Yes-associated protein (YAP) plays a crucial role in tumour development and it is the main effector of the Hippo signalling pathway. However, the mechanism underlying YAP downregulation in laryngeal cancer is still unclear. In our previous study, we found that YAP, compared with adjacent tissues, was expressed higher in laryngeal cancer and was also closely associated with histological differentiation, TNM stage and poor prognosis.
Methods
In this study, we attempted to determine whether silenced YAP could downregulate human laryngeal carcinoma Hep-2 cells progression. YAP was downregulated in Hep-2 cells by shRNA, and the malignant ability of Hep-2 was assessed in vitro and in vivo.
Results
In vitro, CCK-8, colony formation and wound healing assays showed that downregulation of YAP significantly reduced the rates of proliferation, migration, and invasion in Hep-2 cells. Downregulation of YAP distinctly induced G2/M cycle arrest and increased the rate of apoptosis. Accordingly, western blot assay suggested that the expression of DKK1, vimentin and β-catenin was significantly decreased after YAP downregulated treatment, thereby indicating that YAP mediated the EMT programme and the Wnt/β-catenin signalling pathway in carcinoma of the larynx. Furthermore, silencing of YAP suppressed Hep-2 cell tumourigenesis and metastasis in vivo.
Conclusion
In summary, our findings demonstrated the proliferation of YAP downregulation and the invasion of Hep-2 cells via downregulating the Wnt/β-catenin pathway in vitro and in vivo, suggesting that YAP may provide a potential therapeutic strategy for the treatment of laryngeal cancer.
Hinweise
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
CCK-8
Cell counting kit-8
cDNA
complementary deoxyribonucleic acid
DMEM
Dulbecco’s modified eagle’s medium
EMT
Epithelial-mesenchymal transition
GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
IF
Immunofluorescence
IHC
Immunohistochemistry
NC
Negative control
NSCLC
Non-small cell lung cancer
PBS
Phosphate-buffered saline
PE
Phycoerythrin
qRT-PCR
quantitative real-time polymerase chain reaction
SD
Standard deviation
SEM
Standard error of the mean
shRNA
Short hairpin ribonucleic acid
TRITC
Tetramethylrhodamine
USA
United States of America
USTC
University of Science and Technology of China
WB
Western blot
YAP
Yes-associated protein
Background
Laryngeal cancer is known as the leading cause of death in otolaryngology worldwide, which accounts for 26–30% of head and neck tumours [1]. Almost 95% of the histological pathology of laryngeal cancer is squamous carcinoma, and the five-year survival rate for patients reaches 64%[2]. However, the incidence of laryngeal cancer has been increasing in recent years. The survival rate of chemotherapy-treated laryngeal cancer have been demonstrated in patients, when compared with traditional surgery [3]. Importantly, gene target therapy is regarded as a significant treatment that has shown better clinical effects for advanced laryngeal cancer with fewer side effects. Until now, we still lack an effective biomarker which affect tumour invasion, proliferation and metastasis in laryngeal cancer patients. Therefore, it is crucial to search for more effective biomarkers and therapeutic targets, which mainly aim to improve the survival of laryngeal cancer patients.
Yes-associated protein (YAP), a promoter of ligand binding, can regulate signal transduction and gene transcription in cells. It also plays a vital role in regulating tissue regeneration and cancer development [4]. Previous studies demonstrated that YAP was highly expressed in most human cancer tissues such as liver cancer [5]. Another previous study also showed that YAP could stimulate breast cancer growth via certain pathways, such as ZEB1-hTERT signaling pathway [6]. Furthermore, the expression of YAP was positively correlated with pathologic grading and clinical stages, suggesting that YAP is involved in the migration and invasion of tumours. In our previous studies [7], we found that the expression of YAP was significantly increased in LSCC and associated with the malignant status of LSCC, indicating that YAP may be a potential prognostic target in laryngeal cancer. Other relevant studies in vitro and in vivo also confirmed that downregulated YAP inhibited EMT on hepatocellular carcinoma cells [8]. Pan et al.[9] and Zygulska et al.[10] also found similar results in lung cancer and other tumours. These results showed that targeted downregulation of YAP could significantly reduce the malignant transformation ability of various tumour cells.
Anzeige
Recent studies [11] reported that epithelial-mesenchymal transition (EMT) was a distinctive feature of tumours, which was evoked during tumour invasion and metastasis. The ability of epithelial tumour cells to invade interstitial organs plays a crucial part in the development of tumours [12].
The Wnt/β-catenin signalling pathway is pivotal in embryonic development signalling while overexpression of the pathway is closely related to most human cancers [13]. It was found that the overexpression of Wnt could lead to malignant transformation of mouse mammary tissue in the earliest observation. Nowadays, the Wnt pathway evolves as a central mechanism in cancer biology [14]. Available data indicated that a loss of Wnt signalling pathway inhibitors by promoter hypermethylation might impacted NSCLC tumourigenesis and prognosis [15]. There have been recent reports about β-catenin in the cell nucleus related to EMT and tumour migration. Additionally, scientists also found that some proteins could regulate the EMT program via the Wnt/β-catenin pathway in cancer, such as ovarian cancer [16]. Overall, Wnt signalling is complex, especially because it produces factors that may impact tumour aggressiveness through interacting with other pathways [17, 18]. It is not clear whether YAP can regulate the Wnt/β-Catenin pathway and induce EMT in human laryngeal cancer Hep-2 cells, thus exploring the regulatory mechanism may provide new insights into the mechanism of YAP-impacted EMT in laryngeal cancer.
Methods
Animals
We purchased 36 BALB/c mice (mean body weight 20 g, male, aged 4 weeks,) from the Model Animal Research Center of Nanjing University, China. The animal research was completed with the approval of the Ethics Board of the University of Science and Technology of China. These BALB/c mice were kept in a specific pathogen-free environment, where humidity was maintained in the range of 50–60% and temperature was at 25 °C. Care and uses of animals were as per the principles and guidelines of the Ethics Board of the University of Science and Technology of China. After 3 weeks of respective treatment, all mice in various groups were sacrificed by over dose of diethyl.
Cell lines
The laryngeal cancer cell line Hep-2 (FH0119) was purchased from the FuHeng Biology Company (Shanghai, China). Cells were cultured in DMEM (Sangon Biotech, Shanghai, China) supplemented with 10% FBS (Gibco, Sydney, Australia), 1% Penicillin-Streptomycin Solution (Sangon Biotech, Shanghai, China) at 37 °C in the atmosphere of 5% CO2. Hep-2 cells were passaged every 2 days by using 0.25% trypsin (Sangon Biotech, Shanghai, China).
Anzeige
Lentiviral vector construction and plasmid DNA transfection
Short hairpin RNA targeting YAP and negative control shRNA were designed and chemically synthesized by the Hanbio Co. Ltd. (Shanghai, China) as shown in Table 1. Hep-2 cells were seeded at a density of 1 × 105 cells/well in twelve-well culture plates one day before transfection. Then cells were transfected by using 0.5 ml polybrene (Hanbio, Shanghai, China) in DMEM culture medium with shRNA according to the manufacturer’s instruction. Cells were incubated at 37 °C in a 5% CO2 for 4 h. Next 0.5 ml DMEM culture medium was added and cells were cultured for 24 h. A complete medium containing 2 μg/ml puromycin (Solarbio, Beijing, China) was added, and stably transfected cells were obtained by being filtrated for 2 weeks. Cells were transfected with 4 μg of YAP plasmid DNA by using LipoFiter (Hanbio, Shanghai, China) transfection reagent according to the manufacturer’s protocol. After transfection for 24 h, Hep-2 cells were collected for further researches. The expression of YAP was verified by Western Blot and qRT-PCR assay (Fig. 1).
After stable transfection, cells were digested with 0.25% trypsin for 1 min and counted by a hemocytometer. Cells (2000 cells/well) were seeded into 96-well plates with 100 μl per well of complete medium. Then, cells were incubated at 37 °C in an environment with 5% CO2. At the specific time points, before 10 μl CCK-8 (Sangon Biotech, Shanghai, China) solution was added, the medium was replaced by 100 μl fresh culture medium. After incubating 1 h at 37 °C, the absorbance was recorded at 450 nm by using GloMax DISCOVER (Promega, New York, USA). Each sample had three replicates.
Colony formation assay
One thousand cells of each group were seeded into a 6-well plate with complete medium. The colonies were visible by viewing with the eyes after 7 days. The plates were washed three times in phosphate buffered saline (PBS) after the complete medium was removed. Then the colonies were fixed in Crystal Violet Staining Solution for 15–20 min. Finally, each plate was washed three times with PBS. The experiment was performed three times.
Wound healing assay
Hep-2 cells were cultured in 6-well cell plates with complete medium until confluent. Wounds were scratched with a 100 μl pipette tip. After the cell debris was washed away by PBS, pictures of each “wound” were taken by using inverted microscope (Olympus, Tokyo, Japan). Cells were incubated in serum-free medium at 37 °C in an environment with 5% CO2. At 24 and 48 h, another picture of each “wound” was taken by inverted microscope.
Immunofluorescence (IF)
Slips in 24-well plates were fixed in 4% paraformaldehyde for 20 min after cells growing on cover it, then the cells were permeabilized with 0.5% Triton X-100 (Solarbio, Beijing, China) for 20 min at room temperature. The cells were incubated at 4 °C overnight with the primary antibody (YAP, 1:100, BOSTER, Wuhan, China) after blocking with normal donkey serum (Solarbio, Beijing, China) for 30 min at 37 °C. Then the cells were incubated for 1 h at 37 °C with TRITC-conjugated donkey anti-rabbit IgG (1200, Sangon Biotech, Shanghai, China) as the secondary antibody. The nuclei were stained by DAPI (Sangon Biotech, Shanghai, China) for 5 min after washed with PBS. Images were captured by using confocal microscope (Olympus, Tokyo, Japan).
Flow cytometry
Cells (5 × 103 cells/well) were seeded into 6-well plates overnight. An Annexin PE/7-AAD apoptosis detection kit (BD, New York, USA) was used to examine the rate of apoptosis. Data analysis was performed by using Guava easyCyte 12 (Merck Millipore, New York, USA). For cell cycle analysis, Hep-2 cells were fixed in 70% ethanol at 4 °C overnight. Then cells were stained with propidium iodide, and analysed by Guava easyCyte 12 in 1 h(Merck Millipore, New York, USA).
Total RNA was isolated from cells by using IOSPlus reagent (Takara Bio, Tokyo, Japan). On the basis of the instructions of the reverse transcriptase kit (Takara, Tokyo, Japan), cDNA was synthesized using 2 μg of the total RNA in TProfessional Thermocycler (Biometra, Berlin, German). Then, cDNA samples were subjected to qRT-PCR for 40 cycles by using TB GreenTM Premix Ex TaqTM II (Takara, Tokyo, Japan) in SLAN-96P Real-Time PCR System (HONGSHI, Shanghai, China). Primers (Table 2) were designed with the approval of the Sango Biotech Co. Ltd. (Shanghai, China). GAPDH was used as an internal control. Data of different gene were analyzed using the comparative Ct (2-ΔΔCt) method.
Table 2
Primer in this study
Gene
Forward
Reverse
YAP
GAACAATGACGACCAATAGCTC
TAGTCCACTGTCTGTACTCTCA
DKK1
TACCAGACCATTGACAACTACC
TCCATTTTTGCAGTAATTCCCG
GSK-3β
AGGAGAACCCAATGTTTCGTAT
ATCCCCTGGAAATATTGGTTGT
β-catenin
TGGATTGATTCGAAATCTTGCC
GAACAAGCAACTGAACTAGTCG
vimentin
ATGTCCACCAGGTCCGTGT
TTCTTGAACTCGGTGTTGATGG
E-cadherin
AGTCACTGACACCAACGATAAT
ATCGTTGTTCACTGGATTTGTG
GAPDH
GTATCGTGGAAGGACTCATGAC
ACCACCTTCTTGATGTCATCAT
Western blot (WB) analysis
First, total protein was extracted from the cells. Almost 50 μg of crude protein was denatured and electrophoresed on 10% SDS-PAGE gels. Proteins were transferred onto nitrocellulose membranes by electro-blotting after electrophoretic separation, followed by blocking for 1 h at room temperature in PBS with 5% nonfat milk. The blots were incubated with YAP, β-catenin, E-cadherin, vimentin, GSK-3β, DKK1 and GAPDH (information in Table 3) primary antibodies at 4 °C overnight. After wash with PBS-T, membranes were hybridized with appropriate secondary antibody (Santa, New York, USA) at room temperature for 1 h. Last, images of the western blot bands were performed with AlphaEase FC and the intensity in each group was measured with ImageJ analysis software. GAPDH was used as an internal control.
Table 3
Antibody in this study
Antibody
Ratio
Art.No.
Brand
Concentration
WB Antibody
YAP
1:400
BM4253
BOSTER
200μg/ml
DDK1
1:1000
ab61275
Abcam
1 mg/ml
GSK-3β
1:1000
12,456 T
CST
239μg/ml
β-catenin
1:1000
8480 T
CST
239μg/ml
vimentin
1:1000
5741 T
CST
239μg/ml
E-cadherin
1:1000
3195 T
CST
239μg/ml
GAPDH
1:1000
5174 T
CST
239μg/ml
IHC Antibody
YAP
1:50
BM4253
BOSTER
200μg/ml
Ki67
1:50
BM4381
BOSTER
200μg/ml
BCL-2
1:50
BM0200
BOSTER
200μg/ml
Anzeige
In vivo tumourigenicity and metastasis assays
Tumour model experiments were performed in BALB/c mice purchased from the Model Animal Research Center of Nanjing University, China. To observe the tumourigenicity, we harvested stably transfected control, YAP-shRNA and YAP-NC cells. First, 18 BALB/c mice were randomly divided into 3 groups (n = 6). Then each mouse was subcutaneously inoculated with 1 × 106 cells in the right upper limb to develop xenograft tumours. Sizes of tumours were measured every three days. In order to detect metastasis ability of Hep-2 cells, we randomly divided 18 BALB/c nude mice into 3 groups (n = 6). Then cells of control, YAP-shRNA, and YAP-NC group were injected into the tail vein of BALB/c nude mice. All mice in experiments were sacrificed after three weeks. All the experiments in vivo were performed in specific pathogen-free (SPF) conditions which was provided by the Committee on the Ethics of Animal Experiments of USTC.
Immunohistochemistry (IHC)
The sections were dewaxed and deparaffinized in xylene and rehydrated in graded alcohol solutions. Then the sections were heated for 30 min in Tris-EDTA buffer by microwave oven. Subsequently, the slides were stained with primary antibodies for YAP, Ki67, and Bcl-2 (information in Table 3) and their respective secondary antibodies. Before dehydration and mounting, the sections were counter-stained with haematoxylin. Images were performed with Olympus microscope camera (DP70, Tokyo, Japan).
Statistical analyses
The statistical software GraphPad Prism 7.0 was used to analyze significance of data. All data were collected from three or more samples for each of the experimental groups, and are presented as mean values±SEM. Two-tailed Student’s t-tests was used to determine significance when only two groups were compared. P values of less than 0.05 was considered statistically significant.
Results
Downregulation of YAP by shRNA
Specific silencing YAP by shRNA was applied to conduct loss-of function assays. Untransfected isotype Hep-2 cells (Control group) and negative control shRNA (YAP-NC shRNA) transfected Hep-2 cells were used as controls. QRT-PCR, WB and IF showed that YAP expression were decreased in the cells with small interfering RNA (YAP-shRNA group) (P < 0.05; Fig. 1). Subsequently, in YAP rescue experiment, YAP plasmid DNA transfection was retransfected into the cells with YAP-shRNA (YAP-shRNA + YAP-cDNA group), the expression of YAP was significantly elevated (P < 0.05; Fig. 1).
Anzeige
Downregulation of YAP supresses the proliferation, migration, and invasiveness of Hep-2 cells
EMT is considered to be a critical step for tumour infiltration and distant metastasis in majority carcinomas. To explore the function of YAP in Hep-2, we designed migration assay, colony formation assay and cell viability assay after stable downregulation of YAP in Hep-2 cells. Comparing the control, YAP-NC, YAP-shRNA and YAP-shRNA+YAP-cDNA groups (Fig. 2a), we found that the YAP-shRNA group had lower cell viability than others. In addition, the wounds in the YAP-shRNA group healed more slowly. However, cell migration was increased after transfection by YAP-cDNA (Fig. 2c). Furthermore, the colony formation of cells decreased in the YAP-shRNA group while the other three groups remained the same (Fig. 2b). These results indicated that downregulated YAP might inhibit growth in Hep-2 cells.
×
Downregulation of YAP increases the apoptosis and induces G2/M cell cycle arrest in Hep-2 cells
YAP-downregulated induced G2/M cell cycle arrest in Hep-2 cells (P < 0.01, Fig. 3a), and the percentage of Hep-2 was also markedly decreased in G0/G1 phase (P < 0.01, Fig. 3a). Additionally, Annexin PE/7-AAD double-staining assays showed that the rate of apoptosis in Hep-2 treated with YAP-downregulated was significantly higher than YAP-NC group, the control group and the YAP-shRNA+YAP-cDNA group (P < 0.01, Fig. 3b).
×
Downregulation of the YAP reduces mRNA and protein levels by inducing the EMT programme and Wnt/β-catenin pathway
We analysed the mRNA and protein levels of epithelial markers and mesenchymal markers after inhibition and overexpression of YAP gene in Hep-2 cells to determine whether YAP regulated translation through EMT programme and the Wnt/β-catenin pathway. To prove that the decreased expression of EMT was regulated by YAP, we also detected EMT expression level after YAP overexpression in Hep-2 cells by RT-PCR and Western Blot. Compared with other groups, we found reduced expression of vimentin and increased expression of E-cadherin at both mRNA (Fig. 4a) and protein level (Fig. 4b) after transfection by YAP-shRNA. Additionally, we investigated protein expression of DKK1, β-catenin and GSK-3β in Hep-2 cells. The expression of DKK1 and β-catenin was lower that of the control group while GSK-3β was not significantly different. In both qRT-PCR and Western Blot assay, the expression of these key proteins in the YAP-NC and YAP-shRNA+YAP-cDNA groups was similar to control. These data strongly suggested that YAP regulated the EMT programme and Wnt/β-catenin pathway in Hep-2 cells.
×
Downregulation of YAP inhibits Hep-2 tumourigenicity and metastasis in vivo
To confirm the effect of YAP in Hep-2, we generated a luciferase-labelled Hep-2 cell line (Luc-control), a stable YAP downregulation Hep-2 cell line (Luc-YAP-shRNA) and a scrambled shRNA Hep-2 cell line (Luc-YAP-NC). We then designed a tumour model in nude mice. We injected different groups with cell suspensions subcutaneously and then measured each tumour volume every three days (Fig. 5a). After 21 days, the tumours were smaller than those in the control and YAP-NC groups, suggesting that the Luc-control and Luc-YAP-NC groups grew more aggressively. We also found similar results when using the IVIS spectrum in vivo imaging system. Then, we injected Hep-2 cells into the tail vein of nude mice and observed the development of lung tumours after three weeks. We detected fewer metastatic tumors in the pulmonary tissues of the downregulated group (Fig. 5b). Moreover, IHC assay (Fig. 6) exposed that the Luc-YAP-shRNA group exhibited less YAP, Bcl-2 and KI-67 staining, indicating that YAP-downregulated suppressed tumor growth of Hep-2 in vivo. These results demonstrated that targeted YAP downregulation repressed the tumour growth and metastasis of Hep-2 cells in vivo.
×
×
Anzeige
Discussion
Laryngeal cancer is a common squamous-cell carcinoma malignancy that has the second highest incidence after nasopharyngeal cancer in otolaryngology [1]. In addition, the survival rate of patients with laryngeal cancer is low by reason of resistance to chemotherapy and radiotherapy and late metastases. Although the occurrence of cancer is a complex, multifactorial process, it is generally believed that in cancer gene activation, tumour suppressor gene inactivation and overexpression of anti-apoptotic genes are important causes of cancer. On the other side, the five-year post-treatment survival rate has remained poor [19] and the incidence of laryngeal cancer has increased [20] during the last 20 years. Thus, identifying new potential biomarkers and malignant indicators is of great urgency.
The Hippo signalling pathway is involved in the tumourigenicity of most tumours, while YAP is regarded as a vital downstream effector of the Hippo pathway. Activation of the Hippo signalling pathway leads to phosphorylation of YAP into the cytoplasm, resulting in inactivation of YAP gene transcription. The expression and nuclear localization of YAP was significantly elevated in numerous types of human cancers, such as liver cancer and lung cancer. Several recent reports have proposed that targeted YAP downregulation could restrain tumour cell proliferation and induce apoptosis, meaning that YAP might be a potential therapeutic target. Moreover, it is strongly related to histological differentiation, TNM stage, and poor prognosis. EMT can be affected by various signalling pathways, which is regarded as a critical programme in the early phase of the metastasis cascade [21]. Additionally, previous studies have indicated that EMT was required for epithelial cells to acquire malignant ability, while YAP is closely related to the EMT programme in CCA and breast cancer [22]. In our study, we found that abnormal activation of YAP caused proliferation in cancer cell, which also indicated that YAP could induce EMT in Hep-2 cells.
Wnt signalling is critical for development and homeostasis in metazoans with β-catenin being an important transcription activator, playing a pivotal role in tumour progression through the induction of epithelial-mesenchymal transition (EMT). Wnt signalling activation is important for tumourigenesis in various human cancers, some of which are with complicated signalling networks [23]. In fact, evidence from various experiments in vivo and vitro all confirmed that inappropriate activation of Wnt signalling mainly caused human neoplasia [24]. However, Wnt signalling pathway is regulated by the Hippo developmental pathway [17]. The extensive interrelationship of the Wnt and Hippo signalling pathways has emerged as an important tumourigenic signalling network in some cancer cells [25]. Moreover, YAP was recently identified as a novel Wnt regulator at the level of the destruction complex. At the same side, it was deem to be a transcriptional regulator of the Hippo pathway [26]. Increasing evidence [27] has confirmed that the close association about Wnt and Hippo signalling was emphasized by the role of YAP in the Wnt pathway.
The concept that YAP plays a crucial role in regulating the development of laryngeal cancer is further supported by our previous studies. First, targeted YAP downregulation significantly reduced the growth rate of Hep-2 and suppressed Hep-2 cell proliferation and colony formation while increasing the rate of apoptosis and inducing G2/M phase arrest in vitro. However, earlier study [28] shows that shRNA mediated downregulation of YAP induces G1 phase cell cycle arrest with apoptotic cell death. Another study [29] shows in BCPAP/KI cells siRNA mediated downregulation of YAP causes G0/G1 phase cell cycle arrest and autophasic cell death. The possible reason is that YAP-Hippo signaling pathway is regulated by different upstream pathways in cell cycle in each tumour.
Similarly, previous researches indicated that downregulating YAP suppressed proliferation and invasion of NSCLC and it might be a potential gene target for NSCLC treatment [30]. Second, in order to further investigate the potential therapeutic role of YAP in Hep-2 cells in vivo, we established subcutaneous and pulmonary metastasis tumour models based on our findings in vitro. According to our data, we revealed that downregulation of YAP prominently suppressed xenograft tumour growth and the formation of pulmonary metastatic tumors, implying that the silencing of YAP restrianed EMT-induced invasion and metastasis in Hep cells. Simultaneously, similar studies showed that YAP promotes ovarian cancer cell growth and tumourigenesis in vivo [31]. Third, we finally confirmed the role of YAP in EMT owing to elevated expression of the epithelial marker E-cadherin and reduced expression of the mesenchymal markers vimentin and β-catenin after YAP downregulation. As expected, there was an increase in mesenchymal markers and a reduction in epithelial markers due to overexpression of YAP, whereas silencing YAP had opposite effects. Other studies also found that knockdown of YAP decreased the protein level of vimentin and increased E-cadherin protein and mRNA levels in A549 cells [32]. Last, as we have shown in this study, the above data suggested a significant correlation between β-catenin mRNA and protein expression with YAP expression levels in Hep-2 cells, which verified that YAP regulated the proliferation and migration of Hep-2 via EMT and Wnt/β-catenin pathway. Moreover, high levels of biologically active YAP protein in Hep-2 cells were expected to stimulate proliferation of cancer cells and promote tumour progression. From the above, YAP may be regarded as a potential prognostic indicator and a potential anticancer molecular drug target for laryngeal cancer. Hence, the targeted-downregulation of YAP may be a logical approach for anti-tumour therapy in patients with laryngeal cancer. Nevertheless, its specific regulatory mechanism still needs further experimental exploration in the future.
Conclusion
Taken together, our previous results demonstrated that YAP was obviously overexpressed in human laryngeal cancer tissues and its expression was involved in laryngeal cancer progression [7]. We first revealed that lentivirus-mediated YAP downregulation inhibited proliferation and tumourigenesis in human laryngeal carcinoma Hep-2 cells via EMT programme and Wnt/β-catenin pathway both in vitro and in vivo, indicating that disruption of YAP by lentivirus transduction may be a promising method for laryngeal cancer therapy. Therefore, we propose that YAP may be a potential prognostic biomarker and a credible approach for anti-tumour therapy for patients with laryngeal cancer.
Acknowledgements
We would like to thank the reviewers for their helpful comments, which significantly contributed to improve the paper.
Ethics approval and consent to participate
This study received the approval of the Ethics Board of University of Science and Technology of China (USTCACUC1801049). Animals involved in the study were cared for in accordance with institutional guidelines. No cell lines used in the work presented in this paper required Ethics approval.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.