Introduction
Retinopathy of prematurity (ROP) and diabetic retinopathy (DR) are common retinal neovascular blinding eye diseases [
1,
2]. Exudation, bleeding, proliferation, and other pathological changes may occur, along with severe complications such as retinal edema and exudation, vitreous hemorrhage, and retinal detachment, resulting in irreversible visual impairment and even permanent loss of vision [
3]. Preventing and treating retinal neovascularization (RNV) remains an enormous challenge. Some studies have provided novel ideas for understanding the complex pathological mechanism of RNV. The most widely accepted viewpoint is that hypoxia increases vascular endothelial growth factor (VEGF) expression and then causes neovascularization (NV). Currently, anti-VEGF therapy remains an effective pharmacotherapy and is beneficial for some ocular NV patients in clinical application. However, anti-VEGF therapy is expensive and drug-related complications such as resistance and nonresponse exist, and its application is also limited [
4‐
7]. Thus, understanding the molecular mechanisms underlying the regulation of RNV is required for the development of safe and effective antiangiogenic therapies. Integrins, a family of enzymatically inactive cell adhesion receptors, consist of 19 different α subunits and 8 different β subunits. Thus far, these subunits form at least 25 different integrins with distinct ligand-binding specificities [
8] and play significant roles in both cell-cell and cell-extracellular matrix interactions and modulate various signaling pathways involving cell adhesion, migration, differentiation, and angiogenesis [
9,
10]. Integrin α5β1 is a specific receptor of fibronectin [
9]. Both integrin α5β1 and fibronectin are upregulated in growth factor-induced NV [
11], whereas the expression of integrin α5β1 is low in quiescent vascular cells [
11,
12]. Prior research showed that integrin α5β1 inhibition by ATN-161 significantly decreased choroidal neovascularization (CNV) leakage and the size of laser-induced lesions [
13]. However, the precise mechanism by which ATN-161 ameliorates RNV remains unclear.
Apart from ischemia and hypoxia, inflammatory reactions also play an important role in RNV [
2]. The NACHT, LRR, and PYD domains-containing protein 3 (NLRP3) (formerly known as cryopyrin, NALP3) is one member of the NOD-like receptor (NLR) protein family [
14,
15]. Upon activation, NALP3 and adaptor protein apoptosis-associated speck-like protein containing a CARD (ASC) assemble a protein complex known as NALP3 inflammasome [
16]. The assembled inflammasome triggers protease caspase-1, which then cleaves and produces proinflammatory cytokines interleukin-1β (IL-1β) and IL-18 from their inactive precursor forms [
14]. Several reports have demonstrated that the activation of NLRP3 inflammasome is drawn into the inflammatory injury of retinal ischemia [
17,
18]. These data suggest that NLRP3 inflammasome may play a key role in RNV.
In this study, we aimed to determine the effect and underlying mechanism after inhibiting integrin α5β1 by ATN-161 in Tet/opsin/VEGF transgenic mice, which highly express VEGF in photoreceptors, resulting in severe NV and significant leakage causing total exudative retinal detachment in 80 to 90% of mice after treatment with doxycycline [
19,
20]. These studies may enable us to understand the molecular mechanisms of regulating RNV and lead to new potential pharmacotherapy in addition to anti-VEGF treatments for future antiangiogenic therapies.
Materials and methods
Reagents
ATN-161 (Qiangyao, St. Louis, MO and China). Primary antibody: integrin α5, NLRP3, ASC (Santa Cruz Biotechnology, Santa Cruz, CA, USA); cleaved-IL-1β (Millipore, Billerica, MA, USA); integrin β1, cleaved-caspase-1 (Abcam, Cambridge, MA, USA); β-actin (Cell Signaling Technology, Inc., Danvers, MA). Secondary antibodies (Cell Signaling Technology, Inc., Danvers, MA). Anti-mouse CD31(PECAM-1)-PE (eBioscience Inc., San Diego, CA); goat anti-rabbit immunoglobulin (IgG)-fluorescein isothiocyanate (FITC) (Santa Cruz Biotechnology). All cell culture reagents were bought from Invitrogen (Carlsbad, CA, USA).
Animals
Tet/opsin/VEGF mice were kindly provided by Professor Peter Campochiaro (Johns Hopkins Hospital, Baltimore, MD) [
19]. These double transgenic mice were completely normal until they were given a 2 mg/mL dosage of doxycycline in their drinking water to stimulate human VEGF
165 expression in photoreceptors resulting in severe NV and significant leakage, leading to total exudative retinal detachment in 80–90% of mice within 5 days [
19,
20]. The severe phenotype of retinal detachment has proven extremely useful to test efficacy of treatments [
20]. In this study, all the mice used were specific pathogen free. Animal care and all procedures were carried out on the basis of the Health Guide for Care and Use of Laboratory Animals (National Institutes), the Scientific Investigation Board approval (SYXK-2003-0026, Shanghai Jiao Tong University School of Medicine, Shanghai, China).
Quantitative reverse transcription polymerase chain reaction (RT-PCR)
RNA was extracted from retinas and human retinal endothelial cells (HRECs) samples in accordance with the manufacturer’s protocols. Assessing RNA quality and quantity, we chose 2 μg of RNA to reverse transcribe, and then obtained complementary DNA (cDNA). The cDNA was used for quantitative RT-PCR with the iQ SYBR Green mix (Roche, Basel, Switzerland) on an ABI 7500 Real-time PCR system (Applied Biosystems, CA, USA). Primers used included: mouse-integrin α5 (forward: 5′-CGTTGAGTCATTCGCCTCTGG-3′, reverse: 5′- GTGCCCGCTCTTCCCTGTC-3′) [
21], mouse-integrin β1 (forward: 5′-TGGAAAATTCTGCGAGTGTG-3′, reverse: 5′-GCATTCACAAACACGACACC-3′), mouse-NLRP3 (forward: 5′-TCCTGGTGACTTTGTATATGCGT-3′, reverse: 5′-TTCTCGGGCGGGTAATCTTC-3′), mouse-ASC (forward: 5′-GCTGAGCAGCTGCAAACGA-3′, reverse: 5′-ACTTCTGTGACCCTGGCAATGA-3′) [
22], mouse-caspase-1 (forward: 5′-TGCCTGGTCTTGTGACTTGGA-3′, reverse: 5′- CCTATCAGCAGTGGGCATCTGTA -3′) [
22], mouse-IL-1β (forward: 5′-TGCCACCTTTTGACAGTGATG-3′, reverse: 5′-AAGGTCCACGGGAAAGACAC-3′) [
23], mouse-cyclophilin A (forward: 5′-CAGACGCCACTGTCGCTTT-3′, reverse: 5′-TGTCTTTGGAACTTTGTCTGCAA-3′) [
23], human-NLRP3 (forward: 5′-CTTCAGGTGTTGGAATTAGAC-3′, reverse: 5′-GCACTTCACAGAACATCAT-3′) [
24], human-ASC (forward: 5′-TTGGACCTCACCGACAAGC-3′, reverse: 5′-TATAAAGTGCAGGCCCTGGTG-3′), human-caspase-1 (forward: 5′-GGACAAGTCAAGCCGCACA-3′, reverse: 5′- CATGTCCGAAGCAGTGAGAT-3′) [
25], human-IL-1β (forward: 5′-TGCCACCTTTTGACAGTGATG-3′, reverse: 5′-CCTATCAGCAGTGGGCATCTGTA-3′) [
24], and human-GAPDH (forward: 5′-GGGAAACTGTGGCGTGAT-3′, reverse: 5′-GAGTGGGTGTCGCTGTTGA-3′).
Western blot analysis
Proteins from retinas and cell lysate were loaded onto 8% (or 12%) sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, and then transferred to polyvinylidinedifluoride membranes (Millipore). These blots were incubated with primary antibodies against integrin α5, integrin β1, NLRP3, ASC, cleaved-caspase-1, cleaved-IL-1β, and β-actin overnight at 4 °C after 5% non-fat milk. Next, these blots were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h. An enhanced chemiluminescence kit (ECL, Millipore) was used to visualize these immunoreactive bands.
Frozen section analysis
The eyes from Tet/opsin/VEGF transgenic mice were harvested carefully (avoiding artificial retinal detachment) after 5 days treated with doxycycline, frozen in the Tissue-Tek OCT media, prepared into 10-μm-thick slices from the cornea to the optic nerve. The images were photographed with an optical microscope. The retinal detachment state of the slices around the optic nerve was examined for total retinal detachment (TRD), partial retinal detachment (PRD), or no retinal detachment (no RD) [
26].
Immunofluorescence staining
The eyes from adult Tet/opsin/VEGF transgenic mice were prepared into 10-μm-thick slices. These sections were fixed with 4% paraformaldehyde at room temperature, and then rinsed in phosphate buffered saline (PBS). After incubation in 0.5% TritonX-100, the sections were incubated in 5% bovine serum albumin, incubated with polyclonal rabbit anti-mouse-integrin α5, integrin β1, NLRP3, or ASC antibody (Santa Cruz Biotechnology), and then incubated in the mixture of FITC anti-rabbit IgG antibody (Cell Signaling Technology) and anti-mouse CD31(PECAM-1)-PE (eBioscience). After 5 min of incubation in 4′, 6-diamidino-2-phenylindole (DAPI), the sections were photographed with a fluorescence microscope. The HRECs were cultured on the cell culture slide (Millipore) and treated with 20 ng/mL VEGF alone, or in combination with 10 μM ATN-161 for 24 h. After washing with PBS, the HRECs were fixed in 4% paraformaldehyde, and then permeabilized in 0.5% Triton X-100. Subsequently, the HRECs were blocked in 5% bovine serum albumin and incubated in anti-NLRP3 or ASC antibody (Santa Cruz), followed by incubation in the FITC anti-rabbit IgG antibody (Invitrogen). After incubation of 5 min in DAPI, the cell samples were examined under a fluorescence microscope and the images were acquired.
Cell culture and stimulation
The culture conditions of HRECs (ScienCell) included an atmosphere (containing 5% CO
2, humidified, 37 °C), endothelial cell medium (supplemented with 100 U/mL penicillin-streptomycin, 5% fetal bovine serum) [
2]. The cells were incubated in media with 20 ng/mL VEGF with or without 10 μM ATN-161 for 12 h to detect NLRP3, ASC, caspase-1, IL-1β mRNA expression by RT-PCR and for 24 h to detect protein expression by western blot assay and immunofluorescence staining.
Statistical analysis
Classification data analysis used the chi-square test. Multiple comparisons used Student-Newman-Keuls method. The differences between two groups adopted the two-tailed Student’s t test. All the statistical analyses were shown using SAS 9.0 software (SAS Institute Inc., Cary, NC, USA). All data are performed as mean values ± standard error of mean (SEM). A value of P < 0.05 was deemed to be statistically significant.
Discussion
ROP and DR [
2] are common causes of vision loss associated with RNV. Currently, VEGF is known to play a significant part in neovascular diseases and anti-VEGF therapy is beneficial in patients. However, failure of anti-VEGF therapy in some patients [
27] reminds us that the molecular mechanisms of neovascular diseases need to be further explored. Integrins consist of alpha and beta subunits and form heterodimeric glycoprotein receptors through a variety of combinations mediating cell-cell or cell-extracellular matrix interactions [
28]. Integrins binding to ligands play important roles in normal cellular functions including cell proliferation, migration, and differentiation, as well as in the pathogenesis of chronic inflammation [
29]. In our study, we evaluated the effect of inhibiting integrin α5β1 expression on retinal detachment in adult Tet/opsin/VEGF mice and investigated the underlying mechanisms in vitro and in vivo. Integrin α5β1 is one member of integrin family as well as a specific receptor of fibronectin [
9]. Some tumor studies showed that integrin α5β1 is upregulated in tumor angiogenesis, but not in normal vasculature [
11]. We detected the expression levels of integrin α5β1 in Tet/opsin/VEGF mice and found an increased expression in adult mice treated with doxycycline. This was consistent with existing research results that integrin α5β1 and fibronectin were upregulated in growth factor-induced NV [
11], whereas expression of integrin α5β1 was low in quiescent vascular cells [
11,
12] and indicated integrin α5β1may play an important role in retinal detachment progression. We also explored the positional relationship between integrin α5β1 and NV in detached retinas. Immunofluorescence staining showed integrin α5β1 located in the retina near the choroid and displayed co-localization with RNV. These results showed RNV endothelial cells expressed higher integrin α5β1, implying a close relationship between integrin α5β1 and RNV. To further explore the role of integrin α5β1 in RNV, we adopted the method of inhibiting integrin α5β1 expression by ATN-161 and analyzing the effect of integrin α5β1 inhibition on massive RNV leakage-induced retinal detachment. Retinal detachment was significantly ameliorated in adult Tet/opsin/VEGF mice with integrin α5β1 blockade. This was in accordance with prior research, which showed that integrin α5β1 inhibition by ATN-161 significantly decreased CNV leakage, NV, and the size of laser-induced lesions [
13]. However, the precise mechanisms by which ATN-161 ameliorated RNV remain unclear.
We wondered how integrin α5β1 participated in massive RNV leakage-induced retinal detachment process and explored the possible mechanisms. As we know, inflammation is essential for host defense against infections, but the chronic or excessive production of IL-1β is harmful to the individual [
16,
25,
29]. Thus, targeting IL-1β or IL-1β receptor was used as a potential therapeutic approach for inflammatory diseases by targeting the NLRP3 activation pathway [
30,
31]. Several reports have demonstrated that inflammation participated in the pathogenesis of ocular NV [
32,
33] and the NLRP3 inflammasome activation was involved in the inflammatory injury of retinal ischemia [
17,
18]. Some findings indicated that inhibiting NLRP3 ameliorated ischemic injury in animal and cellular models [
34]. The central role of activation of NLRP3 inflammasome in retinal pigment epithelium cells as well as in models of age-related macular degeneration has also been reported [
35]. The activation of caspase-1 and increased expression of IL-1β were well documented in DR with an important proinflammatory role in mediating microvascular degeneration and retinal endothelial cell dysfunction [
35]. In our experiments, the mRNA and protein expression levels of NLRP3, ASC, caspase-1, and IL-1β were significantly upregulated in adult Tet/opsin/VEGF mice with doxycycline treatment. Immunostaining showed co-localization of NLRP3 (or ASC) with RNV endothelial cells, and all of them displayed more staining compared with controls. All these data suggested that NLRP3 inflammasome participated in the RNV and retinal detachment process in Tet/opsin/VEGF mice. Some research showed the invasion-integrin interaction provided the first signal for NLRP3 inflammasome activation in intestinal epithelial cells [
36]. A recent report also demonstrated that
Treponema denticola surface protein Td92 bound to α5β1 integrins, leading to the full NLRP3 inflammasome activation in THP-1 monocytes [
29]. To explore the influence of ATN-161 on NLRP3 inflammasome in vivo, the protein expression levels of NLRP3, ASC, cleaved caspase-1, and mature IL-1β were detected in the retinas from adult Tet/opsin/VEGF mice that received ATN-161 or PBS. We found a significant decrease in NLRP3, ASC, cleaved caspase-1 and mature IL-1β after inhibiting integrin α5β1 by ATN-161 in Tet/opsin/VEGF mice. The results suggested that inhibition of integrin α5β1 could reduce the NLRP3 inflammasome activation in adult Tet/opsin/VEGF mice with doxycycline treatment.
In an in vitro assay, we observed similar results, namely, a significantly increased mRNA and protein expression of NLRP3, ASC, cleavage of caspase-1, and mature IL-1β in the HRECs treated with VEGF as compared to PBS groups, and this upregulation was dramatically inhibited in the ATN-161 group. Immunofluorescence staining assays showed more staining for NLRP3 and ASC in VEGF groups and faint staining after treatment with ATN-161. The merged pictures demonstrated that NLRP3 and ASC were located in the cytoplasm of HREC, indicating that retinal endothelial cells might be the main source of NLRP3 and ASC secretion. All these data clarified that VEGF could promote the secretion of NLRP3 inflammasome; this phenomenon was reversed after inhibiting the expression of integrin α5β1 by ATN-161. However, the limitations of this study include the effects of targeting integrin α5β1 combined with anti-VEGF agents, and the precise molecular mechanisms by which NLRP3 inflammasome regulated RNV remain to be illuminated by further study.
In summary, our study elucidated that integrin α5β1 participated in significant RNV leakage-induced retinal detachment in adult Tet/opsin/VEGF mice treated with doxycycline for the first time. Intravitreous injection of ATN-161 inhibiting integrin α5β1 stifled VEGF-induced retinal detachment. The probable mechanisms include integrin α5β1 stimulated NLRP3 inflammasome expression and mature IL-1β secretion, and then resulted in severe NV and significant leakage that caused total exudative retinal detachment.
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.