Skip to main content
Erschienen in: BMC Ophthalmology 1/2018

Open Access 01.12.2018 | Research article

Investigation of the anti-cataractogenic mechanisms of curcumin through in vivo and in vitro studies

verfasst von: Jing Cao, Tao Wang, Meng Wang

Erschienen in: BMC Ophthalmology | Ausgabe 1/2018

Abstract

Background

Cataract is the leading cause of blindness in elderly people worldwide, especially in developing countries. Studies to identify strategies that can prevent or retard cataract formation are urgently required. This study aimed to investigate the potential mechanism of the cytoprotective effects of curcumin in in vivo and in vitro experiments.

Methods

Male Wistar rats were randomly divided into three groups: the control group, the model group (administered 20 μmol/kg sodium selenite), and the curcumin group (pretreated with 75 mg/kg body weight curcumin 24 h prior to the administration of sodium selenite). The expression levels of heat shock protein 70 (HSP70), the activities of 8-hydroxy-2-deoxyguanosine (8-OHdG), catalase (CAT), malondialdehyde (MDA), superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px) were assessed by using RT-PCR assay and ELISA. In addition, the cell viability, cell apoptosis, and cell cycle were assessed using a CCK-8 assay and flow cytometry in in vitro studies, followed by RT-PCR analysis to identify the mRNA expression levels of caspase 3, Bcl-2 associated X (Bax), B-cell lymphoma 2 (Bcl-2), cyclooxygenase (Cox-2), c-met, and Slug.

Results

Cataract was successfully established in rats of the model group and the curcumin group through intraperitoneal injection of sodium selenite. The expression levels of HSP70 and the activities of 8-OHdG and MDA in the curcumin group were decreased compared with those in the model group, whereas the activities of CAT, SOD, and GSH-Px were significantly higher than those in the model group (P < 0.05). In the in vitro studies, the cell viability and cell apoptosis significantly increased and decreased, respectively, in the curcumin group compared with the model group. Correspondingly, the mRNA expression of caspase-3, Bax, and Cox-2 was lower in the curcumin group than in the model group (P < 0.05).

Conclusions

This study suggested that curcumin attenuated selenite-induced cataract through the reduction of the intracellular production of reactive oxygen species and the protection of cells from oxidative damage.
Abkürzungen
8-OHdG
8-Hydroxy-2-deoxyguanosine
Bax
Bcl-2 associated X
Bcl-2
B-cell lymphoma 2
CAT
Catalase
CCK-8
Cell counting kit-8
Cox-2
Cyclooxygenase
EMT
Epithelial-mesenchymal transition
FBS
Foetal bovine serum
GSH-Px
Glutathione peroxidase
H2O2
Hydrogen peroxide
HSP70
Heat shock protein
LEC
Lens epithelial cells
MDA
Malondialdehyde
NO
Nitric oxide
O2
Superoxide anion
OHs
Hydroxyl radicals
ROS
Reactive oxygen species
SOD
Superoxide dismutase

Background

Cataract is the leading cause of blindness in elderly people worldwide, especially in developing countries [1]. It is estimated that blindness owing to age-related cataracts occurs in approximately 20 million people. At present, the gold standard for the treatment of cataract is the surgical replacement of the cloudy lens with an artificial lens when the cataracts cause problems in daily life [2]. However, the surgery is not an easily accessible treatment option in many countries, especially in low and middle-income countries. Moreover, cataract surgery can cause vision-related complications and risks, such as posterior capsule opacification, especially in infants and children, and place a significant burden on healthcare systems and patients’ quality of life [35]. Although the surgical techniques and intraocular lens materials have advanced significantly in the last few decades, the outcomes have not substantially improved. Therefore, studies are urgently required to identify strategies that can prevent or retard cataract formation.
Although the nosogenesis of cataract is not clear, oxidative damage to the eye lens is thought to be an important mechanism in the initiation and progression of cataracts [6]. A series of highly reactive oxygen species (ROS), including superoxide anion (O2), nitric oxide (NO), hydroxyl radicals (OH-), and hydrogen peroxide (H2O2) has been proven to be implicated in different types of cataract formation [7]. Therefore, considerable efforts have been made to discover effective antioxidative pharmacological agents.
Curcumin, extracted from the rhizome of Curcuma longa Linn., is a natural polyphenol. It was first used as an antioxidant to prevent cataract formation in 1996 [8]. Since then, the study of curcumin as a potential anti-cataract agent has been one of the central areas of anti-cataract research [912]. Although curcumin has been studied for many years, evidenced-based research is still needed to clarify the biochemical roles in the prevention of cataract formation.
This study aimed to investigate the mechanisms involved in the potential use of curcumin to prevent cataract in in vivo and in vitro studies.

Methods

Curcumin and sodium selenite of commercially available analytical grades were purchased from Sigma China (Shanghai, China). The lens epithelial cells (LEC) of the HLEB-3 cell line were purchased from iCell Bioscience Inc. (Shanghai, China) and cultured in DMEM supplemented with 10% foetal bovine serum (FBS) in a humidified incubator maintained at 37 °C with an atmosphere of 5% CO2.

Animals and treatments

Ten-day-old male Wistar rats with an average body weight of (25.4 ± 3.7) g were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). All rats were housed at room temperature of (25 ± 1) °C and subjected to a 12/12 h day/night cycle. The rats in all groups were fed a regular diet (Shanghai SLAC Laboratory Animal Co., Ltd., Shanghai, China) with distilled water ad libitum for a period of 2 weeks. The animal experiments were approved by the ethics committee of LinYi (LW2017003).
The rats were randomly allocated into three groups: the control group (n = 6), administered physiological saline; the model group (n = 6), administered sodium selenite (intraperitoneal injection with signal dose of 20 μmol/kg body weight sodium selenite) to induce cataract; and the curcumin group (n = 6), administered a curcumin pretreatment before sodium selenite (75 mg/kg body weight curcumin, orally administered 24 h before selenium administration), as described in previous studies [11, 13]. The eyes were examined every other day.
After treatment for 2 weeks, the rats were killed by cervical dislocation under anaesthesia and the lenses were dissected out, washed with ice-cold saline, and frozen at − 70 °C until further use.

Biochemical examinations

A 10% homogenate was prepared in aqueous buffers of 0.1 M Tris-HCl (pH 7.4) and centrifuged at 10000 rpm at 4 °C for 30 min. The supernatant was isolated and used to test 8-oxo-deoxyguanosine (8-OHdG), malondialdehyde (MDA), catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px) by using ELISA kits (Nanjing Jiancheng Biological Engineering Institute, Jiangsu, China) in accordance with the manufacturer’s instructions.

Intracellular O2 concentration detection

The intracellular ROS concentration was detected in accordance with previous studies [14, 15]. Briefly, the cells in each group were stained with 5 μM DHE (dihydroethidium, Invitrogen Shanghai, China) at 37 °C in the dark for 30 min. Afterwards, the cells were examined by using a fluorescence activated cell sorter with excitation at 480–535 nm and emission at 590–610 nm.

Cell viability analysis

The HLEB-3 cells were seeded at a density of 1 × 104 cells/cm2 in a 96-well plate, grown overnight, and then administered treatment as appropriate. The cells were treated with 200 μM H2O2 (H2O2 group), 200 μM H2O2 plus curcumin (0.2 mM in 2% acetonitrile solution, H2O2 + Curcumin group) for 24 h; cells without any treatment served as the control (Control group). The cell counting kit-8 (CCK-8) solution was then added to each well and incubated at 37 °C for 4 h. At the end of this treatment, absorbance was measured at 450 nm. The cell growth inhibition rate was calculated as described in reference [16]. The assay was repeated in triplicate.

Cell cycle and cell apoptosis assay

HLEB-3 cells were seeded in 6-well plates and treated with 200 μM H2O2 (H2O2 group), 200 μM H2O2 plus curcumin (0.2 mM in 2% acetonitrile solution, H2O2 + Curcumin group) for 24 h, and cells without any treatment served as the control. The cells were harvested, washed with phosphate-buffered saline (PBS), and stained with annexin V-FITC/PI (Becton Dickinson, Franklin Lakes, NJ, USA) at room temperature for 15 min. Subsequently, the cells were analysed by using flow cytometry.
For the cell cycle analysis, the three different treatments of HLEB-3 cells were applied for 48 h. Subsequently, the cells were harvested by trypsinisation, washed twice in PBS, and fixed in 70% ethanol at 4 °C overnight. The cells were then washed, resuspended in cold PBS, and treated with staining buffer at 37 °C in the dark for 30 min. The cell cycle was analysed by using flow cytometry.

Real-time PCR

Total RNA from the lenses or cells was extracted in each group by using Trizol reagent (Sigma). RT-PCR was performed as previously described [17]. The primers for heat shock protein (HSP70), caspase-3, Bcl-2 associated X (Bax), B-cell lymphoma 2 (Bcl-2), cyclooxygenase (Cox-2), c-met, and Slug are displayed in Table 1. The reactions were conducted in triplicate and the results are shown from three independent experiments.
Table 1
The sequences of primers for RT-PCR
Primer sequence (5′-3′)
Gene
TTT CTG GCT CTC AGG GTG TT
HSP70-f
CTG TAC ACA GGG TGG CAG TG
HSP70-r
GACTTCGCCGAGATGTCCAGC
Bcl-2-f
CCGAACTCAAAGAAGGCCACAAT
Bcl-2-r
GTGCTATTGTGAGGCGGTTGT
Caspase 3-f
TCCATGTATGATCTTTGGTTC
Caspase 3-r
AGAAGGCTAAAGGAAACGAA
c-Met-f
GGACCGTCAAGAAGTAAATAAA
c-Met-r
CCCTGAGCATCTACGGTTTG
Cox-2-f
CAGTATTAGCCTGCTTGTCT
Cox-2-r
ATTTATGCAATAAGACCTATTCT
Slug-f
AGGCTCACATATTCCTTGTCACA
Slug-r
CTGACGGCAACTTCAACTGGG
Bax-f
GGAGTCTCACCCAACCACCCT
Bax-r

Enzyme-linked immunosorbent assay (ELISA)

The protein expression levels of MDA, SOD, and CAT in the three treatment groups were measured by using individual ELISA kits in accordance with the manufacturer’s instructions.

Statistical analysis

All data are expressed as the mean ± standard deviation. Comparisons between two groups were examined by Student’s t test, computed by using GraphPad Prism (GraphPad Software, San Diego, CA, USA). A value of P < 0.05 was considered to indicate statistical significance.

Results

Construction of cataract model

After the injection of sodium selenite for 2 weeks, the lens of rats in the model group took on a white appearance and lost transparency; however, the transparency of rats in the curcumin group was improved compared with those in the model group.

Determination of in vivo levels of HSP70, 8-OHdG, MDA, CAT, SOD, and GSH-Px

HSP70 levels in the lens were further determined by the RT-PCR analysis of each group. As shown in Fig. 1a, the HSP70 level in the model group was significantly higher than that in control group (P < 0.05); however, it was significantly reduced in the curcumin group, which suggested that curcumin could reverse some of the effect of selenite. To further investigate the effect of curcumin, the activities of 8-OHdG, MDA, CAT, SOD, and GSH-Px were measured by using ELISA assays. As shown in Fig. 1b–f, the activities of 8-OHdG and MDA significantly increased in the model group and the curcumin group compared with those in control group (P < 0.05). In addition, their expression levels were significantly lower in the curcumin group than those in model group (P < 0.05). The activities of CAT, SOD, and GSH-PX, showed an opposite trend in expression: a decrease in the model group and curcumin group was observed compared with those in the control group (P < 0.05). Similarly, their activities were higher in the curcumin group than in the model group (P < 0.05).

Evaluation of intracellular superoxide (O2) level by DHE

To evaluate the concentration of ROS in each group, the quantified O2 level was determined by using fluorescent DHE. As shown in Fig. 2a, the O2 level, reflected by red fluorescence, was significantly higher in the model group (P < 0.05) compared with the control group, whereas it was much more suppressed in curcumin-treated cells than those in the model group (P < 0.05).

Cell viability and apoptosis analysis

Proliferation was examined in HLEB-3 cells treated with H2O2, H2O2 plus curcumin, and untreated HLEB-3 cells. The CCK-8 assay revealed that H2O2 treatment significantly decreased the viability of HLEB-3 cells (P < 0.05), whereas curcumin treatment partly reversed this decrease (P < 0.05, Fig. 2b).
The cell cycle analysis (Fig. 2c) indicated that the proportion of HLEB-3 cells in the G1 phase was significantly reduced in the model group and that curcumin could reverse this decrease (P < 0.05). Conversely, the proportion of HLEB-3 cells in the G2 phase was remarkably increased in the model group and decreased in the curcumin group (P < 0.05). The proportion of cells in the S phase was not significantly different between all three groups (P > 0.05).
Flow cytometry was used to determine cellular apoptosis in each group. As shown in Fig. 2d, H2O2 caused an increase in the number of dead HLEB-3 cells after treatment for 24 h (12.8% vs 27.2%). However, cell apoptosis in the H2O2 plus curcumin group was decreased (17.8%) compared with that in the H2O2 group.

In vitro mRNA expression of caspase-3, Cox-2, Bax, Bcl-2, c-met, and Slug

As shown in Fig. 3, the relative mRNA expression of caspase-3, Bax, and Cox-2 was significantly increased in the H2O2 group and the H2O2 + curcumin group compared with those in the control group (P < 0.05). In addition, curcumin treatment significantly decreased the expression levels of these genes compared with the H2O2 group (P < 0.05). The mRNA expression levels of c-met and Slug were increased in the H2O2 and H2O2 + curcumin groups, but the changes were not significant (P > 0.05).

Protein expression of MDA, SOD, and CAT

The protein expression of MDA, SOD, and CAT in the three treatment groups was determined by using ELISA. As shown in Fig. 4, MDA was significantly upregulated in the H2O2 group, whereas SOD and CAT were significantly downregulated in the H2O2 group (P < 0.05). In addition, curcumin treatment could reverse the effect of H2O2 on MDA, SOD, and CAT expression (P < 0.05).

Discussion

Cataract is the leading cause of blindness in the elderly people. Although surgery can be successfully used to remove cataract, the rate of irreversible blindness caused by its complications is highly significant. Previous studies over the past few decades have neglected to screen natural compounds for the potential to ameliorate selenite-induced cataracts. In this study, we investigated the anti-cataractogenic activity of curcumin in in vivo and in vitro studies. The results showed that curcumin could reverse some of the effects of selenite through the regulation of the expression levels of HSP70 and the activities of reactive intermediates, including 8-OHdG, MDA, CAT, SOD, and GSH-Px. In addition, in vitro studies further suggested that curcumin could decrease the concentration of intracellular ROS and attenuate oxidative damage through the regulation of apoptosis-related genes.
The in vivo cataract model was established through the injection of selenium into the eye. This is a classical method for the creation of a cataract model [11, 13] and is used widely in the study of the pathogenesis of senile cataract and the effect of anti-cataract drugs [18]. The results showed that the eye lens isolated from rats injected with selenium took on a white appearance and decreased in transparency, whereas those from untreated rats did not. Interestingly, the administration of curcumin in the cataract model led to a decrease in selenite-induced turbidity in the eye lens. These results were consistent with previous studies and indicated the successful establishment of the cataract models [19].
HSP70, a major member of the Hsp family, is crucial for the maintenance of normal lens microenvironments [20, 21]. It has been widely acknowledged that one of the major triggers factors for cataract formation is the accumulation of excessive free radical generation, which leads to further oxidative stress [22]. These free radicals may cause oxidative damage in the tissue of the anterior eye segment. The expression of HSP70 in the eye lens of rats exposed to selenium was significantly upregulated in our study. This result was consistent with those of Manikandan et al. [23]. Previous studies suggested that HSP70, HSP27, and HSP40 might play a role in the protection of the lens against a variety of stimulants, including oxidative damage, heat shock, and osmotic stress [21, 24, 25]. Interestingly, our results showed that HSP70 expression in the eye lenses of rats exposed to selenium was significantly upregulated and that curcumin could suppress this expression. We hypothesized that this was because HSP70 is a stress-induced protein and curcumin decreases the oxidative stress caused by an accumulation of free radicals; therefore, HSP70 expression was decreased in curcumin group. Correspondingly, the intracellular concentration of ROS was significantly lower in curcumin-treated cells than in H2O2-treated cells in our study (P < 0.05).
In the present study, the activities of CAT, GSH-Px, and SOD were found to be significantly lower in the model group than in the control group in in vivo and in vitro experiments. However, this decrease was partly ameliorated by curcumin. Similarly, low levels of SOD were previously found in diabetic- and selenite-induced cataract models [26, 27], in which low levels of SOD caused irreversible lens damage. These results further supported the antioxidant properties of curcumin. As an end product of lipid peroxidation, MDA is considered to be a toxic compound in the eye owing to its high cross-linking ability with the lipid membrane [12, 28, 29]. Free radicals have the ability to cause lipid peroxidation, which lead to the loss of lens transparency and cataract formation [30]. A previous study demonstrated that thiobarbituric acid reactive substances, which are also the end products of lipid peroxidation, were increased by selenite-induced cataract. As the activity of MDA was decreased in the curcumin group compared with the model group, this study further demonstrated that curcumin could prevent selenite-induced cataractogenesis through a decrease in lipid peroxidation end products.
Reduced glutathione acts as the first line of defence against free radical-mediated damage. As an H2O2 scavenger, GSH-Px also acts as a membrane barrier for lipid peroxidation in the lens membrane. Studies have shown that glutathione deficiency leads to cataract in experimental animals [31] and our studies have shown that GSH-Px was reduced in the selenium-induced cataract model and increased in the curcumin group.
There are numerous studies that investigate the effect of curcumin on cataract. However, most have focused on the antioxidant effect of curcumin. In this study, we investigated the effect of curcumin on LEC apoptosis. As shown in Fig. 3, the cell viability was decreased in the model group and the percentage of apoptotic cells was increased compared with the control. However, those in the curcumin group were increased and decreased, respectively. Through the analysis of the expression of apoptosis-related genes, we found that the expression levels of caspase-3, Bax, and Cox-2 were significantly upregulated in the model group and the curcumin group compared with those in the control group (P < 0.05). However, compared with the model group, the genes were significantly depressed in the curcumin group (P < 0.05). Bcl-2, as a repressor of apoptosis, showed the opposite trend.
The caspase cascade and the heterodimerisation of Bcl-2 family proteins are central components of programmed cell death. Bcl-2 family proteins play important roles in the activation of caspases [32]. Bcl-2 and Bax are two major proteins in the Bcl-2 family that repress apoptosis and promote apoptotic functions, respectively. Selenite caused cell apoptosis and when apoptosis occurred, the expression of Bcl-2 was reduced significantly, whereas the expression of Bax was increased in the model group. However, curcumin attenuated the occurrence of apoptosis through the downregulation of Bax and the upregulation of Bcl-2 expression. These data strongly indicated that the Bcl-2 family of proteins may be involved in the process of curcumin protection from ROS-induced oxidative damage.
The epithelial-mesenchymal transition (EMT) is the change in cell phenotype from an epithelial to a fibrocytic morphology. Previous studies suggested anterior LEC underwent EMT-like changes after cataract surgery [33], but these changes might lead to further complications of posterior capsule opacification. The expression of Cox-2 and Slug is a hallmark of the EMT [34]. In our study, the expression of Cox-2 is significantly upregulated in the model group. However, this expression was reduced to a large extent by curcumin. This was somewhat consistent with a previous study that discovered cataractous LEC underwent EMT expression of Cox-2 mRNA and protein, whereas normal LEC did not [35]. As curcumin significantly decreased the expression of Cox-2, we speculated that curcumin might be useful for the prevention of posterior capsule opacification. However, the expression of Slug was not significantly reduced by curcumin. In addition, the expression of c-met was also not significantly different among groups. The molecular mechanism of these changes warranted further investigations.

Conclusions

This study investigated the cytoprotective nature of curcumin in in vivo and in vitro experiments. The results showed that curcumin attenuated selenite-induced cataract through a reduction in the intracellular production of ROS and the protection of cells from oxidative damage. This study further suggested that curcumin might greatly reduce the occurrence of cataractogenesis as well as prevent posterior capsule opacification.

Acknowledgements

None.

Funding

None.

Availability of data and materials

The data cannot be shared at this time because this is a primary research and subsequent research is continuing on based on this study.

Ethics approval

All animal experiments in this study were approved by ethics committee of LinYi (LW2017003).
Not Applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Congdon NG, Friedman DS, Lietman T. Important causes of visual impairment in the world today. JAMA. 2003;290(15):2057–60.CrossRefPubMed Congdon NG, Friedman DS, Lietman T. Important causes of visual impairment in the world today. JAMA. 2003;290(15):2057–60.CrossRefPubMed
2.
Zurück zum Zitat Lamoureux EL, Fenwick E, Pesudovs K, Tan D. The impact of cataract surgery on quality of life. Curr Opin Ophthalmol. 2011;22(1):19–27.CrossRefPubMed Lamoureux EL, Fenwick E, Pesudovs K, Tan D. The impact of cataract surgery on quality of life. Curr Opin Ophthalmol. 2011;22(1):19–27.CrossRefPubMed
3.
Zurück zum Zitat Apple DJ, Solomon KD, Tetz MR, Assia EI, Holland EY, Legler UF, Tsai JC, Castaneda VE, Hoggatt JP, Kostick AM. Posterior capsule opacification. Surv Ophthalmol. 1992;37(2):73–116.CrossRefPubMed Apple DJ, Solomon KD, Tetz MR, Assia EI, Holland EY, Legler UF, Tsai JC, Castaneda VE, Hoggatt JP, Kostick AM. Posterior capsule opacification. Surv Ophthalmol. 1992;37(2):73–116.CrossRefPubMed
4.
Zurück zum Zitat Apple DJ, Peng Q, Visessook N, Werner L, Pandey SK, Escobar-Gomez M, Ram J, Whiteside SB, Schoderbeck R, Ready EL, et al. Surgical prevention of posterior capsule opacification. Part 1: progress in eliminating this complication of cataract surgery. J Cataract Refract Surg. 2000;26(2):180–7.CrossRefPubMed Apple DJ, Peng Q, Visessook N, Werner L, Pandey SK, Escobar-Gomez M, Ram J, Whiteside SB, Schoderbeck R, Ready EL, et al. Surgical prevention of posterior capsule opacification. Part 1: progress in eliminating this complication of cataract surgery. J Cataract Refract Surg. 2000;26(2):180–7.CrossRefPubMed
5.
Zurück zum Zitat Hodge WG. Posterior capsule opacification after cataract surgery. Ophthalmology. 1998;105(6):943–4.CrossRefPubMed Hodge WG. Posterior capsule opacification after cataract surgery. Ophthalmology. 1998;105(6):943–4.CrossRefPubMed
6.
Zurück zum Zitat Spector A. Review: oxidative stress and disease. J. Ocul. Pharmacol. Ther. official journal of the Association for Ocular Pharmacology and Therapeutics. 2000;16(2):193–201.CrossRef Spector A. Review: oxidative stress and disease. J. Ocul. Pharmacol. Ther. official journal of the Association for Ocular Pharmacology and Therapeutics. 2000;16(2):193–201.CrossRef
7.
Zurück zum Zitat Babizhayev MA, Deyev AI, Linberg LF. Lipid peroxidation as a possible cause of cataract. Mech Ageing Dev. 1988;44(1):69–89.CrossRefPubMed Babizhayev MA, Deyev AI, Linberg LF. Lipid peroxidation as a possible cause of cataract. Mech Ageing Dev. 1988;44(1):69–89.CrossRefPubMed
8.
Zurück zum Zitat Awasthi S, Srivatava SK, Piper JT, Singhal SS, Chaubey M, Awasthi YC. Curcumin protects against 4-hydroxy-2-trans-nonenal-induced cataract formation in rat lenses. Am J Clin Nutr. 1996;64(5):761–6.CrossRefPubMed Awasthi S, Srivatava SK, Piper JT, Singhal SS, Chaubey M, Awasthi YC. Curcumin protects against 4-hydroxy-2-trans-nonenal-induced cataract formation in rat lenses. Am J Clin Nutr. 1996;64(5):761–6.CrossRefPubMed
9.
Zurück zum Zitat Suryanarayana P, Krishnaswamy K, Reddy GB. Effect of curcumin on galactose-induced cataractogenesis in rats. Mol Vis. 2003;9:223–30.PubMed Suryanarayana P, Krishnaswamy K, Reddy GB. Effect of curcumin on galactose-induced cataractogenesis in rats. Mol Vis. 2003;9:223–30.PubMed
10.
Zurück zum Zitat Kumar PA, Suryanarayana P, Reddy PY, Reddy GB. Modulation of alpha-crystallin chaperone activity in diabetic rat lens by curcumin. Mol Vis. 2005;11:561–8.PubMed Kumar PA, Suryanarayana P, Reddy PY, Reddy GB. Modulation of alpha-crystallin chaperone activity in diabetic rat lens by curcumin. Mol Vis. 2005;11:561–8.PubMed
11.
Zurück zum Zitat Padmaja S, Raju TN. Antioxidant effect of curcumin in selenium induced cataract of Wistar rats. Indian J Exp Biol. 2004;42(6):601–3.PubMed Padmaja S, Raju TN. Antioxidant effect of curcumin in selenium induced cataract of Wistar rats. Indian J Exp Biol. 2004;42(6):601–3.PubMed
12.
Zurück zum Zitat Manikandan R, Thiagarajan R, Beulaja S, Chindhu S, Mariammal K, Sudhandiran G, Arumugam M. Anti-cataractogenic effect of curcumin and aminoguanidine against selenium-induced oxidative stress in the eye lens of Wistar rat pups: an in vitro study using isolated lens. Chem Biol Interact. 2009;181(2):202–9.CrossRefPubMed Manikandan R, Thiagarajan R, Beulaja S, Chindhu S, Mariammal K, Sudhandiran G, Arumugam M. Anti-cataractogenic effect of curcumin and aminoguanidine against selenium-induced oxidative stress in the eye lens of Wistar rat pups: an in vitro study using isolated lens. Chem Biol Interact. 2009;181(2):202–9.CrossRefPubMed
13.
Zurück zum Zitat Doganay S, Borazan M, Iraz M, Cigremis Y. The effect of resveratrol in experimental cataract model formed by sodium selenite. Curr Eye Res. 2006;31(2):147–53.CrossRefPubMed Doganay S, Borazan M, Iraz M, Cigremis Y. The effect of resveratrol in experimental cataract model formed by sodium selenite. Curr Eye Res. 2006;31(2):147–53.CrossRefPubMed
14.
Zurück zum Zitat Pan Q, Liao X, Liu H, Wang Y, Chen Y, Zhao B, Lazartigues E, Yang Y, Ma X. MicroRNA-125a-5p alleviates the deleterious effects of ox-LDL on multiple functions of human brain microvessel endothelial cells. Am. J. Physiol. Cell Physiol. 2017;312(2):C119–30.CrossRefPubMed Pan Q, Liao X, Liu H, Wang Y, Chen Y, Zhao B, Lazartigues E, Yang Y, Ma X. MicroRNA-125a-5p alleviates the deleterious effects of ox-LDL on multiple functions of human brain microvessel endothelial cells. Am. J. Physiol. Cell Physiol. 2017;312(2):C119–30.CrossRefPubMed
15.
Zurück zum Zitat Tu LY, Bai HH, Cai JY, Deng SP. The mechanism of kaempferol induced apoptosis and inhibited proliferation in human cervical cancer SiHa cell: from macro to nano. Scanning. 2016;38(6):644–53.CrossRefPubMed Tu LY, Bai HH, Cai JY, Deng SP. The mechanism of kaempferol induced apoptosis and inhibited proliferation in human cervical cancer SiHa cell: from macro to nano. Scanning. 2016;38(6):644–53.CrossRefPubMed
16.
Zurück zum Zitat Liu HZ, Xiao W, Gu YP, Tao YX, Zhang DY, Du H, Shang JH. Polysaccharide from Sepia Esculenta ink and cisplatin inhibit synergistically proliferation and metastasis of triple-negative breast cancer MDA-MB-231 cells. Iranian J. Basic Med. Sci. 2016;19(12):1292–8. Liu HZ, Xiao W, Gu YP, Tao YX, Zhang DY, Du H, Shang JH. Polysaccharide from Sepia Esculenta ink and cisplatin inhibit synergistically proliferation and metastasis of triple-negative breast cancer MDA-MB-231 cells. Iranian J. Basic Med. Sci. 2016;19(12):1292–8.
17.
Zurück zum Zitat Mahmoud AM, Al-Alem U, Ali MM, Bosland MC. Genistein increases estrogen receptor beta expression in prostate cancer via reducing its promoter methylation. J Steroid Biochem Mol Biol. 2015;152:62–75.CrossRefPubMedPubMedCentral Mahmoud AM, Al-Alem U, Ali MM, Bosland MC. Genistein increases estrogen receptor beta expression in prostate cancer via reducing its promoter methylation. J Steroid Biochem Mol Biol. 2015;152:62–75.CrossRefPubMedPubMedCentral
18.
Zurück zum Zitat Doganay S, Turkoz Y, Evereklioglu C, Er H, Bozaran M, Ozerol E. Use of caffeic acid phenethyl ester to prevent sodium-selenite-induced cataract in rat eyes. J Cataract Refract Surg. 2002;28(8):1457–62.CrossRefPubMed Doganay S, Turkoz Y, Evereklioglu C, Er H, Bozaran M, Ozerol E. Use of caffeic acid phenethyl ester to prevent sodium-selenite-induced cataract in rat eyes. J Cataract Refract Surg. 2002;28(8):1457–62.CrossRefPubMed
19.
Zurück zum Zitat Liao JH, Huang YS, Lin YC, Huang FY, Wu SH, Wu TH. Anticataractogenesis mechanisms of Curcumin and a comparison of its degradation products: an in vitro study. J Agric Food Chem. 2016;64(10):2080–6.CrossRefPubMed Liao JH, Huang YS, Lin YC, Huang FY, Wu SH, Wu TH. Anticataractogenesis mechanisms of Curcumin and a comparison of its degradation products: an in vitro study. J Agric Food Chem. 2016;64(10):2080–6.CrossRefPubMed
20.
Zurück zum Zitat Bagchi M, Katar M, Maisel H. Effect of exogenous stress on the tissue-cultured mouse lens epithelial cells. J Cell Biochem. 2002;86(2):302–6.CrossRefPubMed Bagchi M, Katar M, Maisel H. Effect of exogenous stress on the tissue-cultured mouse lens epithelial cells. J Cell Biochem. 2002;86(2):302–6.CrossRefPubMed
21.
Zurück zum Zitat Dean DO, Kent CR, Tytell M. Constitutive and inducible heat shock protein 70 immunoreactivity in the normal rat eye. Invest Ophthalmol Vis Sci. 1999;40(12):2952–62.PubMed Dean DO, Kent CR, Tytell M. Constitutive and inducible heat shock protein 70 immunoreactivity in the normal rat eye. Invest Ophthalmol Vis Sci. 1999;40(12):2952–62.PubMed
22.
Zurück zum Zitat Spector A. Oxidative stress-induced cataract: mechanism of action. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 1995;9(12):1173–82.CrossRef Spector A. Oxidative stress-induced cataract: mechanism of action. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 1995;9(12):1173–82.CrossRef
23.
Zurück zum Zitat Manikandan R, Beulaja M, Thiagarajan R, Arumugam M. Effect of curcumin on the modulation of alphaA- and alphaB-crystallin and heat shock protein 70 in selenium-induced cataractogenesis in Wistar rat pups. Mol Vis. 2011;17:388–94.PubMedPubMedCentral Manikandan R, Beulaja M, Thiagarajan R, Arumugam M. Effect of curcumin on the modulation of alphaA- and alphaB-crystallin and heat shock protein 70 in selenium-induced cataractogenesis in Wistar rat pups. Mol Vis. 2011;17:388–94.PubMedPubMedCentral
24.
Zurück zum Zitat de Jong WW, Hoekman WA, Mulders JW, Bloemendal H. Heat shock response of the rat lens. J Cell Biol. 1986;102(1):104–11.CrossRefPubMed de Jong WW, Hoekman WA, Mulders JW, Bloemendal H. Heat shock response of the rat lens. J Cell Biol. 1986;102(1):104–11.CrossRefPubMed
25.
Zurück zum Zitat Banh A, Vijayan MM, Sivak JG. Hsp70 in bovine lenses during temperature stress. Mol Vis. 2003;9:323–8.PubMed Banh A, Vijayan MM, Sivak JG. Hsp70 in bovine lenses during temperature stress. Mol Vis. 2003;9:323–8.PubMed
26.
Zurück zum Zitat Manikandan R, Thiagarajan R, Beulaja S, Sudhandiran G, Arumugam M. Effect of curcumin on selenite-induced cataractogenesis in Wistar rat pups. Curr Eye Res. 2010;35(2):122–9.CrossRefPubMed Manikandan R, Thiagarajan R, Beulaja S, Sudhandiran G, Arumugam M. Effect of curcumin on selenite-induced cataractogenesis in Wistar rat pups. Curr Eye Res. 2010;35(2):122–9.CrossRefPubMed
27.
Zurück zum Zitat Lin D, Barnett M, Grauer L, Robben J, Jewell A, Takemoto L, Takemoto DJ. Expression of superoxide dismutase in whole lens prevents cataract formation. Mol Vis. 2005;11:853–8.PubMed Lin D, Barnett M, Grauer L, Robben J, Jewell A, Takemoto L, Takemoto DJ. Expression of superoxide dismutase in whole lens prevents cataract formation. Mol Vis. 2005;11:853–8.PubMed
28.
Zurück zum Zitat Wang K, Spector A. Alpha-crystallin can act as a chaperone under conditions of oxidative stress. Invest Ophthalmol Vis Sci. 1995;36(2):311–21.PubMed Wang K, Spector A. Alpha-crystallin can act as a chaperone under conditions of oxidative stress. Invest Ophthalmol Vis Sci. 1995;36(2):311–21.PubMed
30.
Zurück zum Zitat Yan H, Harding JJ. Glycation-induced inactivation and loss of antigenicity of catalase and superoxide dismutase. Biochem. J. 1997;328(Pt 2):599–605.CrossRefPubMedPubMedCentral Yan H, Harding JJ. Glycation-induced inactivation and loss of antigenicity of catalase and superoxide dismutase. Biochem. J. 1997;328(Pt 2):599–605.CrossRefPubMedPubMedCentral
31.
Zurück zum Zitat Fecondo JV, Augusteyn RC. Superoxide dismutase, catalase and glutathione peroxidase in the human cataractous lens. Exp Eye Res. 1983;36(1):15–23.CrossRefPubMed Fecondo JV, Augusteyn RC. Superoxide dismutase, catalase and glutathione peroxidase in the human cataractous lens. Exp Eye Res. 1983;36(1):15–23.CrossRefPubMed
33.
Zurück zum Zitat de Iongh RU, Wederell E, Lovicu FJ, McAvoy JW. Transforming growth factor-beta-induced epithelial-mesenchymal transition in the lens: a model for cataract formation. Cells Tissues Organs. 2005;179(1–2):43–55.CrossRefPubMed de Iongh RU, Wederell E, Lovicu FJ, McAvoy JW. Transforming growth factor-beta-induced epithelial-mesenchymal transition in the lens: a model for cataract formation. Cells Tissues Organs. 2005;179(1–2):43–55.CrossRefPubMed
34.
Zurück zum Zitat Medvedovic M, Tomlinson CR, Call MK, Grogg M, Tsonis PA. Gene expression and discovery during lens regeneration in mouse: regulation of epithelial to mesenchymal transition and lens differentiation. Mol Vis. 2006;12:422–40.PubMed Medvedovic M, Tomlinson CR, Call MK, Grogg M, Tsonis PA. Gene expression and discovery during lens regeneration in mouse: regulation of epithelial to mesenchymal transition and lens differentiation. Mol Vis. 2006;12:422–40.PubMed
35.
Zurück zum Zitat Chandler HL, Barden CA, Lu P, Kusewitt DF, Colitz CM. Prevention of posterior capsular opacification through cyclooxygenase-2 inhibition. Mol Vis. 2007;13:677–91.PubMedPubMedCentral Chandler HL, Barden CA, Lu P, Kusewitt DF, Colitz CM. Prevention of posterior capsular opacification through cyclooxygenase-2 inhibition. Mol Vis. 2007;13:677–91.PubMedPubMedCentral
Metadaten
Titel
Investigation of the anti-cataractogenic mechanisms of curcumin through in vivo and in vitro studies
verfasst von
Jing Cao
Tao Wang
Meng Wang
Publikationsdatum
01.12.2018
Verlag
BioMed Central
Erschienen in
BMC Ophthalmology / Ausgabe 1/2018
Elektronische ISSN: 1471-2415
DOI
https://doi.org/10.1186/s12886-018-0711-8

Weitere Artikel der Ausgabe 1/2018

BMC Ophthalmology 1/2018 Zur Ausgabe

Neu im Fachgebiet Augenheilkunde

Update Augenheilkunde

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.