Background
By a proteomic approach, we previously identified leucine-rich alpha 2 glycoprotein (LRG) as a serum protein that is elevated in patients with active rheumatoid arthritis (RA) [
1]. There was stronger correlation between serum LRG and the 28-joint disease activity score (DAS28) in patients with RA than there was with C-reactive protein, suggesting that LRG is a promising biomarker of RA that reflects disease activity quantitatively and objectively. Since LRG contains repetitive leucine-rich sequences known to be involved in protein-protein interactions and signal transduction [
2], elevated LRG may have a role in regulating the action of other molecules and/or signal transduction. Recently, other studies [
3] and our own study [
4] have shown that LRG binds with transforming growth factor (TGF)-β and/or its receptors and modulates downstream pathways of TGF-β signaling. Moreover, pathophysiological functions of LRG have been elucidated in several disease models including pathological ocular angiogenesis [
3], myocardial infarction [
5] and cancer [
4,
6]. However, the role of LRG in autoimmune arthritis is still unclear.
TGF-β has a reciprocal function in differentiation of both T helper 17 cells (Th17) and regulatory T cells (Treg). Namely, by the stimulation of TGF-β alone, naïve T cells differentiate into “anti-inflammatory” Treg [
7,
8]. However, in conjunction with IL-6, TGF-β promotes the differentiation into “pro-inflammatory” Th17 cells [
9,
10]. Several lines of evidence indicate that the imbalance between Th17 and Treg plays important roles in the pathogenesis of RA. For instance, peripheral blood Th17 frequencies and Th17-related cytokines such as IL-17 and tumor necrosis factor (TNF)-α were significantly increased in RA patients, while Treg frequencies were decreased [
11]. Moreover, elevated levels of Th17 cells in the circulation were associated with disease activity in RA [
12] and IL-17 expression levels correlated with poor prognosis and the severity of joint destruction [
13,
14].
We previously showed that LRG can enhance TGF-β-Smad2 signaling in several cell lines. Because the importance of TGF-β-Smad2 signaling in the differentiation of helper T cells is well-documented, LRG may affect immune homeostasis by enhancing this pathway in CD4 T cells. However, the exact role of TGF-β-Smad2 signaling in CD4 T cells is still elusive and is conceivably context-dependent. Lack of Smad2 in T cells reduces TGF-β-induced upregulation of forkhead box p3 (Foxp3), a master regulator of Treg differentiation [
7,
15]. On the other hand, T cell-specific Smad2 deficiency causes a defect in the differentiation of Th17 in vitro and in vivo [
15‐
17]. Thus, even if LRG enhances Smad2 activation in T cells, it needs to be determined whether LRG exhibits an anti-inflammatory function or pro-inflammatory action.
In this study, by using collagen induced arthritis (CIA), a mouse model of rheumatoid arthritis, we aimed to elucidate the involvement of LRG in the pathogenesis of RA, especially focusing on T lymphocyte differentiation.
Methods
Generation of LRG-deficient mice
We generated LRG knockout (LRG KO) mice on a C57BL/6 background as previously described [
4]. Wild-type (WT) and LRG KO mice were maintained by in-house breeding.
CIA
CIA was performed as previously described [
18]. Briefly, complete Freund’s adjuvant was prepared by grinding 100 mg heat-killed
Mycobacterium tuberculosis (H37Ra; Difco Laboratories, Detroit, MI, USA) in 20 mL of incomplete Freund’s adjuvant (Sigma, Tokyo, Japan). Chicken type-2 collagen (Sigma) was dissolved in 10 mM acetic acid overnight at 4 °c. An emulsion was formed by combining 2 mg/mL chicken type-2 collagen in acetic acid with an equal volume of complete Freund’s adjuvant (5 mg/mL). Ten-week-old WT or LRG KO mice were injected intra-dermally at several sites into the base of the tail with 100 μL of an emulsion containing 100 μg of type-2 collagen and 250 μg of
M. tuberculosis. The same injection was repeated on day 21.
Assessment of arthritis
The macroscopic appearance of arthritis was observed up to day 70 after the first immunization. The severity of arthritis was scored in each of the four limbs per mouse on a scale of 0–4 as described previously [
19]. The criteria for grading were: 0, no evidence of erythema and swelling; 1, erythema and mild swelling confined to the mid-foot or ankle joint; 2, erythema and mild swelling extending from the ankle to the mid-foot; 3, erythema and moderate swelling extending from the ankle to the metatarsal joints; 4, erythema and severe swelling encompass the ankle, foot, and digits. The maximum arthritis score was determined as the highest arthritis score in each mouse during the experimental period.
Histological analysis
The excised joint was fixed with 10% formaldehyde. It was decalcified with Morse’s solution, and processed for routine paraffin embedding. Tissue cross-sections (5 μm) were stained with hematoxylin and eosin (HE) or safranin O in a standard manner.
Recombinant mLRG preparation
A549, human alveolar adenocarcinoma cells, were transfected with pEBMulti-neo vector (Wako, Osaka, Japan) to obtain mouse LRG-expressing cells. Cells were cultured for 72 h in serum-free RPMI medium (Wako). LRG protein secreted into culture supernatant was purified with an antibody affinity column (NHS-activated Sepharose 4 Fast Flow conjugated with anti mLRG antibody mLRA0010) and concentrated by ultrafiltration (Amicon Ultra 10 K, Merk Millipore). Concentration of LRG was determined by mouse LRG ELISA as described subsequently.
Quantitative real-time and direct reverse transcriptase PCR of messenger (m)RNA
Total RNA was isolated using the RNeasy Mini kit (Qiagen, Tokyo, Japan) according to the manufacturer’s protocol. First, 100 ng of RNA was reverse transcribed using the QuantiTect reverse transcription kit (Qiagen). For quantitative real-time reverse transcriptase PCR, standard curves for IL-17A, retinoid-related orphan receptor (ROR) γt, and hypoxanthine phosphoribosyl transferase 1 (HPRT1) were generated. Relative quantification of the PCR products was performed using ABI prism 7700 (Applied Biosystems, Darmstadt, Germany) and the comparative threshold cycle (CT) method. The level of the target gene expression was normalized to that of HPRT1 in each sample. The primers used for real-time PCR were as follows: IL17A, sense 5′-TCTCATCCAGCAAGAGATCC -3′, antisense 5′-GAATCTGCCTCTGAATCCAC -3′; RORγt, sense 5′-CCGCTGAGAGGGCTTCAC -3′, antisense 5′- TGCAGGAGTAGGCCACATTACA -3′; HPRT1, sense 5′-TCAGTCAACGGGGGACATAA-3′, antisense 5′-GGGGCTGTACTGCTTAACCAG-3′. Each reaction was performed in triplicate. The variation within samples was less than 10%.
Western blot analysis
Whole-cell protein extract was prepared from CD4 cells in radioimmunoprecipitation assay (RIPA) buffer 10 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl, 1% (v/v) NP-40, 0.1% (w/v) SDS, 0.5% (w/v) sodium deoxycholate, 1% protease inhibitor cocktail (Nacalai Tesque, Tokyo, Japan), and 1% phosphatase inhibitor cocktail (Nacalai Tesque). The extracted proteins were resolved on SDS–PAGE and transferred to an Immnobilon-P transfer membrane (Millipore, Bedford, MA, USA). The following antibodies were used: anti-phospho-Smad2 (Ser465/467) (1:1000), anti-Smad2 (D43B4) (1:1,000), anti-phospho-Smad1 (Ser463/465), anti-Smad1(D59D7), anti-phospho-p38 (Thr180/Tyr182) (1:1,000), anti-p38 (#9211), anti-phospho-STAT3 (D3A7)/STAT3 (C-20) (1:1,000) (total STAT3 was from Santa Cruz, Santa Cruz Biotechnology, CA, USA. Other antibodies were from Cell Signaling Technology, Danvers, MA, USA); anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:2,000) (Santa Cruz Biotechnology). This was followed by treatment with 1:5000 diluted anti-rabbit horseradish-peroxidase-conjugated secondary antibodies (Cell Signaling Technology) and visualization using the Chemi-Lumi one L reagent (Nacalai Tesque). Band intensities were quantified with ImageJ 1.34.
ELISA
The concentrations of IL-17, IL-6, IL-10, IL-21, Interferon gamma (IFN-γ),TNF-α (Biolegend, San Diego, CA, USA), soluble IL-6 receptor (IL6Ra) (R&D systems, Minneapolis, MN, USA) and anti-chicken type II collagen IgG antibody (Chondrex, inc., Redmond, WA, USA) in mouse sera on day 27 and cell culture supernatants were determined by ELISA according to the manufacturer’s protocol. The levels of serum LRG on day 27 were analyzed by sandwich ELISA using two antibody clones (mLRA0010 and rLRA0094) as described before [
20].
T cell differentiation
Naïve CD4+CD25-CD62L+ T cells were isolated from spleen and lymph nodes using FACS Aria (BD bioscience, San Jose, CA, USA). PerCPCy5.5-conjugated anti-CD4 (GK1.5), fluorescein isothiocyanate (FITC)-conjugated anti-CD25 (7D4), phycoerythrin (PE)-conjugated anti-CD62L (MEL-14) were purchased from Biolegend. The naïve T cells were cultured in DMEM (Wako, Osaka, Japan) supplemented with 10% fetal bovine serum (Biowest, Nuaillè, France) and penicillin G and streptomycin. Naïve T cells were activated with anti-CD3/CD28 beads (Life Technologies, Oslo, Norway), anti-IL-4 (10 μg/mL) (Biolegend), and anti-IFNγ (10 μg/mL) neutralizing antibodies (Biolegend) and were polarized with cytokines to generate Treg (TGF-β: 0.125 or 0.5 ng/mL, Peprotech, Inc, Rocky Hill, NJ, USA) or Th17 (TGF-β: 2 ng/mL and IL-6: 100 ng/mL, Peprotech, Inc) in the presence or absence of LRG. Cells were harvested on day 3 for analysis.
For determination of the differentiation of CD4+ T cells, inguinal lymphoid cells were isolated on day 27, and cultured in the presence of type-2 collagen (Chondrex,Inc. Redmond, WA, USA) for 3 days. Then, T cell subsets were analyzed by flow cytometry.
Flow cytometry
For intracellular cytokine staining, cells were treated with 50 ng/mL phorbol-12-myristat-13-acetate (PMA) and 500 ng/mL ionomycin, in the presence of 3 μM goldi-stop (BD bioscience) for 4 h. Flow cytometric analysis of T cells was performed with PerCPCy5.5-conjugated anti-CD4 (GK1.5), allophycocyanin (APC)-conjugated anti-IL17 (TC11-18H10.1), PE-conjugated anti-IL6 receptor alpha (D7715A7), and PE-Cy7-conjugated anti-IFNγ (XMG1.2) from Biolegend (San Diego, CA, USA). eFlour450-conjugated anti-Foxp3 (FJK16S) and PE-conjugated gp130 (KGP130) were from eBioscience (San Diego, CA, USA).
Splenocytes were isolated and stimulated by IL-6 for 30 minutes for phosphorylated STAT3 analysis. These cells were fixed by 4% paraformaldehyde for 10 minutes at room temperature and permeabilized by ice-cold 90% methanol for 30 minutes. Cells were stained by Alexa Fluor-conjugated anti-phosphorylate STAT3 (py705, BD bioscience), PE-conjugated anti-CD25, and PerCPcy5.5-conjugated anti-CD4.
Immunohistochemical analysis
Immunohistochemical analysis of joints was performed according to our previous report [
20]. Briefly, 5-μm-thick paraffin sections were de-waxed, rehydrated and incubated for 16 h in citrate buffer (10 mM citric acid, pH6.0) at 60 °C for antigen retrieval. Sections were treated with 0.3% H2O2/MeOH, then blocked with Blocking One (Nacalai Tesque) and incubated with anti-LRG1 polyclonal antibody (clone R322, IBL, Gunma, Japan) overnight at 4 °C. After washing, the reaction was visualized by adding ABC solution followed by diaminobenzene (DAB) substrate (Vector Laboratories, Burlingame, CA, USA). All sections were counterstained with hematoxylin.
For naïve T cell immunocytochemical staining, isolated CD4+CD25-CD62L+ naïve T cells were placed onto a glass slide by cytospin. These cells were fixed by 4% paraformaldehyde for 10 minutes, blocked with Blocking One (Nacalai Tesque) for 1 h and then incubated with anti-IL-6 receptor monoclonal antibody (Bioss, Inc. Woburn, MA, USA) for 1 h at room temperature. The reaction was visualized by adding ABC solution followed by DAB substrate (Vector Laboratories, Burlingame, CA). All specimens were counterstained with hematoxylin.
Statistical analysis
Statistical analysis of serum LRG was performed by one-way analysis of variance followed by Dunnett’s test. The assessment of arthritis was statistically analyzed using the Mann-Whitney U test. The levels of phosphorylated Smad2 relative to total Smad2 were analyzed by one-way analysis of variance followed by the Bonferroni test. Other statistical analyses were performed using the two-tailed Student’s t test. P < 0.05 was considered statistically significant.
Discussion
We previously reported that LRG binds with TGF-β and modulates the TGF-β-induced smad2 pathway [
4]. Consistent with this observation, we confirmed that LRG enhanced the phosphorylation of Smad2 in naive CD4 T cells in this study. Accumulating evidence indicates that the Smad2 pathway plays important but complicated roles in naïve CD4 T cell differentiation. Smad2 phosphorylation induces the expression of Foxp3, which promotes Treg differentiation and immune suppression by interfering with RORγt, a critical transcriptional factor of Th17 [
16]. Smad2, on the other hand, also acts as a positive regulator of Th17, which plays critical roles in chronic inflammation including in RA [
25,
26]. By mediating TGF-β-induced IL-6R expression [
17], Smad2 can enhance IL-6-STAT3 signaling, which represses the function of Foxp3 and initiates Th17 differentiation [
9,
27]. Thus, it is likely that Smad2 directs the differentiation of naïve CD4 T cells toward Treg or Th17, depending on the absence or presence of IL6, respectively. Thus, LRG, as an enhancer of Smad2 activation, can regulate Treg and Th17 differentiation dependently on the cytokine milieu.
IL-6 is a pro-inflammatory cytokine that is critically involved in the pathogenesis of RA. Levels of IL-6 in both serum and synovial fluid are elevated in RA patients and are associated with disease activity [
28,
29]. Moreover, anti-IL-6 receptor antibody treatment induces significant amelioration in the clinical symptoms of arthritis, accompanied by a decrease in Th17 cells [
30]. In the present study, we confirmed the elevation of IL-6 in the active stage of CIA. In addition, our findings indicate that LRG promotes the differentiation of Th17 rather than Treg in vitro when both TGF-β and IL-6 are present. Thus, in the CIA model and probably in RA in which excessive IL-6 production is detectable, LRG likely enhances Th17 differentiation and promotes joint inflammation by augmenting Smad2 activation. This notion is consistent with the previous findings that T-cell-specific deficiency of Smad2 leads to impaired Th17 differentiation and alleviated clinical symptoms in mouse disease models including experimental autoimmune encephalomyelitis and CIA [
16,
31].
Interestingly, high levels of IL-6R are detectable in naïve CD4 T cells, but the expression is diminished during inflammation [
32]. In the pathogenesis of arthritis, it is likely that IL-6 signals are particularly important for the initial priming of CD4+ T cells, because our group previously revealed that anti-IL-6R antibody treatment on day 0 of CIA inhibited both Th17 induction and arthritis, but administration on day 14 had no effect [
33]. In addition, Nish et al. recently reported that T-cell-specific ablation of IL-6R was sufficient to abrogate Th17 differentiation [
33]. These findings collectively suggest that IL-6R expression in naïve CD4 T cells is critically important for the initial stage of Th17 differentiation. Our data showed that the expression of IL-6R is reduced in naïve CD4 T cells in LRG KO mice. Moreover, in this study, we observed that LRG increases the expression of IL-6R in CD4 T cells after TGF-β stimulation and even more after Th17 priming. Thus, LRG can support Th17 differentiation by maintaining IL-6R expression in naïve CD4 T cells. In addition to this, LRG might enhance the Th17 cell differentiation via p38 signaling, given that the p38 pathway regulates the differentiation of Th17 cells [
34].
Besides the role in Th17 cell differentiation, IL-6 signal is reported to be involved in the survival of CD4 T cells [
35]. In addition, T-cell-specific deletion of IL-6R causes a defect in T cell proliferation [
36]. Our study showed the enlargement of inguinal lymph nodes was suppressed in LRG KO mice compared with WT mice. One possible reason for this is that LRG deficiency might lead to enhanced apoptosis and impaired proliferation of CD4 T cells due to reduced IL-6R expression. Furthermore, we revealed that LRG could enhance the phosphorylation of p38, a crucial pathway of cell proliferation and survival. Therefore, decreased p38 signaling in CD4 T cells might also contribute to the attenuated lymph node response in LRG KO mice.
Our data indicate that LRG promotes Treg polarization in vitro. However, whereas LRG deficiency resulted in a reduction in Th17 cells during CIA in vivo, the frequency of Tregs was not affected either in non-treated or collagen-immunized mice. This may be due to the difference between Treg and Th17 cells in TGF-β dependency. Under the normal condition, the majority of Treg cells are thymus-derived Foxp3+ Treg cells. Although TGF-β is critical for Foxp3 induction in naïve CD4 T cells in the periphery, it is less important in the development of thymus-derived Treg cells [
37]. We therefore consider that thymus-derived Treg cells might mask a defect in TGF-β-induced Treg development due to LRG deficiency.
In this study, we showed that arthritis in LRG KO mice was significantly reduced at the onset of the symptoms. We then determined the influence of LRG on the initiation of adaptive immune responses, focusing on the differentiation of naïve CD4 T cells. However, taking into consideration the remarkable suppression of arthritis in LRG KO mice throughout the course of the disease, LRG might play other important roles in the pathogenesis of arthritis. To examine a possible defect in humoral immune response in LRG KO mice, we measured anti-collagen antibodies. However, these antibody levels were similar in LRG KO and WT mice, suggesting that the humoral immune response to collagen is not altered in LRG KO mice. Previous reports showed that LRG is expressed in neutrophils, co-localized with myeloperoxidase in their granules and involved in their differentiation and activation [
38,
39]. Interestingly, the gene for human LRG localizes to chromosome 19p13.3, where the genes for primary neutrophil granule enzymes also localizes [
39]. In addition, because IL-17 produced by Th17 recruits neutrophils by inducing neutrophil chemoattractants [
40], LRG may indirectly enhance neutrophil migration into the joints. Given that activated neutrophils are found in synovial tissue in RA and play critical roles in joint destruction [
41], LRG may enhance arthritis by regulating neutrophil development, recruitment and function. Furthermore, previous studies showed that LRG can promote angiogenesis in damaged tissue [
3,
5] by modulating TGF-β signaling in endothelial cells. In RA, hypoxia in synovium likely induces synovial angiogenesis [
42], which pivotally contributes to the pathogenesis of disease in the joints [
43]. Hypoxia-inducible factor (HIF)1-α, which is highly expressed in the synovium in RA, regulates the expression of pro-angiogenic mediators including endoglin [
44]. In addition, LRG is abundantly expressed in inflammatory lesions in CIA and other diseases [
20,
45], where the expression is likely mediated by various inflammatory cytokines such as IL-6, IL-22, TNFα, and IL-1β [
1]. It is suggested that LRG binds with endoglin in endothelial cells and promotes angiogenesis by enhancing pro-angiogenic Smad1/5/8 signaling of TGF-β [
3]. Therefore, LRG might facilitate intracapsular inflammation by orchestrating many cell types such as CD4 T cells, neutrophils and endothelial cells.
Acknowledgements
This work was supported in part by the Practical Project for Rare/Intractable Diseases from Japan Agency for Medical Research and Development (15ek0109045h0002), the JSPS KAKENHI Grant-in-Aid for Young Scientists (Start-up)(15H06918), Grant-in-Aid for Scientific Research (17H04215) and Bristol-Myers Squibb Foundation Grants.