Background
Methods
Subjects
Collection of blood samples and extraction of genomic DNA
Selection of the SNPs in NGF and NGFR genes
Genotyping of selected SNPs in NGF and NGFR genes
Gene | Accession | SNP ID | Primer type | Nucleotide sequence of primer (5′ → 3′) | Amplicon size, bp |
---|---|---|---|---|---|
NGF
| NG_007944 | rs6330 | reverse for standard C allele | CTGAAGTTTAGTCCAGTGGG | 187 |
reverse for minor T allele | CTGAAGTTTAGTCCAGTGGA | ||||
forward constant | CTGCATTTAGTACTCCATGAA | ||||
rs4839435 | forward for standard G allele | TGGGTGCCAAAAAGCTTGGC | 188 | ||
forward for minor A allele | TGGGTGCCAAAAAGCTTGGT | ||||
reverse constant | GCAGCTCCTGCAATTATCCA | ||||
NGFR
| AC006487 | rs11466155 | reverse for standard C allele | AGGCTATGTAGGCCACAAGG | 210 |
reverse for minor T allele | AGGCTATGTAGGCCACAAGA | ||||
forward constant | CAGAGGGCTCGGACAGCACA | ||||
rs2072446 | forward for standard C allele | GTCCACACCCCCAGAGGGCTC | 190 | ||
forward for minor T allele | GTCCACACCCCCAGAGGGCTT | ||||
reverse constant | AGCAGCCAGGATGGAGCAAT | ||||
rs734194 | forward for standard T allele | GCTGGAGCTGGCGTCTGTCT | 186 | ||
forward for minor G allele | GCTGGAGCTGGCGTCTGTCG | ||||
reverse constant | CTAGAGCTGGGAGAAATCCC |
Statistical analysis
Results
Gene SNP ID | Minor allele | MAF (frequency/number) | HWE (P) | |||
---|---|---|---|---|---|---|
IS patients | Controls | 1000 Genomes | IS patients | Controls | ||
NGF rs6330 | T | 0.406/138 | 0.205/82 | 0.248/1239 | 0.95 | 0.12 |
P = 0.06 | ||||||
NGF rs4839435 | A | 0.344/117 | 0.333/133 | 0.176/880 | 0.98 | 0.165 |
P < 0.0001 | ||||||
NGFR rs11466155 | T | 0.282/96 | 0.263/102 | 0.229/1151 | 0.5 | 0.6 |
P = 0.25 | ||||||
NGFR rs2072446 | T | 0.378/125 | 0.293/117 | 0.053/264 | 0.99 | 0.094 |
P < 0.0001 | ||||||
NGFR rs734194 | G | 0.1/34 | 0.273/109 | 0.106/533 | 0.72 | 0.26 |
P < 0.0001 |
Gene SNP (M/m) | Groups | Genotypes (number/frequency) | Model | OR (95%CI) |
P
nom
| ||
---|---|---|---|---|---|---|---|
MM | Mm | mm | |||||
NGF rs6330 (C/T) | IS patients | 60 (0.35) | 82 (0.48) | 28 (0.175) | multiplicative | 2.65 (1.996–3.5) | 7.3E-12 |
dominant | 3.39 (2.35–4.89) | 4.8E-11 | |||||
Controls | 130 (0.65) | 58 (0.29) | 12 (0.06) | recessive | 3.07 (1.65–5.72) | 0.0002 | |
additive | 3.409 (2.3–5.054) | < 0.0001 | |||||
NGF rs4839435 (G/A) | IS patients | 73 (0.43) | 77 (0.45) | 20 (0.12) | multiplicative | 1.05 (0.81–1.37) | 0.45 |
dominant | 0.98 (0.69–1.4) | 1 | |||||
Controls | 85 (0.425) | 97 (0.485) | 18 (0.09) | recessive | 1.35 (0.76–2.39) | 0.3 | |
additive | 0.851 (0.58–1.24) | 0.4 | |||||
NGFR rs11466155 (C/T) | IS patients | 86 (0.505) | 72 (0.424) | 12 (0.071) | multiplicative | 1.11 (0.84–1.46) | 0.48 |
dominant | 1.19 (0.84–1.69) | 0.32 | |||||
Controls | 110 (0.55) | 75 (0.375) | 15 (0.075) | recessive | 1.06 (0.54–2.07) | 0.86 | |
additive | 1.791 (1.15–2.79) | 0.011 | |||||
NGFR rs2072446 (C/T) | IS patients | 68 (0.4) | 79 (0.465) | 23 (0.135) | multiplicative | 1.43 (1.09–1.86) | 0.008 |
dominant | 1.68 (1.18–2.39) | 0.004 | |||||
Controls | 105 (0.525) | 73 (0.365) | 22 (0.11) | recessive | 1.3 (0.76–2.23) | 0.3 | |
additive | 2.327 (1.56–3.48) | < 0.0001 | |||||
NGFR rs734194 (T/G) | IS patients | 138 (0.81) | 30 (0.18) | 2 (0.01) | multiplicative | 3.36 (2.36–4.78) | 2.3E-12 |
dominant | 3.62 (2.42–5.42) | 1.7E-10 | |||||
Controls | 109 (0.545) | 73 (0.365) | 18 (0.09) | recessive | 7.95 (2.35–26.89) | 9.7E-5 | |
additive | 0.182 (0.11–0.32) | < 0.0001 |
(a) | |||||
r2/|D'| | NGF rs6330 | NGF rs4839435 | NGFR rs11466155 | NGFR rs2072446 | NGFR rs734194 |
NGF rs6330 | – | 0.01867 | – | – | – |
NGF rs4839435 | 0.18280 | – | – | – | – |
NGFR rs11466155 | – | – | – | 0.01859 | 0.10206 |
NGFR rs2072446 | – | – | 0.14499 | – | 0.01801 |
NGFR rs734194 | – | – | 0.34901 | 0.13786 | – |
(b) | |||||
r2/|D'| | NGF rs6330 | NGF rs4839435 | NGFR rs11466155 | NGFR rs2072446 | NGFR rs734194 |
NGF rs6330 | – | 0.06598 | – | – | – |
NGF rs4839435 | 0.28271 | – | – | – | – |
NGFR rs11466155 | – | – | – | 0.12024 | 0.07141 |
NGFR rs2072446 | – | – | 0.41654 | – | 0.08063 |
NGFR rs734194 | – | – | 0.49926 | 0.63728 | – |
(c) | |||||
Armenians/HapMap | NGF rs6330 | NGF rs4839435 | NGFR rs11466155 | NGFR rs2072446 | NGFR rs734194 |
NGF rs6330 | – | 0.01867 | – | – | – |
NGF rs4839435 | 0.012 | – | – | – | – |
NGFR rs11466155 | – | – | – | 0.01859 | 0.10206 |
NGFR rs2072446 | – | – | 0.001 | – | 0.01801 |
NGFR rs734194 | – | – | 0.002 | 0.609 | – |
NGF rs6330*T | NGFR rs2072446*T | TT(rs6330/rs2072446) | |
---|---|---|---|
Relative risk | 1.85 | 1.26 | 2.16 |
95% CI | 1.48–2.3 | 1.05–1.53 | 1.46–3.17 |
Significance level | P < 0.0001 | P = 0.001 | P = 0.0001 |