Background
Prostate cancer (PCa) is a most frequently occurring malignancy among older men [
1,
2]. Prostate tumors are usually indolent, but a considerable number of tumors are highly aggressive and often metastasize to bones and other organs, leading to high morbidity and mortality [
3,
4]. In addition, PCa is typically marked by a high recurrence rates, whereby about 40% of local PCa cases recur after initial treatment, and the tumor progresses to hormone refractory/castration resistance stage is basically untreatable [
5,
6]. Epithelial–mesenchymal transition (EMT) and its reverse process are essential physiological processes during organogenesis and tissue differentiation of normal embryonic development [
7,
8]. The EMT process is also a part of cancer pathogenesis including PCa [
9]. Angiogenesis is also an important feature of malignancy, and is particularly relevant in the progression to end-stage PCa [
10]. There is a need to unravel the molecular events and players that are involved in these mechanisms.
Past studies have highlighted the regulatory role of microRNAs (miRNAs) in PCa pathogenesis. miRNAs regulate post-transcriptional gene expression and their dysregulation is implicated in the development of cancer [
11,
12]. It has been previously reported that up-regulated miR-129-5p could reduce EMT and thus functions as a tumor suppressor [
13]. Down-regulation of miR-129 has been demonstrated as a valuable prognostic biomarker of PCa proliferation [
14]. Zinc-finger protein of the cerebellum (ZIC) 2, identified as a target gene of miR-129-5p in the present study, is the vertebrate homologues of the Drosophila odd-paired (OPA) gene, including ZIC1, ZIC2, ZIC3, ZIC4 and ZIC5, and has been implicated in multiple diseases including cancer [
15,
16]. Another study has proved that the RNA levels of ZIC1, ZIC2, ZIC4 and ZIC5 are all induced in Gleason grade 3 embedded in Gleason score (GS) 4 + 3 = 7 PCa [
17]. miRNAs have recently become important regulators of EMT in diversity cancers [
18]. miRNAs appear to regulate EMT by modulating posttranscriptional components such as EMT-transcription factors, epithelial and mesenchymal genes, or through regulation of key signaling pathways, which in turn modulate cancer progression and metastasis [
7,
18]. For instance, overexpression of miR-129-5p attenuated EMT and proliferation in gastric cancer by downregulating the expression of HMGB1 [
19]. The canonical Wnt signaling pathway, extensively conserved in the animal kingdom, is essential for embryonic development and adult tissue homeostasis [
20]. Moreover, miR-129-5p has been reported to hamper proliferation and invasion of chondrosarcoma cells by blocking the Wnt/β-catenin signaling pathway [
21]. Based on the aforementioned evidences, we hypothesize that miR-129-5p played a significant role in PCa pathogenesis via its regulation of ZIC2-mediated Wnt/β-catenin signaling pathway. Therefore, the current study aimed to examine if miR-129-5p could impact EMT and angiogenesis in PCa by regulating ZIC2-mediated Wnt/β-catenin signaling pathway.
Materials and methods
Ethical statement
The study was approved by the Institutional Review Board of the First Hospital of China Medical University. Written informed consents were obtained from all patients or their guardians. All study procedures were conducted in accordance with the Declaration of Helsinki. All animal experiments were conducted under the approval of guidelines for the protection and use of experimental animals issued by the National Institutes of Health (NIH), and strictly complied with the principles of completing the experiments with the minimum number of animals and minimizing pain.
Study subjects
A total of 60 cases of PCa tissues were collected from the PCa patients who had undergone prostatectomy in the Urology Department in the First Hospital of China Medical University from September 2016 to September 2017, with the corresponding 60 adjacent normal tissues taken as controls (all the samples were verified by pathological examination). All subjects had no missing clinical data. The patients included were aged between 54 and 76 years, old, with 26 patients ≥ 70 years old and 34 patients < 70 years old; 46 patients of prostate transverse diameter > 35 mm and 14 patients of prostate transverse diameter < 35 mm; 43 patients of Gleason score ≤ 7 points and 17 patients of Gleason score > 7 points. And 38 patients in I + II stage, 22 patients in IIIA stage of tumor, node, metastases staging [
22]. All the 60 cases of PCa patients were diagnosed as primary tumors. Moreover, all the patients had no previous history of PCa-related chemotherapy or radiotherapy. The adjacent normal tissues were pathologically confirmed to be with no tumor cell infiltration and no obvious inflammatory reaction. The collected samples were fixed with 10% formaldehyde, routinely dehydrated, paraffin-embedded, and cut into 4 μm sections for subsequent experiments.
Immunohistochemistry
The SP-9001 kit (Beijing noble Ryder Technology Co., Ltd., Beijing, China) was used for Immunohistochemistry. The normal and PCa paraffin tissues were allowed to stand at room temperature for 30 min, fixed by 4 °C acetone for 10 min followed by dewaxing and hydration. Next, samples were soaked with 3% H
2O
2 for 5–10 min to inhibit endogenous peroxidase activity and sealed with 5% normal goat serum working solution (C1771, Beijing Applygen Technology Co., Ltd., Beijing, China). After incubation for 10–15 min at 37 °C, the sections were probed with rabbit anti-human antibodies to Wnt3a (ab19925, 1:200, Abcam, Cambridge, UK) and β-catenin (ab16051, 1:100, Abcam, Cambridge, UK) overnight at 4 °C. Next, the sections were allowed to stand at room temperature for 30 min and incubated with the secondary antibody, biotinylated goat anti-rabbit antibody to immune globulin (IgG; 1:1000, ab6721, Abcam, Cambridge, UK) for 1 h at 37 °C. Following that, the sections were reacted with horseradish peroxidase (HRP)-labeled streptavidin (0343-10000U, Imunbio Biotechnology Co., Ltd., Beijing, China) for 1 h at 37 °C and with diaminobenzidine (DAB; ST033, Guangzhou Whiga Science and Technology Co., Ltd., Guangzhou, Guangdong, China) for 3–10 min. Subsequently, the sections were counterstained by hematoxylin (Shanghai Fusheng Industrial Co., Ltd., Shanghai, China) for 1 min, immersed in 1% hydrochloric acid alcohol for 10 s, soaked with tap water, and stained for 10 s with 1% ammonia to obtain a blue color. The sections were then dehydrated with conventional gradient alcohol, cleared by xylene, and sealed with neutral balsam. Phosphate buffer solution (PBS) instead of the primary antibody was used as the blank control. Five high-power fields (200×) were randomly selected from each section and 100 cells were counted in each field. Scores were determined as the proportion of positive cells [
23]. The positive cells/total cells > 10% was considered as positive (+) and positive cells ≤ 10% was considered as negative (−). Normally, the β-catenin
+ cells in PCa tissues were mainly in the cytoplasm and nucleus, and poorly expressed in the membrane. The Wnt
+ cells were mainly in the cytoplasm. The positively stained cells were expressed as brown or tan. Each experiment was carried out three times.
Dual-luciferase reporter gene assay
Biological prediction website (
https://cm.jefferson.edu/rna22/Interactive/) was applied to conduct the target gene analysis for ZIC2 and miR-129-5p. A dual-luciferase reporter gene assay was used to verify whether ZIC2 was a target gene of miR-129-5p. Based on the predicted binding sequence between the 3′untranslated region (3′UTR) of ZIC2 mRNA and miR-129-5p, the target sequence and the mutant sequence were each designed. The target sequence was chemically synthesized and digested by
XhoI and
NotI restriction sites. The synthesized fragment was cloned into the PUC57 vector (HZ0087, Shanghai Huzheng Industrial Co., Ltd., Shanghai, China), and recombinant plasmids were identified by DNA sequence assay once positive clones were identified. Next, the recombinant plasmids were subcloned into the psiCHECK-2 vector (HZ0197, Shanghai Huzhen Industrial Co., Ltd., Shanghai, China), transferred into Escherichia coli DH5α cells and amplified. All the plasmids were extracted in accordance with the instructions of plasmid mini-extracting kit Omega (D1100-50T, Beijing Solarbio Science & technology Co., Ltd., Beijing, China). The cells were seeded in a 6-well plate (2 × 10
5 cell/well) and transfected once they were adherent to the wall. After 48 h, the effect of miR-129-5p on the luciferase activity of FGF3 3′-UTR in cells was detected using the dual-luciferase reporter assay kit (D0010, Beijing Solarbio Science & technology Co., Ltd., Beijing, China). The fluorescence intensity was measured using a Promega Glomax 20/20 luminometer fluorescence detector (E5311, Shanxi Zhongmei Bio-technology Co., Ltd., Xian, Shaanxi, China). Each experiment was repeated three times.
Cell culture, grouping and transfection
The DU145 PCa cell line (Cell Bank of Shanghai Institute of Cells, Chinese Academy of Science, Shanghai, China) was cultured in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) [
24] with a mixture of penicillin–streptomycin solution at the ratio of 1:1 (100 U/mL), in a 5% CO
2 incubator at 37 °C. Cells were detached with 0.25% trypsin and passaged at a ratio of 1:3. Next, the cells were cultured in 6-well plates at a density of 3 × 10
5 cells/well. When the cells reached 70–80% confluence, the following experiments were carried out.
The cells at passage three were treated with trypsin, seeded in 24-well plates, and cultured until they grew into monolayers. These cells were then grouped as follows: the blank group (DU145 cells transfected without any sequence), the negative control (NC) group (DU145 cells transfected with scramble siRNA), the miR-129-5p mimic group (DU145 cells transfected with miR-129-5p mimic plasmid), the miR-129-5p inhibitor group (DU145 cells transfected with miR-129-5p inhibitor plasmid), the si-ZIC2 group (DU145 cells transfected with si-ZIC2 plasmid), and the miR-129-5p inhibitor + si-ZIC2 group (DU145 cells transfected with miR-129-5p inhibitor and si-ZIC2 plasmid). The transfection sequences were constructed by Shanghai Sangon Biotech Company (Shanghai, China). Before transfection, cells were cultured in 6-well plates for 24 h. When cell density reached 30–50%, the cells were transfected following the manufacturer’s instructions of lipofectamin 2000 (11668-019, Invitrogen, New York, CA, USA). A total of 250 μL serum-free Opti-minimal essential medium (MEM; 51985042, Gibco, Gaithersburg, MD, USA) was used for dilution of 100 pmol plasmid (the final concentration was 50 nM), mixed gently and incubated for 5 min. Another 250 μL serum-free medium Opti-MEM was used to dilute 5 μL lipofectamin 2000, mixed gently and incubated for 5 min. These two mixtures were incubated for 20 min, added to the cell culture wells, and cultured within 5% CO2 at 37 °C for 6–8 h. Next, a complete medium was used for incubation for 24–48 h for following experiments.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
The total RNA was extracted from the transfected cells in strict accordance with the instructions of the TRIZOL kit (15596-018, Beijing Solarbio Science & technology Co., Ltd., Beijing, China), and RNA concentration was determined. The primers used in this study were synthesized by Dalian TaKaRa Corporation (Dalian, Liaoning, China) (Table
1). The reverse transcription was conducted following the instructions of cDNA Reverse Transcription Kit (K1622, Beijing Reanta Biotechnology Co., Ltd., Beijing, China). RT-qPCR was performed using a fluorescence quantitative PCR instrument (ViiA 7, Sun Yat-sen University DAAN GENE Co., Ltd., Guangzhou, Guangdong, China). U6 was used as the internal reference gene and the relative expression of miR-129-5p was calculated. With glyceraldehyde-3-phosphate dehydrogenase (GAPDH) used as the primer of internal reference, the relative expression of target genes (ZIC2, Wnt, β-catenin, E-cadherin and vimentin) was calculated by relative quantitative method (2
−ΔΔCt) [
25].
Table 1
Primer sequences for RT-qPCR
miR-129-5p | F: CAAAAAGCGGACAGG |
R: CAGTGCGTGTCGTGGAGT |
ZIC2 | F: GAGGGCACCTTGTGATCATGT |
R: ACAGGGTGGGAAAGAACGTG |
Wnt | F: CAGAAGGACCTTGTTTGCCAGG |
R: CCTCAGGGTATTGCTGGACAAC |
β-Catenin | F: CAAGACCTCGTGCTCCAGTTAG |
R: GACCAAAAGGTGATGCTGGACAG |
E-Cadherin | F: TGCCCAGAAAATGAAAAAGG |
R: GTGTATGTGGCAATGCGTTC |
Vimentin | F: GAGAACTTTGCCGTTGAAGC |
R: GCTTCCTGTAGGTGGCAATC |
U6 | F: CTCGCTTCGGCAGCACA |
R: AACGCTTCACGAATTTGCGT |
GAPDH | F: ACCCAGAAGACTGTGGATGG |
R: TCTAGACGGCAGGTCAGGTC |
Western blot analysis
After 48 h of culture, cells of each group were lysed with a protein lysis buffer for 30 min at 4 °C and shaken once every 10 min. After centrifugation at 25,764×g for 20 min at 4 °C, the supernatant was collected and used as the protein extraction solution. The protein concentration was determined using a bicinchoninic acid (BCA) kit (20201ES76, YEASEN Biotech Co., Ltd., Shanghai, China). The protein was separated by polyacrylamide gel electrophoresis (PAGE), transferred onto a polyvinylidene fluoride (PVDF) membrane by wet transfer method, and blocked with 5% bovine serum albumin (BSA) for 1 h. The membrane was probed with the primary antibodies; rabbit anti-human antibodies to ZIC2 (1:2000, ab150404), Wnt3a (1:1000, ab28472), β-catenin (1:4000, ab6302), p-β-catenin (1:500, ab75777), E-cadherin (1:20,000, ab40772), N-cadherin (1:1000, ab76057), vimentin (1:2000, ab92547), VEGF (1:2000, ab32152), CD31 (1:5000, ab76533), and GAPDH (1:500, ab9485) overnight at 4 °C. After being washed three times with tris-buffered saline tween (TBST) (each time for 5 min), the membrane was probed with HRP-labeled goat anti-rabbit IgG (1:10,000, ab6721) for 1 h at room temperature. All antibodies were bought from Abcam (Cambridge, UK). Subsequently, the membrane was washed three times with TBST (each time for 5 min) and developed. The ImageJ 1.48u software (National Institutes of Health, Bethesda, MD, USA) was used for protein quantitative analysis by computing the ratio of gray value of each protein to that of the internal reference. Each experiment was repeated three times independently.
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay
After transfection for 48 h, the cells were counted and seeded in 96-well plates at a ratio of 3 × 10
3–6 × 10
3 cells/well (100 μL/well). Six replicate wells were prepared. At the 24th h, 48th h, and 72nd h, cells were incubated with 20 μL prepared 5 mg/mL MTT solution at 37 °C for 2 h. Next, 15 μL Dimethyl Sulphoxide (DMSO; WBBB011a, Beijing Qiangxin Biorepublic Co., Ltd., Beijing, China) was then added to each well. The optical density (OD) value was obtained at 570 nm using a microplate reader (NYW-96M, Beijing Nuoyawei Instrument Co., Ltd., Beijing, China). Each experiment was conducted for three times. A cell viability curve was plotted using the time points at 24th h, 48th h, and 72nd h as abscissa and OD value as ordinate. The cell viability was calculated as follows = OD value of treated cells/OD value of control cells × 100% [
26].
Transwell assay
Cells were starved in serum-free medium for 24 h and detached. Next the cells were resuspended in serum-free Opti-MEMI (31985008, Nanjing SenBeiJia Biological Technology Co., Ltd., Nanjing, Jiangsu, China) containing 10 g/L BSA, and the cell density was adjusted into 3 × 104 cells/mL. A transwell chamber was placed in a 24-well plate, and the bottom membrane on the apical chamber was coated with diluted Matrigel (40111ES08, YEASEN Biotech Co., Ltd., Shanghai, China) at a ratio of 1:8, and then air-dried. Totally, 200 μL of cell suspension was added into the apical chamber coated with Matrigel, and 600 μL of Roswell Park Memorial Institute (RPMI) 1640 culture medium with 20% FBS was added to the basolateral chamber. After 24 h of routine culture, the cells on the apical chamber were removed using cotton swabs, fixed using 4% paraformaldehyde for 15 min, and stained with methanol-prepared 0.5% crystal violet solution for 15 min. Five visual fields were randomly selected and photographed (200×) under an inverted microscope (XDS-800D, Shanghai CIKONG Optical Instrument Co., Ltd., Shanghai, China). The number of cells that had penetrated the membrane was counted and the number of cells in each field was calculated to determine cell migration and invasion. Three replicates were set for all groups. This experiment was repeated for three times to obtain an average value.
Matrigel angiogenesis assay
Matrigel (356234, Shanghai ShanRan Biotech Co., Ltd., Shanghai, China) was placed in a freezer at 4 °C overnight to melt into a yellow gel. A total of 70 μL (0.5 mmol/L thickness) of the yellow gel was rapidly added to a pre-cooled 96-well plate with a pre-chilled micropipette. Next, the plate was incubated for about 30 min at 37 °C until the Matrigel was frozen. After 48 h of infection, the cells were dissociated into a cell suspension. The cell suspension at 1 × 105 cells/mL was seeded into the wells coated with Matrigel and cell culture medium for the corresponding group was added to each well. The plates were incubated for 18 h, and then photographed under a low power microscopy system. Three fields were randomly selected from each well and the number of blood vessels formed in each field was calculated. Each experiment was carried out three times.
Flow cytometry
After transfection, the DU145 cells were treated with ethylene diamine tetraacetic acid (EDTA)-free trypsin, collected in a flow tube and centrifuged. The cells were centrifuged again, and then the supernatant was removed. According to the instructions of Annexin-V-fluorescein isothiocyanate (FITC) Cell Apoptosis Detection Kit (40302ES60, YEASEN Biotech Co., Ltd., Shanghai, China), the Annexin-V-FITC/propodium iodide (PI) staining solution was prepared by dilution of the Annexin-V-FITC, PI, and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer solution at a ratio of 1:2:50. Every 100 μL staining solution was used to re-suspend 1 × 106 cells, and the cells were shaken fully, incubated for 15 min, added with 1 mL HEPES buffer and mixed well. Cell apoptosis was determined by using 525 nm and 620 nm band pass filters to detect the fluorescence of FITC and PI at an excitation wavelength of 488 nm.
In vivo xenograft assay
Male BALB/c nude mice (aged 4–6 weeks and weighing 16–22 g) were used. All mice were housed in a humidity-controlled (50–60%) room on a 12/12 h light/dark cycle with ad libitum access to chow and drinking water. After 24 h of transfection, stably transfected DU-145 cells were detached with trypsin, resuspended in serum-free 1640 medium and counted. A total of 1.5 × 106 DU-145 cells were implanted subcutaneously on the back of the nude mice (200 μL suspension). The growth of the resultant tumor was observed every 7 days starting from the 7th day. The volume (V) of the tumor was calculated using the formula V (mm3) = (D2 × L)/2, where L is the length, and D is the width of the tumor. The development of solid tumors was monitored for up to 35 days post xenotransplantation. All mice were euthanized, and the tumor was excised and weighed.
Statistical analysis
SPSS21.0 statistical software (SPSS, IBM, Armonk, NY, USA) was used to analyze the statistical data. The enumeration data were expressed as the number of cases or percentages. The comparisons were carried out using a Chi square test or Fisher’s exact test. The measurement data were summarized as mean ± standard deviation and. Data between 2 groups were analyzed using a t test, while those among multiple groups were compared using one-way analysis of variance (ANOVA). Pairwise comparisons of mean values were made using Tukey test. α = 0.05 was taken as the test level, and p < 0.05 was considered as statistically significant.
Discussion
PCa is one of the most prevalent carcinomas among men, resulting in a high number of cancer-related deaths [
32]. miRNAs have been implicated in biological processes such as cell proliferation, differentiation, development, apoptosis, and metabolism, and their alterations have been found in various cancers and participate in pathogenesis of cancers [
33,
34]. Importantly, miR-129-5p has been demonstrated to express aberrantly in primary tumors of human PCa and prostate control specimens [
35]. Therefore, this study investigated the function of miR-129-5p in PCa, and it was found that up-regulated miR-129-5p could inhibit EMT and angiogenesis in PCa.
Initially, the results obtained from present study revealed that up-regulation of miR-129-5p could attenuate EMT and angiogenesis of PCa. A previous study reported that miR-129-5p modulated EMT in tubular epithelial cells by targeting the gene PDPK1 [
36]. β-Catenin, p-β-catenin, N-cadherin and vimentin are well established as indicators of EMT, and accordingly, the poor expression of β-catenin in chondrosarcoma cells of the miR-129-5p group has been observed, which further suppressed the cell proliferation, migration and promoted apoptosis [
21]. Similarly, over-expression of miR-129-5p in the breast cancer cell line MCF-7 was found to significantly induce E-cadherin and suppress N-cadherin and vimentin expression [
37]. Corroborating these findings, we noted that poor expression of β-catenin, N-cadherin, and vimentin and high expression of E-cadherin were markers of PCa inhibition. Additionally, up-regulation miR-195 has been found to reduce VEGF level by blocking VEGF receptor 2 signaling in endothelial cells and consequently inhibiting angiogenesis, consistent with our findings [
38].
Additionally, miR-129 might play a role in inhibition of viability, proliferation, migration and invasion of PCa cells via directly suppressing E26 transformation specific-1 (ETS1), which was also provided new train of thought for us to popularize the carcinogenesis of PCa [
39]. In laryngeal cancer, miR-129-5p can mediate cell proliferation, invasiveness, and migration by suppressing the expression of STAT3 [
40]. Another study suggested that miR-129-5p mediates FNDC3B to suppress proliferation, migration and invasion of glioblastoma cells U87 cells [
41]. Overexpression of miR-129-5p alone has been found sufficient to promote apoptosis [
42]. Consistent with these findings, the current study demonstrated that up-regulated miR-129-5p could inhibit proliferation, migration, and invasion while promoting apoptosis of PCa cells.
Here, we showed that an operant mechanism of miR-129-5p in PCa involves impairment of the Wnt/β-catenin signaling pathway via down-regulation of ZIC2. The Wnt/β-catenin signaling pathway, central to tissue development in embryos and tissue maintenance in adults, is a major up-regulated signaling pathway in castration-resistant PCa [
43]. Vimentin and E-cadherin are established as Wnt/β-catenin signaling pathway-related factors [
44]. The Wnt/β-catenin signaling pathway is blocked upon down-regulation of the EMT marker vimentin [
45]. The up-regulated E-cadherin expression in microwells was found following with a downregulation of the Wnt signaling pathway and the deficiency of nuclear β-catenin as well [
46]. Consistent with former results, our data indicated over-expressed miR-129-5p and down-regulated ZIC2 reduced the expression of Wnt, β-catenin and vimentin, but restored the expression of E-cadherin, which further indicated the inhibitory role of over-expressed miR-129-5p or down-regulated ZIC2 on the Wnt/β-catenin signaling pathway.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.