethoxy-β-carboline [
48], and stemmadenine [
49]. The preliminary phytochemical tests provide insight into the isolation and characterization of active compounds leading to drug discovery and development. Our findings showed the presence of alkaloids and saponins, and the absence of phenols, flavonoids, and amino acids in RS1S CHCL
3 extract. Plant collection may occur in different seasons, during different stages of plant development, or in the presence of different environmental factors. Due to these factors, the active compound/s may not be present. Additionally, the freezing and thawing cycle of the extract, oxidation, degradation, hydrolysis, thermal instability, and photodegradation may result in the loss of the activity of the compound/s or changes in the solubility of the extract [
50]. Therefore, the best method to overcome this problem is to generate a fingerprint of the extracts or fractions to monitor the production and stability of the extract over time and similarity of the extract when recollection occurs. Such quality control is a key issue in herbal medicine development. The fingerprint technique has been widely established as a useful method for the quality control and evaluation of herbal extracts [
51,
52]. Several methods are used for fingerprinting of natural products such as HPLC, IR, HPTLC and GC-MS. Lu et al., [
53] used GC-MS to create a fingerprint of
Houttuynia cordata. They found 15 compounds that could be used as markers to identify and evaluate the consistency in 40 different factories and different batches. Paul et al. [
54] analyzed volatile substances in
Meum athamanticum to generate a profile of 46 components that was used to monitor seasonal and geographic chemical variation. In this study, we described the fingerprints of RS1S extract that could allow for monitoring the stability and comparing the composition of selected extracts for further isolation and characterization of the active principle/s as well as other in vivo and in vitro studies in the future.