Introduction
Metastasis is the principal cause of the morbidity and death of cancer patients. The incidence of brain metastasis has been increasing in recent years, especially in breast cancer and lung cancer [
1]. In the process of metastasis formation, the interaction between the metastatic tumor cells and host cells plays an important role in the microenvironment of the metastatic sites [
2]. However, a molecular mechanism for brain metastasis is poorly understood to date. In the central nervous system, activated glial cells contribute to the innate immune response and produce a large variety of different inflammatory mediators as a chronic inflammatory reaction [
3]. A similar mechanism could function in cell survival, growth, proliferation and colonization, invasion and motility of metastatic tumor cells in the microenvironment of brain metastases [
4,
5]. Among the glial cells, astrocytes are the most abundant cell population and play an important role in maintaining homeostasis of the brain [
6]. Astrocytes have been shown to produce a wide variety of cytokines including interleukin-1 (IL-1), interleukin-3 (IL-3), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), transforming growth factor-β (TGF-β), insulin-like growth factor-1 (IGF-1) and platelet-derived growth factor (PDGF) [
7‐
10]. Among them, it was suggested that IL-6, TGF-β and IGF-1 may contribute to the development of brain metastasis by breast cancer cells [
11]. As for brain metastasis by lung cancer cells, it is not known whether or not the same cytokines are involved and what the difference between brain metastases derived by breast cancer cells and lung cancer cells.
Therefore, in the present study, we examined brain pathology in an experimental model system of brain metastasis, using HARA-B cells derived from human lung cancer cells, and assessed the effects of astrocytes on the growth of HARA-B cells as well as three other non-small cell lung cancer cell lines (PC-9, QG56, and EBC-1) in vitro. Furthermore, astrocytes-derived factors conducive to tumor cell growth and their receptor expression on tumor cells were investigated.
Materials and methods
Experimental model for brain metastasis
The study was approved by the Animal Care and Use Committee at Kyushu University and carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Male 5-week-old nude mice (BALB/c
nu/
nu) (Kyudo, Kumamoto, Japan), kept in a specific pathogen-free environment, were used. A single suspension of human lung squamous cell carcinoma-derived cells (HARA-B) (2 × 10
5 cells/0.2 ml PBS) was inoculated into the left ventricle of the heart in nude mice according to the method described previously [
12]. After 4–6 weeks, brains were subjected for immunohistochemical staining.
Human tissue samples
A total of 6 paraffin-embedded samples from patients with lung tumor brain metastasis were used. All sections were obtained from the National Hospital Organization Shikoku Cancer Center. Use of the human specimens was in accordance with the University Ethics Commission. The formalin-fixed, paraffin-embedded archival tissue blocks were retrieved, and matching hematoxylin and eosin (H & E)-stained slides were reviewed and screened for representative tumor regions by a neuropathologist.
Immunohistochemistry
Nude mice were perfused transcardially with 50 ml of 10 U/ml heparin and 0.5% procaine in PBS and 4% paraformaldehyde (PFA) in PBS prior to excision of the brain. Then the brain was removed, post-fixed for 3 h, and cryoprotected for 24 h in PBS containing 20% sucrose. The brain was cut into slices (30 μm thick) using a cryostat and the sections were placed on glass slides. In order to acquire the better immunoreactive images, sections were autoclaved with 0.01 M citrate buffer solution (pH 6.0), permeabilized with 0.3% TritonX-100 in PBS for 15 min, and then blocked in BlockAce (Dainippon Pharmaceutical, Japan) for 1 h at room temperature. Sections were incubated with mouse anti-human cytokeratin monoclonal antibody (AE1/AE3 pool of cytokeratin) (Dako, Glostrup, Denmark, 1:100) at 4°C overnight. Biotinylated anti-mouse IgG (Jackson, 1:200) were incubated for 2 h at room temperature, followed by the incubation with streptavidin Alexa488 (Molecular Probes, 1:500) for 2 h at room temperature. For double-staining of cytokeratin and GFAP, sections were incubated with Cy3-conjugated anti-GFAP antibody (Sigma, USA) (1:1000) at 4°C overnight after staining of cytokeratin. Every treatment was followed by washing three times with PBS containing 0.3% TritonX-100 for 5 min. The sections were mounted in the Perma Fluor Aqueous Mounting Medium (Thermo Shandon, Pittsburgh, PA, USA) and analyzed with a confocal microscope (LSM510 META, Carl Zeiss, Co. Ltd. Germany). Z-stack images were obtained from each section by LSM 510 META and total intensity were calculated by LSM image browser.
As for human tissue samples, after removal of paraffin in xylene and rehydration in a graded of alcohols (100%, 90%, 80%, 70%, 60%), sections were incubated for 30 min in 0.05 M phosphate buffer pH 7.6 containing tripsin and KCl for antigen retrieval. Then, the sections were incubated for 1 h in 0.3% H2O2, and blocked in PBS containing 1% BSA and 5% normal donkey serum (Jackson Immuno Research Laboratories Inc., West Grove, PA, USA) for 1 h at room temperature. Then, the sections were incubated with anti-GFAP antibody (ImmunoStar) (1:15) at 4°C overnight, goat anti-rabbit IgG Alexa 568 (Molecular Probes) (1:500) for 3 h at room temperature and FITC-conjugated anti-human cytokeratin antibody (CAM5.2) (Becton–Dickinson Biosciences, New Jersey, USA) (undiluted solution) for 1 h at room temperature. Every treatment was followed by washing three times with PBS containing 0.3% TritonX-100 for 5 min. The sections were mounted in the Perma Fluor Aqueous Mounting Medium (Thermo Shandon, Pittsburgh, PA, USA) and analyzed with a confocal microscope (LSM510 META, Carl Zeiss, Co. Ltd. Germany).
Cell culture
Primary glial cell cultures were performed according to the method described previously [
13]. Briefly, the cerebral cortex obtained from 1-day-old C57BL/6 mice (Kyudo, Kumamoto, Japan) were isolated under a dissecting microscope and carefully separated from the choroid plexus and meninges. The isolated cerebral cortex were minced and treated with trypsin–EDTA solution (0.25% trypsin, 1 mM EDTA) and 1500 U DNase in Dulbecco’s modified Egle medium (DMEM; Nissui, Tokyo, Japan) at 37°C for 10 min. Cell suspensions were filtered through 70 μm pore size mesh (BD Falcon, Bedford, MA, USA) into DMEM containing 10% fetal calf serum (FCS; Hyclone, UT, USA), 2 mM L-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, 0.37% NaHCO
3, and 110 μg/ml pyruvic acid. After centrifugation, cells were filtered through 40 μm pore size-mesh (BD Falcon), plated into poly-L-lysine coated 75 cm
2 cell culture flask at the density of two brains per flask in 10 ml of DMEM, and maintained at 37°C in 10% CO
2–90% air with a change of the medium twice per week. Astrocytes were obtained after 28 days of mixed glial cell cultures as follows. After removing other glial cells by shaking the flasks, the astroglial layer was removed from the flasks by the treatment with trypsin–EDTA solution (0.06% trypsin, 0.25 mM EDTA in serum free DMEM) at 37°C for 45 min. Suspended astrocytes were filtered through 40 μm pore size-mesh and seeded. Astrocyte purity ranged from 90 to 95% as determined by immunostaining with anti-GFAP antibody (Sigma, St. Louis, MO, USA) (data not shown). Astrocytes were maintained in the same medium used for cell suspension from cerebral cortex at 37°C in 10% CO
2–90% air. HARA-B cells and other lung cancer cell lines (QG56, EBC-1; squamous cell carcinoma) and PC-9 (non-small cell lung cancer cell) were maintained under the same condition. Cells were grown in 25 cm
2 cell culture flask (Nalge Nunc International), and single-cell suspension of cells were obtained by trypsin treatment.
Cell proliferation assay
In the co-culture experiment, HARA-B cells (0.5 × 103 cells/well) and astrocytes (2.5 × 103 or 5 × 103 cells/well) were seeded into 8-well cell culture slide (BD Falcon) in DMEM for 24 h. Then, cells were rinsed twice with PBS and incubated in serum free DMEM. After 72 h of co-culture, cells were fixed with 4% PFA for 30 min at room temperature and permeabilized with 0.3% TritonX-100 in PBS for 15 min, followed with blocking solution containing 1% BSA and 5% normal donkey serum (Jackson) in PBS for 1 h at room temperature. Then cells were incubated with mouse anti-human cytokeratin monoclonal antibody (AE1/AE3 pool of cytokeratin) (Dako, Glostrup, Denmark) (1:100) at 4°C overnight, followed by the incubation with the secondary antibody (FITC-conjugated anti-mouse IgG; Sigma, 1:500) for 5 h at room temperature, and then, incubated with 300 nM 4′,6′-diamidino-2-phenylindole hydrochloride (DAPI, Sigma) for 30 min at room temperature. The number of HARA-B cells in each well, which were positively stained with an anti-human cytokeratin antibody, was counted using a digital camera system (Axio Cam, Carl Zeiss) mounted on a light and fluorescent microscope (Axopscope2 plus, Carl Zeiss). The results were expressed as the percentage of control (single cell culture of HARA-B cells).
Insert culture-medium was obtained as follows. Astrocytes (5 × 104 cells/well) were plated in 6-well cell culture plates (Falcon). Tumor cells derived from each lung tumor (EBC-1, PC9, QG56 and HARA-B cells) (5 × 103 cells/insert) were plated in cell culture-inserts (membrane pore size 0.4 μm; Becton–Dickinson), and then, placed in the well of astrocyte cultures. After 24 h of the insert-culture, cells were rinsed twice with PBS, incubated in serum-free DMEM for further 48 h. Then, the medium was collected. Each conditioned medium was centrifuged to remove debris (1500 rpm for 10 min at 4°C) before use. Tumor cells derived from each lung tumor (0.5 × 103 cells/well) were seeded into 8-well cell culture slide (BD Falcon) in DMEM for 24 h. Then, cells were rinsed twice with PBS and incubated in each Insert culture-medium. After 72 h, cells were fixed with 4% PFA for 30 min at room temperature and incubated with 300 nM DAPI for 10 min at room temperature. The number of tumor cells in each well, which were positively stained with DAPI, was counted as mentioned above. The results were expressed as the percentage of control (each tumor cells cultured in serum-free DMEM for 72 h).
The astrocyte-conditioned medium (ACM) was obtained from the primary culture of astrocytes at a density of 104 cells/well in serum free DMEM after 72 h-incubation. This ACM was centrifuged (1500 rpm for 10 min at 4°C), and then, added to HARA-B cells cultured for 1 day at a volume of 25% or 50%. The number of HARA-B cells were counted after the 72 h-incubation in the presence of ACM as described above.
HARA-B-stimulated astrocyte-conditioned medium (H-ACM) was obtained as follows. Culture medium of HARA-B cells (5 × 103 cells/well) were added to astrocytes cultures (5 × 104 cells/well) and incubated for 24 h. Then the medium was collected and centrifuged to remove debris (1500 rpm for 10 min at 4°C) before use.
In the proliferation assay using recombinant mouse cytokines, HARA-B cells 24 h after plating were rinsed twice with PBS and incubated in serum free DMEM with each cytokine (mIL-1β, 1 to 10 pg/ml; mTNF-α, 10 to 500 pg/ml; mIL-6, 10 to 500 pg/ml, Peprotech, Rocky Hill, NJ, USA). After 72 h, HARA-B cells were immunostained and counted as mentioned above.
In the experiments using neutralizing antibodies, cells were plated, rinsed twice with PBS after 24 h, and incubated in serum free DMEM with each specific neutralizing antibodies; mIL-1β antibody (ab), 0.2 to 2.0 μg/ml (R&D systems, Minneapolis, MN USA), mTNF-α ab, 0.2 to 2.0 μg/ml (R&D systems), mIL-6 ab, 2.0 to 20 ng/ml (Peprotech) for 48 h. As controls, rat IgG (Sigma) and rabbit IgG (R&D systems) were used. HARA-B cells were immunostained and counted as mentioned above.
SYBR green-based real-time quantitative RT–PCR
HARA-B cells (1 × 10
5 cells/insert) and astrocytes (1 × 10
6 cells/well) were cultured in cell culture-insert systems as mentioned above. Cells were collected by treatment with trypsin after 24, 48 and 72 h of insert-culture. As controls, single cell culture of HARA-B cells or astrocytes was used. Total RNA was isolated from each cell type by an extraction procedure using the RNA blood mini kit (QIAGEN in Japan). Contaminating DNA was removed by RNase-free DNase (QIAGEN). Single-strand cDNA was synthesized from cellular mRNA by using random 9 mer and RNA PCR kit (AMV) (Takara Bio Inc., Ootsu, Japan). PCR amplification was undertaken for plain SYBR Green I detection in using Light Cycler system (Roche Diagnostics GmbH, Mannheim, Germany). Each reaction was carried out in a total volume of 20 μl in glass capillary, containing 1 μl of cDNA, 2, 3 or 4 mM MgCl
2, 10% LightCycler-DNA Master SYBR Green I buffer (Taq DNA polymerase, reaction buffer, deoxynucleotide triphosphate mix, 10 mM MgCl
2 and SYBR Green I dye) and 0.5 μM of each primer (Table
1). After the PCR reaction, we confirmed that there was no primer dimer and non specific product in each PCR product by agarose gel electrophoresis and staining with ethidium bromide. The expression of all target genes was normalized to β-actin. Analysis was carried out with Light Cycler 3.5 software (Roche) and Microsoft Excel.
Table 1
Gene-specific primer pairs for real-time RT–PCR
Mouse |
β-actin | Sense | ACCAACTGGGACGACATGGAG | 380 |
Antisense | GTGGTG GTGAAG CTGTAGCC |
IL-6 | Sense | ACAAGTCGGAGGCTTAATTACACAT | 79 |
Antisense | AATCAG AATTG CCATTGCACAA |
IL-1β | Sense | CTCCATGAG CTTTGTACAAG G | 240 |
Antisense | TG CTG ATGTACCAGTTG GG G |
TNF-α | Sense | ATGAGCACAGAAAGCATGATCCGC | 692 |
Antisense | CCAAAGTAGACCTG CCCG GACTC |
TGF-β1 | Sense | GAG AG CCCTGG GATACCAACTACTG | 173 |
Antisense | GTGTGTCCAGG CTCCAAATGTAG |
EGF | Sense | TTTTGCCTCAGAAG GAGTGG | 150 |
Antisense | GG CCACACTTG G CAGTATATC |
IGF-I | Sense | GGACCAGAGACCCTTTGCGGGG | 209 |
Antisense | GG CTG CTTTTGTAGG CTTCAGTG G |
PDGF-B | Sense | TGAAATGCTGAGCGACCAC | 137 |
Antisense | AGCTTTCCAACTCGACTCC |
Human |
β-actin | Sense | ATG GCCACG GCTGCTTCCAG C | 237 |
Antisense | CATGGTGGTGACAGACCG CCG |
IL-6Ra | Sense | CATTGCCATTGTTCTGAGGTT | 271 |
Antisense | AGTAGTCTGTATTG CTGATGT |
gpi30 | Sense | TGGAGTGAAGAAGCAAGTGG | 303 |
Antisense | AACAGCTGCATCTGATTTGC |
TNFRI | Sense | TG CCTACCCCAGATTG AG AA | 121 |
Antisense | ATTTCCCACAAACAATGGAGTAG |
IL-1 Rtl | Sense | AAG GTG GAG G ATTCAGG ACAT | 284 |
Antisense | AG CCTATCTTTGACTCCACTA |
IL-1 ra | Sense | CAGAAGACCTCCTGTCCTATGAGG | 424 |
Antisense | GCTGTGCAGAGGAACCA |
To see the reconstituted effects of HARA-B-derived substances on astrocytic expression of TNF-α, IL-1β and IL-6, the mouse primary astrocyte cells were treated with human IL-8 (R&D systems, Minneapolis, MN, U.S.A), MIF (R&D systems), or PAI-1 (Peprotech, Rocky Hill, U.S.A) for 72 h in serum-free medium. Total RNA was extracted using an RNeasy Plus Mini kit (QIAGEN, Hilden, Germany) and QIA shredder (QIAGEN). cDNA was synthesized using a SuperScript VILO cDNA synthesis kit (Invitrogen) SYBR-Green real-time PCR (Applied Biosystems, Foster City, CA) was performed on cDNA prepared from each sample using Platinum SYBR-Green qPCR Super-Mix-UDG (Invitrogen) and 0.5 μM each primer (Table
1). Thermal cycling condition were 10 min at 95°C, 45 cycles at 95°C for 15 s, followed by 1 min at 60°C. Data Analysis was completed using the ABI PRISM 7500HT Sequence detection software (Applied Biosystems). β-actin was used for normalization.
Cytokine ELISA assay
Co-cultures of HARA-B cells (0.5 × 103 cells/well) and astrocytes (5 × 103 cells/well) or astrocytes alone (5 × 103 cells/well) were seeded into 8-well cell culture slides in DMEM with FCS for 24 h. Then, cells were rinsed twice with PBS and incubated in serum free DMEM. After 48 or 72 h of culture, each conditioned medium was collected and centrifuged to remove debris (1500 rpm for 10 min at 4°C) before use. The amount of mouse IL-1β, TNF-α and IL-6 in each conditioned medium was measured with an ELISA kit for mouse cytokines (Biosource International). The absorbency at 450 nm was measured by a Microplate Reader (Immuno-Mini NJ-2300, Nalge Nunc International).
Cytokine proteome array
HARA-B cells (1 × 106 cells) were grown in 10 cm dish (BD, Franklin Lake, NJ, U.S.A) for 24 h and culture medium was collected. Protein array analysis was performed according to the manufacture’s instruction. Positive controls were located in the upper left-hand corner (two spots), upper right-hand corner (two spots) and the lower left-hand corner (two spots) of each array kit. Medium and culture medium were measured using the human cytokine array Panel A (Proteome Profiler) (R&D systems, Minneapolis, MN, U.S.A). Horseradish peroxidase substrate (Thermo scientific, Rockford, IL, U.S.A) was used to detect protein expression and captured by exposure to X-ray Film (FUJIFILM, Tokyo, Japan).
Immunocytochemistry
HARA-B cells (0.5 × 103 cells/well) with or without astrocytes (5 × 103 cells/well) were seeded into 8-well cell culture slides in complete medium. Cells were fixed with 4% PFA for 30 min at room temperature and permeabilized with 0.3% TritonX-100 in PBS for 15 min and blocked in PBS containing 1% BSA and 5% normal donkey serum (Jackson) for 1 h at room temperature. Cells were incubated with primary antibodies, containing monoclonal mouse anti-human cytokeratin antibody (AE1/AE3 pool of cytokeratin) (Dako, 1:100), rabbit anti-human IL-6Rα antibody (Santa Cruz, CA, USA) (1:200), rabbit anti-human gp130 antibody (Santa Cruz, 1:500), rabbit anti-human IL-1RtI antibody (Santa Cruz, 1:200), and goat anti-human TNFRI (Santa Cruz, 1:100) overnight at 4°C. Control cells were incubated without primary antibody (PBS containing 1% BSA) to test non-specific staining. The cells were then incubated for 5 h at room temperature with secondary antibody, containing FITC-conjugated anti-mouse IgG (Sigma, 1:500), Cy3-conjugated anti-rabbit IgG (Jackson, 1:500) and Cy3-conjugated anti-goat IgG (Jackson, 1:500) and then for 30 min at room temperature with 300 nM 4′,6′-diamidino-2-phenylindole hydrochloride (DAPI, Sigma). Slides were mounted in the Perma Fluor Aqueous Mounting Medium (Thermo) and were analyzed with a Zeiss LSM510 META confocal microscope.
Statistical analysis
One-way analysis of variance (ANOVA) and post-hoc Bonferroni/Dunn test were used to examine the statistical differences. Differences were considered significant at P < 0.05.
Discussion
Certain cancers, i.e. breast cancer and lung cancer, are liable to metastasize in the brain. The incidence of the brain metastasis has been increasing in recent years [
1]. In the metastatic process, the microenvironment of the metastatic sites plays an important role for tumor cells to invade and proliferate in the target tissues [
2]. Such a microenvironment contains many resident cell types in addition to tumor cells as well as migratory hematopoietic cells.
Though activated astrocytes and soluble factors produced by glial cells in vivo seem to play an important role in the development of brain metastases [
5], mechanisms of brain metastases induced by lung cancer cells remained unclear.
In the present study, histological examination revealed that activated astrocytes accumulated around the metastatic foci of human lung cancer-derived cell line, HARA-B cells, in the brain. Similar accumulation of astrocytes around brain metastases was also observed in human brain section from patients with lung cancer metastasis (Fig.
8), as well as in autopsy cases [
14]. In our animal models, brain metastases were observed not two but three weeks after intracardiac inoculation of HARA-B cells, mostly in lateral cortex including hippocampus where more GFAP-positive astrocytes were observed even in control condition (data not shown). In later phase of metastases, 4-6 weeks after inoculation, more metastases were observed in whole brain, especially in cerebral cortex. These informations might be useful to understand the process of brain metastasis and its diagnosis.
From our in vitro studies, it was suggested that astrocytes, activated by tumor cells even in the absence of physical contact, promote the proliferation of lung cancer cells by releasing trophic factors. Using one of the lung cancer cell lines, HARA-B cells, IL-1β, TNF-α and IL-6 were identified as astrocyte-oriented factors. It is known that activated astrocytes produce various inflammatory cytokines. IL-1, one of the inflammatory cytokines, has been shown to stimulate the growth of tumor cells in hepatic and/or lung metastases of melanoma tumor cells in vivo [
15‐
17]. Sierra et al. [
11] demonstrated that the growth of the breast cancer cell line, which was derived from a brain metastasis, was stimulated by the astrocytes through IL-6, TGF-β and/or IGF-1 in vitro. In brain metastasis of melanoma cells, it was reported that astrocytes produce neurotrophin-regulated heparanase [
18,
19]. Recently, it was also reported that epidermal growth factor receptor (EGFR) and membrane type-1 matrix metalloproteinase (MT1-MMP) may be playing an important role in brain metastasis from lung adenocarcinoma and breast cancer [
20]. All these results suggest that tumor-promoting factors released from astrocytes are different depending on the type of tumor cells and each type of tumor cells may play a different role in the microenvironment of metastatic sites.
So far, a factor produced by HARA-B cells was only a parathyroid hormone-related protein (PTHrP) [
21]. However, application of PTHrP(1-34) (10
−6 M) alone did not stimulate the production of IL-6 in astrocytes (supplementary figure) as was already reported [
22]. It was reported that TNF-α stimulated the production of IL-6 in astrocytes and PTHrP acted in an additive fashion with TNF-α to astrocyte-induced expression of IL-6 [
22]. In our case, however, PTHrP rather attenuated the effect of TNF-α (100 pg/ml) on astrocytic expression IL-6 (supplementary figure).
In the present study, we found that the production of IL-8, MIF, and SERPINE1 (PAI-1) were markedly increased in the medium of HARA-B cell, with less amount of IL-1ra, IL-2 (Fig.
5a), which increased expression of TNF-α, IL-1β, and IL-6 in astrocytes (Fig.
5b–d). It was recently reported that IL-8, as well as IL-6, were induced in nonsmall-cell lung carcinoma (non-SCLC) cells A549 [
23]. In human lung adenocarcinoma cell line CPA-Yang2, which is highly metastasis cell line, quantitative RT–PCR showed that ESM1 (Endothelial cell-specific molecule 1), VEGF-C (Vascular Endothelial Growth Factor C), IL-6, IL-8, AR (androgen receptor) genes were overexpressed [
24]. It was also found that IL-8 and matrix metalloproteinase-9 (MMP-9) are important cytokines which are closely related to the growth and metastasis of tumor [
25]. Consistently, lung cancer patients had higher levels of serum and bronchoalveolar lavage fluid IL-6 and serum IL-8 compared to controls [
26].
As for MIF, it is a multifunctional cytokine or an autocrine- and paracrine-acting cytokine/growth factor, being overexpressed in lung cancer, and therefore one of the biomarkers of non-SCLC [
27]. The MIF receptor, CD74, was recently discovered and was found that CD74 and MIF were co-expressed in tumors in close proximity, and that co-expression of the MIF-CD74 pair was associated with both higher levels of tumor-associated angiogenic CXC chemokines and greater vascularity [
28]. Importantly, expression level of MIF, together with CD147 proteins, in non-SCLC were related to the metastasis. Survival rate was markedly lower in patients with high expression level of MIF or CD147 [
29]. It was also shown that MIF overexpression by adenovirus in human lung adenocarcinoma cells induces a dramatic enhancement of cell migration [
30].
Urokinase plasminogen activator (uPA) and its inhibitor PAI-1 stimulate angiogenesis in non-SCLC [
31] and a crucial role of PAI-1 in lung cancer invasiveness and influence on prognosis were reported [
32‐
34]. Increased PAI-1 expression and stabilization of PAI-1 mRNA in human lung epithelial and carcinoma cells were regulated by tumor suppressor protein p53 [
35]. Taken together, IL-8, MIF, and PAI-1 in lung cancer cells are important not only for invasiveness and prognosis but also as stimulants for astrocytes after brain metastasis.
Stimulated astrocytes by the factors mentioned above release IL-1β, TNF-α and IL-6. In our present study, expression of their receptors on HARA-B cells was confirmed immunocytochemically. Interestingly, the time-dependent change in the expression of receptors for each cytokine seemed different in vitro. IL-6 receptor and its subunit, gp130, were up-regulated with time, while expression of receptors for IL-1β and TNF-α were down-regulated. It was reported that leukocytes rapidly lose their surface receptors for TNF and IL-1 upon exposure to various stimuli in vitro and in fact lipopolisaccharide (LPS) induced down-regulation of monocyte and granulocyte receptors for TNF and IL-1 in humans in vivo [
36]. In parallel, the release of IL-6 looked to be delayed compared to that of IL-1β and TNF-α (Fig.
3b, c, d). Taking account of these evidences, IL-1β and TNF-α might play an important role at the beginning, then IL-6 and its receptors would become more important functionally when brain metastases take place during long period. This might be the reason why the effects of neutralizing antibodies against IL-1β and TNF-α looked apparently robust when they were added during the first 24–72 h of co-culture. Considering the long-lasting effect of IL-6, blocking IL-6 may be useful not only for autoimmune and chronic inflammatory diseases [
37] but also for brain metastasis. In vivo analyses on the effects of these cytokine blockages are now under investigation.
The role of activated microglia also needs to be investigated. It was reported that differential reactions of microglia to brain metastasis of lung cancer [
38], showing an obvious increase in the number of microglia around metastatic lung cancer mass in the brain. However, only a few microglia expressed inducible nitric oxide synthase (iNOS) and TNF-α in the region where the tumor mass was situated. In vitro study, LPS-activated microglia showed both apoptotic effect and trophic effect, depending on the concentration of supernatant. Since the mechanism would be different between LPS- and metastasis-induced microglial activation, further investigation would be necessary.
In conclusion, the present results showed that the interaction between metastatic tumor cells and activated astrocytes are important in creating a favorable microenvironment for the tumor cells in the brain. They stimulate each other; first lung tumor cells stimulate astrocytes by releasing IL-8, MIF, and PAI-1, then activated astrocytes stimulate the proliferation of tumor cells by releasing cytokines such as TNF-α, IL-1β, and IL-6. These mutual relationships may be important to understand how lung cancer cells metastasize and develop in the brain.