Background
Hypertension is the second leading cause of end-stage renal disease [
1], resulting in hypertensive nephropathy, which usually starts with glomerulosclerosis [
2,
3]. The pathophysiologic process is associated with structural changes to renal glomeruli due to mesangial cell (MC) proliferation and abnormal accumulation of extracellular matrix (ECM) [
3,
4]. Angiotensin II (Ang II), the main effective peptide in the rennin-angiotensin system (RAS) is considered a key mediator in the development of hypertensive glomerulosclerosis [
3,
5]. RAS regulates the proliferation of MCs and increases the production of ECM, mainly through the induction of glomerular hypertension, as well as non-hemodynamic effects, which include the production of reactive oxygen species, up-regulation of profibrotic growth factors, such as platelet-derived growth factor (PDGF), transforming growth factor-β1 (TGF-β1), tumor necrosis factor-α (TNF-α) and connective tissue growth factor, and macrophage activation and infiltration [
3,
6‐
8].
Aldose reductase (AR), a member of the aldo-ketoreductase super family, catalyzes the conversion of glucose to sorbitol dependent on NADPH in the first step of the polyol pathway [
9]. AR can be activated by TGF-β1, oxidative stress and inflammation [
9‐
12], to stimulate proliferation of MCs and deposition of ECM induced by TGF-β1 and PDGF [
13‐
16]. An over-expression of AR was observed in the renal tissue of spontaneous hypertensive rats (SHR) in our previous study [
12]. AR might be involved in the pathological process induced by Ang II in MCs.
Cortex Eucommiae (
Du-zhon g), the dried bark of the
Eucommia ulmoides Oliv. (Family: Eucommiaceae), has been served as a traditional tonic medicine and is thought to benefit the liver and kidney, strengthen tendons and bones, and prevent miscarriage [
17]. The natural products that have been identified from
Du-zhong include lignans, iridoids, flavonoids, polysaccharides, terpenes and protein [
18], which possess various pharmacological effects, including antihypertensive, antioxidant, antimicrobial, and anti-inflammatory properties [
9,
18]. We previously confirmed that lignans were the effective fraction of
Du-zhong for antihypertension [
10,
19]. Further study showed that both N-acetyl-β-D-glucosaminidase enzyme activity and the ratio of albumin to urinary creatinine decreased in spontaneous hypertensive rat (SHR)-treated with
Eucommia lignans [
12].
Eucommia lignans also inhibited the expression of collagen type III (Col III) in the glomerular basement membrane, and diminished the over-expression of AR in the kidney [
11]. Accordingly, we hypothesized that lignans decreased the production of Col III by affecting AR expression and thus decreased damage to the glomerular structure [
12].
This study aims to investigate the effects of lignans extracted from the bark of Eucommia ulmoides Oliv. On Ang II-induced proliferation and extracellular matrix biosynthesis in rat mesangial cells, and attempted to elucidate the mechanisms by which Eucommia lignans from Du-zhong protecting against hypertensive renal injury in vitro.
Methods
Materials and reagents
RPMI-1640 medium, newborn calf serum (NCS), RT-qPCR kits with Platinum® SYBR® Green qPCR Super Mix-UDG, and primers for collagen I (Col I), Col III, collagen type IV (Col IV), fibronectin and AR were purchased from Invitrogen (Carlsbad, CA, USA). Antibodies for Col I, Col III, Col IV, fibronectin and AR for western blotting were supplied by Abcam (Cambridge, England) and Santa Cruz Biotechnology Inc. (CA, USA). The Cell Titer 96® Aqueous One Solution Proliferation Assay for the 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) method was provided by Promega (Madison, WI, USA). A Revert Aid First Strand cDNA Synthesis Kit was purchased from Thermo Scientific (Austin, TX, USA). Losartan was obtained commercially from the National Institute for Food and Drug Control (Beijing, China). Human Angiotensin II and other analytical grade reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA).
Eucommia lignans were extracted at our own laboratory as described previously [
12,
19,
20].
E. ulmoides were obtained from Changsha Medical Company (Hunan, China) in July 2009, and authenticated by Dr. Dong-Sheng Ouyang, one of the authors according to the methods described in the literature [
21]. A voucher specimen of
Eucommia ulmoides Oliv. (IBSC_0345347) was deposited at South China Botanical Garden Herbarium, Guangdong, China. Briefly, fresh
Eucommia ulmoides Oliv. bark was cut into pieces and extracted with 60% ethanol purchased from Changsha Tianshun Chemical Co., Ltd (Hunan, China) at 70°C for 2 h (twice). The extract was subjected to macroporous resin supplied by Haiguang Chemical Industrial Company (Tianjin, China) and eluted with 80% ethanol after treatment with pure water as the eluent. The eluent was freeze-dried to powder and stored at 4°C. The lignans content in
Eucommia lignans was 71%, as determined by spectrophotometry on a Beckman Coulter DU 640 spectrophotometer (Beckman Coulter, Inc. USA) at 277 nm, with pinoresinoldiglucoside used as the control which was supplied by college of chemistry and chemical engineering in Central South University (Hunan, China).
Cell culture
RMCs (HBZY-1 cells) were purchased from China Center for Type Culture Collection (Wuhan, China). After recovery, RMCs were cultured in RPMI-1640 medium supplemented with 10% NCS at 37°C in a humidified atmosphere of 5% CO2 in air.
MTT assay
RMCs were added into the wells of a 96-well plate at a density of 3000 cells per well and cultured in RPMI-1640 medium containing 10% NCS. All incubations were performed in RPMI-1640 containing 1% NCS when they grew to 60% confluence. The study included two parts: (1) Control group, Eucommia lignans groups (10, 20, 30, 40, 50, 60, 70, 80, or 90 mg/L Eucommia lignans); and (2) Control group, Ang II group (10 nM Ang II), Losartan group (10 nM Ang II with 20 μM Losartan), Eucommia lignans groups (10 nM Ang II with 20, 40 and 80 mg/L Eucommia lignans). After 48 h, the viability of RMCs was measuredby MTT method. Then, 20 μL cell Titer 96® Aqueous One Solution Reagent was added to the medium in each well, and the absorbance of solubilized blue formazan was recorded by a microplate reader (Molecular Devices, Spectra MAX. 250, USA) at 490 nm after 1 h at 37°C in a humidified 5% CO2 atmosphere.
Reverse transcription real-time quantitative PCR (RT-qPCR) assay
RMCs were assigned to six groups: Control group, Ang II group (10 nM Ang II), Losartan group (10 nM Ang II with 20 μM Losartan), and
Eucommia lignans groups (10 nM Ang II with 20, 40 or 80 mg/L
Eucommia lignans), in a 6-well plate, and cultured in RPMI-1640 medium containing 10% NCS for 48 h. Total RNA from RMCs was extracted by Trizol® reagent (Invitrogen, Carlsbad, CA, USA) and the concentration was determined by spectrophotometry at 260 and 280 nm. A reverted aid cDNA synthesis kit was used to perform the synthesis of first strand cDNA from total RNA templates. Real-time qPCR was performed by Platinum® SYBR® Green qPCR Super Mix-UDG following the manufacturer’s instructions. The gene-specific primers are listed in Table
1. The data were quantitatively analyzed by Stratagene Mx3000p Real-time PCR (Santa Clara, CA, USA). The glyceraldehyde phosphate dehydrogenase (GAPDH) gene was used as the internal control.
Table 1
Information on the primers used for real-time PCR
AR | F: TCCCAGGATCAAGGAAATTG | 202 |
R: ACAACAGGAACTGGAGGGTG |
FN | F: AACGGCCCTGGTTTGTACC | 285 |
R: CTCCAACATATAGCCACCAGTC |
Col I | F: GAGAGAGCATGACCGATGGA | 251 |
R: CGTGCTGTAGGTGAATCGAC |
Col III | F: GGCTGCACTAAACACACTGG | 229 |
R: TGGTTGACGAGATTAAAGCAAG |
Col IV | F: TGTCAGCAATTAGGCAGGTC | 205 |
R: CACCATGTTTCGGAATGGTT |
GAPDH | F: CAAGTTCAACGGCACAGTCAAG | 123 |
| R: ACATACTCAGCACCAGCATCAC | |
Western blotting
Total protein was extracted from RMCs with radio immunoprecipitation assay lysis buffer consisting of 10 mM sodium phosphate (pH 7–8), 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate and 1% Triton X 100 after a 48-h culture under the conditions described above, and the protein concentration was determined using a bicinchoninic acid assay kit (Sigma-Aldrich, USA). A total of 40 μg of total protein was separated on a 10% sodium dodecyl sulfate polyacrylamide gel (Invitrogen, Carlsbad, CA, USA) and transferred onto a polyvinylidenefluoride membrane (Millipore, USA). The membrane was blocked with 5% skim milk solution in 0.1% tris-buffered saline Tween-20 (TBST) (Shanghai Bioscience Co. Ltd, China) over night. Subsequently, one of the primary antibodies (rabbit polyclonal for Col I, mouse monoclonal [FH-7A] for Col III, rabbit polyclonal for Col IV, mouse monoclonal [IST-9] for fibronectin, goat polyclonal for AR, and rabbit polyclonal for GAPDH) was added for hybridization before being incubated with the specific secondary antibody after washing membranes with TBST (Shanghai Bioscience Co. Ltd, China) three times. Protein bands were determined by the enhanced chemiluminescence western blotting detection system. GAPDH was used as an internal standard for data normalization.
Statistical analysis
Data were shown as mean ± standard deviation (SD) and were analyzed with SPSS 17.0 software (SPSS Inc., USA). A P value less than 0.05 was considered statistically significant. Significant differences between multiple groups were analyzed by one-way analysis of variance (ANOVA) followed by a Dunnett’s post-hoc test.
Discussion
Eucommia lignans (10 to 90 mg/L) was incubated with RMCs, according to our previous study with renal tubular epithelial cells (HK-2 cells) [
12].
Eucommia lignans at 90 mg/L affected the normal growth of RMCs. Therefore,
Eucommia lignans amounts in the subsequent experiments were set as 20, 40 and 80 mg/L.
The result consistent with those previous reports on the pathogenesis of hypertensive glomerulosclerosis [
3,
5], and stimulates MC proliferation and biosynthesis of ECM including mainly Col IV, fibronectin, Col I and Col III in
in vivo or
in vitro[
4,
23‐
28]. Our present study found that Ang II (10 nM) stimulated proliferation and production of Col IV, fibronectin and Col I in RMCs, and that both mRNA and protein of Col III were over-expressed in RMCs induced by Ang II.
In the current study, Ang II-induced RMC proliferation was significantly inhibited by
Eucommia lignans, and there was a reduction in the raised expression of Col I, Col III, Col IV and fibronectin at both mRNA and protein levels. However, the mechanisms of
Eucommia lignans in preventing Ang II-induced proliferation of RMC and production of ECM are poorly defined. According to some reports, AR, as a member of the aldo-ketoreductase superfamily, is involved in the cellular proliferation and ECM (Col I, Col IV and fibronectin) production induced by TGF-β1 or PDGF in human or rat MCs, and TGF-β1 and PDGF are downstream genes of Ang II [
13‐
16]. Therefore, we tested the hypothesis that AR might participate in the pathological process in RMCs induced by Ang-II. This study demonstrated both AR mRNA and protein levels increase in RMCs were induced by Ang-II, in addition to our previous finding that
Eucommia lignans decreased the production of Col III by degrading the expression of AR protein in SHR renal tissue [
12], showed that the
Eucommia lignans’ effects on Ang II-induced pathological changes in RMCs involved the reduction in the expression of AR. Our further studies will examine the signal pathways for the reduction of
Eucommia lignans by AR expression.
Acknowledgments
This study was supported by the National Sci-Tech Support Plan of China (SQ2010BAJY1411-08), National Development of Key Novel Drugs for Special Projects of China (2012ZX09303014001), the Hunan Provincial Natural Science Foundation of China (12JJ7006), the Innovation Project for 2011 Graduates of Central-South University (2010ssxt272), and the Fundamental Research Funds for the Central Universities of Central South University (1681-7608040003).
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
DO and HZ designed this study. ZL, XD, LL, HL, XJ, YT, and PL performed the experiments. ZL, XD and WH wrote the manuscript. All authors have read and approved the final manuscript.