Skip to main content
Erschienen in: Chinese Medicine 1/2014

Open Access 01.12.2014 | Research

Lignans from the bark of Eucommia ulmoides inhibited Ang II-stimulated extracellular matrix biosynthesis in mesangial cells

verfasst von: Zhen-yu Li, Xiao-lan Deng, Wei-hua Huang, Ling Li, Hui Li, Xian Jing, Ying-ying Tian, Pei-yu Lv, Tian-lun Yang, Hong-hao Zhou, Dong-sheng Ouyang

Erschienen in: Chinese Medicine | Ausgabe 1/2014

Abstract

Background

Tree bark of Eucommia ulmoides Oliv., (commonly well-known as “Du-zhong” in China), has been used to treat hypertension, hypercholesterolemia, hyperglycemia, hepatic fibrosis and renal injury. This study aims to investigate the effects of lignans extracted from the bark of Eucommia ulmoides Oliv. on Ang II-induced proliferation and extracellular matrix biosynthesis in rat mesangial cells.

Methods

Rat mesangial cells (RMCs) were cultured in vitro and divided into six groups (control, Ang II, losartan, and low, middle and high concentration lignans groups). RMC proliferation was measured by MTT assay. RT-qPCR and western blotting were used to detect mRNA and protein expression of collagen type I (Col I), collagen type III (Col III), collagen type IV (Col IV), fibronectin and aldose reductase (AR).

Results

Cellular proliferation induced by Ang II was significantly suppressed by Eucommia lignans of different concentrations (P = 0.034, P < 0.001, and P < 0.001). Treatment of cells with Ang II increased Col I, Col III, Col IV, and fibronectin mRNA expression, which was observed at the protein level (P < 0.001, P < 0.001, P = 0.004, and P = 0.004, respectively). The increased mRNA expression and protein levels of Col I, Col III, Col IV, and fibronectin were diminished remarkably with by treatment Eucommia lignans, and elevated AR expression stimulated by Ang II was significantly inhibited by Eucommia lignans.

Conclusions

Eucommia lignans (Du-zhong) inhibited Ang II-stimulated extracellular matrix biosynthesis in mesangial cells.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1749-8546-9-8) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

DO and HZ designed this study. ZL, XD, LL, HL, XJ, YT, and PL performed the experiments. ZL, XD and WH wrote the manuscript. All authors have read and approved the final manuscript.
Abkürzungen
Ang II
Angiotensin II
AR
Aldose reductase
Col I
Collagen type I
Col III
Collagen type III
Col IV
Collagen type IV
ECM
Extracellular matrix
GAPDH
Glyceraldehyde phosphate dehydrogenase
MCs
Mesangial cells
MTT
3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide
NCS
Newborn calf serum
PDGF
Platelet-derived growth factor
RAS
Rennin-angiotensin system
SHR
Spontaneous hypertensive rat
TGF-β1
Transforming growth factor-β1
TNF-α
tumor necrosis factor-α.

Background

Hypertension is the second leading cause of end-stage renal disease [1], resulting in hypertensive nephropathy, which usually starts with glomerulosclerosis [2, 3]. The pathophysiologic process is associated with structural changes to renal glomeruli due to mesangial cell (MC) proliferation and abnormal accumulation of extracellular matrix (ECM) [3, 4]. Angiotensin II (Ang II), the main effective peptide in the rennin-angiotensin system (RAS) is considered a key mediator in the development of hypertensive glomerulosclerosis [3, 5]. RAS regulates the proliferation of MCs and increases the production of ECM, mainly through the induction of glomerular hypertension, as well as non-hemodynamic effects, which include the production of reactive oxygen species, up-regulation of profibrotic growth factors, such as platelet-derived growth factor (PDGF), transforming growth factor-β1 (TGF-β1), tumor necrosis factor-α (TNF-α) and connective tissue growth factor, and macrophage activation and infiltration [3, 68].
Aldose reductase (AR), a member of the aldo-ketoreductase super family, catalyzes the conversion of glucose to sorbitol dependent on NADPH in the first step of the polyol pathway [9]. AR can be activated by TGF-β1, oxidative stress and inflammation [912], to stimulate proliferation of MCs and deposition of ECM induced by TGF-β1 and PDGF [1316]. An over-expression of AR was observed in the renal tissue of spontaneous hypertensive rats (SHR) in our previous study [12]. AR might be involved in the pathological process induced by Ang II in MCs.
Cortex Eucommiae (Du-zhon g), the dried bark of the Eucommia ulmoides Oliv. (Family: Eucommiaceae), has been served as a traditional tonic medicine and is thought to benefit the liver and kidney, strengthen tendons and bones, and prevent miscarriage [17]. The natural products that have been identified from Du-zhong include lignans, iridoids, flavonoids, polysaccharides, terpenes and protein [18], which possess various pharmacological effects, including antihypertensive, antioxidant, antimicrobial, and anti-inflammatory properties [9, 18]. We previously confirmed that lignans were the effective fraction of Du-zhong for antihypertension [10, 19]. Further study showed that both N-acetyl-β-D-glucosaminidase enzyme activity and the ratio of albumin to urinary creatinine decreased in spontaneous hypertensive rat (SHR)-treated with Eucommia lignans [12]. Eucommia lignans also inhibited the expression of collagen type III (Col III) in the glomerular basement membrane, and diminished the over-expression of AR in the kidney [11]. Accordingly, we hypothesized that lignans decreased the production of Col III by affecting AR expression and thus decreased damage to the glomerular structure [12].
This study aims to investigate the effects of lignans extracted from the bark of Eucommia ulmoides Oliv. On Ang II-induced proliferation and extracellular matrix biosynthesis in rat mesangial cells, and attempted to elucidate the mechanisms by which Eucommia lignans from Du-zhong protecting against hypertensive renal injury in vitro.

Methods

Materials and reagents

RPMI-1640 medium, newborn calf serum (NCS), RT-qPCR kits with Platinum® SYBR® Green qPCR Super Mix-UDG, and primers for collagen I (Col I), Col III, collagen type IV (Col IV), fibronectin and AR were purchased from Invitrogen (Carlsbad, CA, USA). Antibodies for Col I, Col III, Col IV, fibronectin and AR for western blotting were supplied by Abcam (Cambridge, England) and Santa Cruz Biotechnology Inc. (CA, USA). The Cell Titer 96® Aqueous One Solution Proliferation Assay for the 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) method was provided by Promega (Madison, WI, USA). A Revert Aid First Strand cDNA Synthesis Kit was purchased from Thermo Scientific (Austin, TX, USA). Losartan was obtained commercially from the National Institute for Food and Drug Control (Beijing, China). Human Angiotensin II and other analytical grade reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA).
Eucommia lignans were extracted at our own laboratory as described previously [12, 19, 20]. E. ulmoides were obtained from Changsha Medical Company (Hunan, China) in July 2009, and authenticated by Dr. Dong-Sheng Ouyang, one of the authors according to the methods described in the literature [21]. A voucher specimen of Eucommia ulmoides Oliv. (IBSC_0345347) was deposited at South China Botanical Garden Herbarium, Guangdong, China. Briefly, fresh Eucommia ulmoides Oliv. bark was cut into pieces and extracted with 60% ethanol purchased from Changsha Tianshun Chemical Co., Ltd (Hunan, China) at 70°C for 2 h (twice). The extract was subjected to macroporous resin supplied by Haiguang Chemical Industrial Company (Tianjin, China) and eluted with 80% ethanol after treatment with pure water as the eluent. The eluent was freeze-dried to powder and stored at 4°C. The lignans content in Eucommia lignans was 71%, as determined by spectrophotometry on a Beckman Coulter DU 640 spectrophotometer (Beckman Coulter, Inc. USA) at 277 nm, with pinoresinoldiglucoside used as the control which was supplied by college of chemistry and chemical engineering in Central South University (Hunan, China).

Cell culture

RMCs (HBZY-1 cells) were purchased from China Center for Type Culture Collection (Wuhan, China). After recovery, RMCs were cultured in RPMI-1640 medium supplemented with 10% NCS at 37°C in a humidified atmosphere of 5% CO2 in air.

MTT assay

RMCs were added into the wells of a 96-well plate at a density of 3000 cells per well and cultured in RPMI-1640 medium containing 10% NCS. All incubations were performed in RPMI-1640 containing 1% NCS when they grew to 60% confluence. The study included two parts: (1) Control group, Eucommia lignans groups (10, 20, 30, 40, 50, 60, 70, 80, or 90 mg/L Eucommia lignans); and (2) Control group, Ang II group (10 nM Ang II), Losartan group (10 nM Ang II with 20 μM Losartan), Eucommia lignans groups (10 nM Ang II with 20, 40 and 80 mg/L Eucommia lignans). After 48 h, the viability of RMCs was measuredby MTT method. Then, 20 μL cell Titer 96® Aqueous One Solution Reagent was added to the medium in each well, and the absorbance of solubilized blue formazan was recorded by a microplate reader (Molecular Devices, Spectra MAX. 250, USA) at 490 nm after 1 h at 37°C in a humidified 5% CO2 atmosphere.

Reverse transcription real-time quantitative PCR (RT-qPCR) assay

RMCs were assigned to six groups: Control group, Ang II group (10 nM Ang II), Losartan group (10 nM Ang II with 20 μM Losartan), and Eucommia lignans groups (10 nM Ang II with 20, 40 or 80 mg/L Eucommia lignans), in a 6-well plate, and cultured in RPMI-1640 medium containing 10% NCS for 48 h. Total RNA from RMCs was extracted by Trizol® reagent (Invitrogen, Carlsbad, CA, USA) and the concentration was determined by spectrophotometry at 260 and 280 nm. A reverted aid cDNA synthesis kit was used to perform the synthesis of first strand cDNA from total RNA templates. Real-time qPCR was performed by Platinum® SYBR® Green qPCR Super Mix-UDG following the manufacturer’s instructions. The gene-specific primers are listed in Table 1. The data were quantitatively analyzed by Stratagene Mx3000p Real-time PCR (Santa Clara, CA, USA). The glyceraldehyde phosphate dehydrogenase (GAPDH) gene was used as the internal control.
Table 1
Information on the primers used for real-time PCR
Gene
Primers
Product size (bp)
AR
F: TCCCAGGATCAAGGAAATTG
202
R: ACAACAGGAACTGGAGGGTG
FN
F: AACGGCCCTGGTTTGTACC
285
R: CTCCAACATATAGCCACCAGTC
Col I
F: GAGAGAGCATGACCGATGGA
251
R: CGTGCTGTAGGTGAATCGAC
Col III
F: GGCTGCACTAAACACACTGG
229
R: TGGTTGACGAGATTAAAGCAAG
Col IV
F: TGTCAGCAATTAGGCAGGTC
205
R: CACCATGTTTCGGAATGGTT
GAPDH
F: CAAGTTCAACGGCACAGTCAAG
123
 
R: ACATACTCAGCACCAGCATCAC
 

Western blotting

Total protein was extracted from RMCs with radio immunoprecipitation assay lysis buffer consisting of 10 mM sodium phosphate (pH 7–8), 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate and 1% Triton X 100 after a 48-h culture under the conditions described above, and the protein concentration was determined using a bicinchoninic acid assay kit (Sigma-Aldrich, USA). A total of 40 μg of total protein was separated on a 10% sodium dodecyl sulfate polyacrylamide gel (Invitrogen, Carlsbad, CA, USA) and transferred onto a polyvinylidenefluoride membrane (Millipore, USA). The membrane was blocked with 5% skim milk solution in 0.1% tris-buffered saline Tween-20 (TBST) (Shanghai Bioscience Co. Ltd, China) over night. Subsequently, one of the primary antibodies (rabbit polyclonal for Col I, mouse monoclonal [FH-7A] for Col III, rabbit polyclonal for Col IV, mouse monoclonal [IST-9] for fibronectin, goat polyclonal for AR, and rabbit polyclonal for GAPDH) was added for hybridization before being incubated with the specific secondary antibody after washing membranes with TBST (Shanghai Bioscience Co. Ltd, China) three times. Protein bands were determined by the enhanced chemiluminescence western blotting detection system. GAPDH was used as an internal standard for data normalization.

Statistical analysis

Data were shown as mean ± standard deviation (SD) and were analyzed with SPSS 17.0 software (SPSS Inc., USA). A P value less than 0.05 was considered statistically significant. Significant differences between multiple groups were analyzed by one-way analysis of variance (ANOVA) followed by a Dunnett’s post-hoc test.

Results

Effects of Eucommia lignans on RMC growth

In comparison with the control, there was no significant change in the number of cells treated with Eucommia lignans in the 10, 20, 30, 40, 50, 60, 70 and 80 mg/L groups (P = 0.983, 0.986, 1.000, 0.900, 0.920, 0.515, 0.515, and 0.249, respectively). However, cellular viability decreased markedly in the group incubated with 90 mg/L Eucommia lignans (P = 0.001) (Figure 1). Therefore, the incubated concentrations of Eucommia lignans for the following experiments were 20, 40 and 80 mg/L.

Inhibition of Eucommia lignans on Ang II-induced RMC proliferation

The Ang II receptor blocker, losartan (20 μM), significantly decreased the proliferation of RMCs induced by Ang II (P = 0.004). The inhibitory effects were also observed in the different Eucommia lignans-treated groups (P = 0.034, P < 0.001, and P < 0.001) (Figure 2).

Reduction of Eucommia lignans on Ang II-induced ECM biosynthesis in RMCs

The changes in Col I, Col III, Col IV and fibronectin production are shown in Figure 3. mRNA and protein expression increased with Ang II stimulation. All of the increased expression levels induced by Ang II could be attenuated by losartan treatment (Col IV mRNA, P = 0.007; others, P < 0.001). Furthermore, Eucommia lignans also significantly diminished their ascended expression (Col I protein of 20 mg/L, P = 0.001; Col I protein of 40 mg/L, P = 0.002; Col IV mRNA of 80 mg/L, P = 0.031; others, P < 0.001), although decreases of the Col IV mRNA level of the low and middle concentration lignans groups did not reach a statistically significant difference (P = 0.084 and P = 0.134). Eucommia lignans could suppress Ang II-stimulated biosynthesis of ECM in RMCs (Figure 3B).

Block of Eucommia lignans on Ang II-induced AR expression in RMCs

The mechanisms of Eucommia lignans inhibitory effects were tentatively elucidated from data of our previous animal experiments [22]. Both mRNA and protein expression of AR were effectively enhanced by Ang II (P < 0.001) (Figure 4). Losartan and Eucommia lignans clearly attenuated all expression stimulated by Ang II (Losartan, P = 0.045; 20 mg/L Lignans, P = 0.01; others, P < 0.001). The experiment demonstrated that Eucommia lignans could suppress Ang II-induced AR expression in RMCs.

Discussion

Eucommia lignans (10 to 90 mg/L) was incubated with RMCs, according to our previous study with renal tubular epithelial cells (HK-2 cells) [12]. Eucommia lignans at 90 mg/L affected the normal growth of RMCs. Therefore, Eucommia lignans amounts in the subsequent experiments were set as 20, 40 and 80 mg/L.
The result consistent with those previous reports on the pathogenesis of hypertensive glomerulosclerosis [3, 5], and stimulates MC proliferation and biosynthesis of ECM including mainly Col IV, fibronectin, Col I and Col III in in vivo or in vitro[4, 2328]. Our present study found that Ang II (10 nM) stimulated proliferation and production of Col IV, fibronectin and Col I in RMCs, and that both mRNA and protein of Col III were over-expressed in RMCs induced by Ang II.
In the current study, Ang II-induced RMC proliferation was significantly inhibited by Eucommia lignans, and there was a reduction in the raised expression of Col I, Col III, Col IV and fibronectin at both mRNA and protein levels. However, the mechanisms of Eucommia lignans in preventing Ang II-induced proliferation of RMC and production of ECM are poorly defined. According to some reports, AR, as a member of the aldo-ketoreductase superfamily, is involved in the cellular proliferation and ECM (Col I, Col IV and fibronectin) production induced by TGF-β1 or PDGF in human or rat MCs, and TGF-β1 and PDGF are downstream genes of Ang II [1316]. Therefore, we tested the hypothesis that AR might participate in the pathological process in RMCs induced by Ang-II. This study demonstrated both AR mRNA and protein levels increase in RMCs were induced by Ang-II, in addition to our previous finding that Eucommia lignans decreased the production of Col III by degrading the expression of AR protein in SHR renal tissue [12], showed that the Eucommia lignans’ effects on Ang II-induced pathological changes in RMCs involved the reduction in the expression of AR. Our further studies will examine the signal pathways for the reduction of Eucommia lignans by AR expression.

Conclusions

Eucommia lignans (Du-zhong) inhibited Ang II-stimulated extracellular matrix biosynthesis in mesangial cells.

Acknowledgments

This study was supported by the National Sci-Tech Support Plan of China (SQ2010BAJY1411-08), National Development of Key Novel Drugs for Special Projects of China (2012ZX09303014001), the Hunan Provincial Natural Science Foundation of China (12JJ7006), the Innovation Project for 2011 Graduates of Central-South University (2010ssxt272), and the Fundamental Research Funds for the Central Universities of Central South University (1681-7608040003).
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

DO and HZ designed this study. ZL, XD, LL, HL, XJ, YT, and PL performed the experiments. ZL, XD and WH wrote the manuscript. All authors have read and approved the final manuscript.
Literatur
2.
Zurück zum Zitat Lee SB, Kalluri R: Mechanistic connection between inflammation and fibrosis. Kidney Int Suppl. 2010, 119: S22-S26.CrossRefPubMed Lee SB, Kalluri R: Mechanistic connection between inflammation and fibrosis. Kidney Int Suppl. 2010, 119: S22-S26.CrossRefPubMed
3.
Zurück zum Zitat Kagami S: Involvement of glomerular renin-angiotensin system (RAS) activation in the development and progression of glomerular injury. Clin Exp Nephrol. 2012, 16: 214-220. 10.1007/s10157-011-0568-0.PubMedCentralCrossRefPubMed Kagami S: Involvement of glomerular renin-angiotensin system (RAS) activation in the development and progression of glomerular injury. Clin Exp Nephrol. 2012, 16: 214-220. 10.1007/s10157-011-0568-0.PubMedCentralCrossRefPubMed
4.
Zurück zum Zitat Ding G, Zhang A, Huang S, Pan X, Zhen G, Chen R, Yang T: ANG II induces c-Jun NH2-terminal kinase activation and proliferation of human mesangial cells via redox-sensitive transactivation of the EGFR. Am J Physiol Renal Physiol. 2007, 293: F1889-F1897. 10.1152/ajprenal.00112.2007.CrossRefPubMed Ding G, Zhang A, Huang S, Pan X, Zhen G, Chen R, Yang T: ANG II induces c-Jun NH2-terminal kinase activation and proliferation of human mesangial cells via redox-sensitive transactivation of the EGFR. Am J Physiol Renal Physiol. 2007, 293: F1889-F1897. 10.1152/ajprenal.00112.2007.CrossRefPubMed
5.
Zurück zum Zitat Rüster C, Wolf G: Angiotensin II as a morphogenic cytokine stimulating renal fibrogenesis. J Am Soc Nephrol. 2011, 22: 1189-1199. 10.1681/ASN.2010040384.CrossRefPubMed Rüster C, Wolf G: Angiotensin II as a morphogenic cytokine stimulating renal fibrogenesis. J Am Soc Nephrol. 2011, 22: 1189-1199. 10.1681/ASN.2010040384.CrossRefPubMed
6.
7.
Zurück zum Zitat Chen XM, Qi W, Pollock CA: CTGF and chronic kidney fibrosis. Front Biosci (Schol Ed). 2009, 1: 132-141. 10.2741/s13.CrossRef Chen XM, Qi W, Pollock CA: CTGF and chronic kidney fibrosis. Front Biosci (Schol Ed). 2009, 1: 132-141. 10.2741/s13.CrossRef
9.
Zurück zum Zitat Gu J, Yan J, Wu W, Huang Q, Ouyang DS: Research progress in aldose reductase. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2010, 35: 395-400.PubMed Gu J, Yan J, Wu W, Huang Q, Ouyang DS: Research progress in aldose reductase. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2010, 35: 395-400.PubMed
10.
Zurück zum Zitat Wang JL, Liu EW, Zhang Y, Wang T, Han LF, Gao XM: Validation of a HPLC-tandem MS/MS method for pharmacokinetics study of (+)-pinoresinol-di-beta-D-glucopyranoside from Eucommia ulmoides Oliv extract in rats’ plasma. J Ethnopharmacol. 2012, 139: 337-342. 10.1016/j.jep.2011.10.037.CrossRefPubMed Wang JL, Liu EW, Zhang Y, Wang T, Han LF, Gao XM: Validation of a HPLC-tandem MS/MS method for pharmacokinetics study of (+)-pinoresinol-di-beta-D-glucopyranoside from Eucommia ulmoides Oliv extract in rats’ plasma. J Ethnopharmacol. 2012, 139: 337-342. 10.1016/j.jep.2011.10.037.CrossRefPubMed
11.
Zurück zum Zitat Gu J, Wang JJ, Yan J, Cui CF, Wu WH, Li L, Wang ZS, Yu M, Gao N, Liu L, Ouyang DS: Effects of lignans extracted from Eucommia ulmoides and aldose reductase inhibitor epalrestat on hypertensive vascular remodeling. J Ethnopharmacol. 2011, 133: 6-13. 10.1016/j.jep.2010.08.055.CrossRefPubMed Gu J, Wang JJ, Yan J, Cui CF, Wu WH, Li L, Wang ZS, Yu M, Gao N, Liu L, Ouyang DS: Effects of lignans extracted from Eucommia ulmoides and aldose reductase inhibitor epalrestat on hypertensive vascular remodeling. J Ethnopharmacol. 2011, 133: 6-13. 10.1016/j.jep.2010.08.055.CrossRefPubMed
12.
Zurück zum Zitat Li L, Yan J, Hu K, Gu J, Wang JJ, Deng XL, Li H, Jing X, Li ZY, Ye QF, Ouyang DS: Protective effects of Eucommia lignans against hypertensive renal injury by inhibiting expression of aldose reductase. J Ethnopharmacol. 2012, 139: 454-461. 10.1016/j.jep.2011.11.032.CrossRefPubMed Li L, Yan J, Hu K, Gu J, Wang JJ, Deng XL, Li H, Jing X, Li ZY, Ye QF, Ouyang DS: Protective effects of Eucommia lignans against hypertensive renal injury by inhibiting expression of aldose reductase. J Ethnopharmacol. 2012, 139: 454-461. 10.1016/j.jep.2011.11.032.CrossRefPubMed
13.
Zurück zum Zitat Jiang T, Che Q, Lin Y, Li H, Zhang N: Aldose reductase regulates TGF-beta1-induced production of fibronectin and type IV collagen in cultured rat mesangial cells. Nephrology (Carlton). 2006, 11: 105-112. 10.1111/j.1440-1797.2006.00553.x.CrossRef Jiang T, Che Q, Lin Y, Li H, Zhang N: Aldose reductase regulates TGF-beta1-induced production of fibronectin and type IV collagen in cultured rat mesangial cells. Nephrology (Carlton). 2006, 11: 105-112. 10.1111/j.1440-1797.2006.00553.x.CrossRef
14.
Zurück zum Zitat Huang P, Zhang Y, Jiang T, Zeng W, Zhang N: Aldose reductase is a potent regulator of TGF-beta1 induced expression of fibronectin in human mesangial cells. Mol Biol Rep. 2010, 37: 3097-3103. 10.1007/s11033-009-9887-6.CrossRefPubMed Huang P, Zhang Y, Jiang T, Zeng W, Zhang N: Aldose reductase is a potent regulator of TGF-beta1 induced expression of fibronectin in human mesangial cells. Mol Biol Rep. 2010, 37: 3097-3103. 10.1007/s11033-009-9887-6.CrossRefPubMed
15.
Zurück zum Zitat Zou L, Wang W, Xu Z, Zhang N, Jiang T: Aldose reductase regulates platelet-derived growth factor-induced proliferation through mediating cell cycle progression in rat mesangial cells. Int J Mol Med. 2012, 30: 409-416.PubMed Zou L, Wang W, Xu Z, Zhang N, Jiang T: Aldose reductase regulates platelet-derived growth factor-induced proliferation through mediating cell cycle progression in rat mesangial cells. Int J Mol Med. 2012, 30: 409-416.PubMed
16.
Zurück zum Zitat Zhang Y, Huang P, Jiang T, Zhao J, Zhang N: Role of aldose reductase in TGF-beta1-induced fibronectin synthesis in human mesangial cells. Mol Biol Rep. 2010, 37: 2735-2742. 10.1007/s11033-009-9811-0.CrossRefPubMed Zhang Y, Huang P, Jiang T, Zhao J, Zhang N: Role of aldose reductase in TGF-beta1-induced fibronectin synthesis in human mesangial cells. Mol Biol Rep. 2010, 37: 2735-2742. 10.1007/s11033-009-9811-0.CrossRefPubMed
17.
Zurück zum Zitat National PCoC: Chinese Pharmacopoeia. 2010, Beijing: China Medical Science and Technology Press, 2010 National PCoC: Chinese Pharmacopoeia. 2010, Beijing: China Medical Science and Technology Press, 2010
18.
Zurück zum Zitat Liu E, Han L, Wang J, He W, Shang H, Gao X, Wang T: Eucommia ulmoides bark protects against renal injury in cadmium-challenged rats. J Med Food. 2012, 15: 307-314. 10.1089/jmf.2011.1756.CrossRefPubMed Liu E, Han L, Wang J, He W, Shang H, Gao X, Wang T: Eucommia ulmoides bark protects against renal injury in cadmium-challenged rats. J Med Food. 2012, 15: 307-314. 10.1089/jmf.2011.1756.CrossRefPubMed
19.
Zurück zum Zitat Luo LF, Wu WH, Zhou YJ, Yan J, Yang GP, Ouyang DS: Antihypertensive effect of Eucommia ulmoides Oliv. extracts in spontaneously hypertensive rats. J Ethnopharmacol. 2010, 129: 238-243. 10.1016/j.jep.2010.03.019.CrossRefPubMed Luo LF, Wu WH, Zhou YJ, Yan J, Yang GP, Ouyang DS: Antihypertensive effect of Eucommia ulmoides Oliv. extracts in spontaneously hypertensive rats. J Ethnopharmacol. 2010, 129: 238-243. 10.1016/j.jep.2010.03.019.CrossRefPubMed
20.
Zurück zum Zitat Liu N, Chen XQ, Du H, Xue XJ, Ouyang DS: Separation and purification of the lignans from Eucommia ulmoides. HuaXue Tong Bao. 2006, 69: 4- Liu N, Chen XQ, Du H, Xue XJ, Ouyang DS: Separation and purification of the lignans from Eucommia ulmoides. HuaXue Tong Bao. 2006, 69: 4-
21.
Zurück zum Zitat Zhang Q: Sequence analysis of chloroplast maturase K gene of Chinese medical plant Eucommia ulmoides. ShengTai KeXue. 2004, 23: 141-143. Zhang Q: Sequence analysis of chloroplast maturase K gene of Chinese medical plant Eucommia ulmoides. ShengTai KeXue. 2004, 23: 141-143.
22.
Zurück zum Zitat Li ZY, Gu J, Yan J, Wang JJ, Huang WH, Tan ZR, Zhou G, Chen Y, Zhou HH, Ouyang DS: Hypertensive cardiac remodeling effects of lignan extracts from Eucommia ulmoides oliv. bark — a famous traditional Chinese medicine. Am J Chin Med. 2013, 41: 801-815. 10.1142/S0192415X13500547.CrossRefPubMed Li ZY, Gu J, Yan J, Wang JJ, Huang WH, Tan ZR, Zhou G, Chen Y, Zhou HH, Ouyang DS: Hypertensive cardiac remodeling effects of lignan extracts from Eucommia ulmoides oliv. bark — a famous traditional Chinese medicine. Am J Chin Med. 2013, 41: 801-815. 10.1142/S0192415X13500547.CrossRefPubMed
23.
Zurück zum Zitat Wolf G, Haberstroh U, Neilson EG: Angiotensin II stimulates the proliferation and biosynthesis of type I collagen in cultured murine mesangial cells. Am J Pathol. 1992, 140: 95-107.PubMedCentralPubMed Wolf G, Haberstroh U, Neilson EG: Angiotensin II stimulates the proliferation and biosynthesis of type I collagen in cultured murine mesangial cells. Am J Pathol. 1992, 140: 95-107.PubMedCentralPubMed
24.
Zurück zum Zitat Block K, Ricono JM, Lee DY, Bhandari B, Choudhury GG, Abboud HE, Gorin Y: Arachidonic acid-dependent activation of a p22(phox)-based NAD(P)H oxidase mediates angiotensin II-induced mesangial cell protein synthesis and fibronectin expression via Akt/PKB. Antioxid Redox Signal. 2006, 8: 1497-1508. 10.1089/ars.2006.8.1497.CrossRefPubMed Block K, Ricono JM, Lee DY, Bhandari B, Choudhury GG, Abboud HE, Gorin Y: Arachidonic acid-dependent activation of a p22(phox)-based NAD(P)H oxidase mediates angiotensin II-induced mesangial cell protein synthesis and fibronectin expression via Akt/PKB. Antioxid Redox Signal. 2006, 8: 1497-1508. 10.1089/ars.2006.8.1497.CrossRefPubMed
25.
Zurück zum Zitat Huang Y, Wongamorntham S, Kasting J, McQuillan D, Owens RT, Yu L, Noble NA, Border W: Renin increases mesangial cell transforming growth factor-beta1 and matrix proteins through receptor-mediated, angiotensin II-independent mechanisms. Kidney Int. 2006, 69: 105-113. 10.1038/sj.ki.5000011.CrossRefPubMed Huang Y, Wongamorntham S, Kasting J, McQuillan D, Owens RT, Yu L, Noble NA, Border W: Renin increases mesangial cell transforming growth factor-beta1 and matrix proteins through receptor-mediated, angiotensin II-independent mechanisms. Kidney Int. 2006, 69: 105-113. 10.1038/sj.ki.5000011.CrossRefPubMed
26.
Zurück zum Zitat Zhang J, Noble NA, Border WA, Huang Y: Infusion of angiotensin-(1-7) reduces glomerulosclerosis through counteracting angiotensin II in experimental glomerulonephritis. Am J Physiol Renal Physiol. 2010, 298: F579-F588. 10.1152/ajprenal.00548.2009.PubMedCentralCrossRefPubMed Zhang J, Noble NA, Border WA, Huang Y: Infusion of angiotensin-(1-7) reduces glomerulosclerosis through counteracting angiotensin II in experimental glomerulonephritis. Am J Physiol Renal Physiol. 2010, 298: F579-F588. 10.1152/ajprenal.00548.2009.PubMedCentralCrossRefPubMed
27.
Zurück zum Zitat Davis LK, Rodgers BD, Kelley KM: Angiotensin II- and glucose-stimulated extracellular matrix production: mediation by the insulin-like growth factor (IGF) axis in a murine mesangial cell line. Endocrine. 2008, 33: 32-39. 10.1007/s12020-008-9055-0.PubMedCentralCrossRefPubMed Davis LK, Rodgers BD, Kelley KM: Angiotensin II- and glucose-stimulated extracellular matrix production: mediation by the insulin-like growth factor (IGF) axis in a murine mesangial cell line. Endocrine. 2008, 33: 32-39. 10.1007/s12020-008-9055-0.PubMedCentralCrossRefPubMed
28.
Zurück zum Zitat Banes-Berceli AK, Shaw S, Ma G, Brands M, Eaton DC, Stern DM, Fulton D, Caldwell RW, Marrero MB: Effect of simvastatin on high glucose- and angiotensin II-induced activation of the JAK/STAT pathway in mesangial cells. Am J Physiol Renal Physiol. 2006, 291: F116-F121. 10.1152/ajprenal.00502.2005.CrossRefPubMed Banes-Berceli AK, Shaw S, Ma G, Brands M, Eaton DC, Stern DM, Fulton D, Caldwell RW, Marrero MB: Effect of simvastatin on high glucose- and angiotensin II-induced activation of the JAK/STAT pathway in mesangial cells. Am J Physiol Renal Physiol. 2006, 291: F116-F121. 10.1152/ajprenal.00502.2005.CrossRefPubMed
Metadaten
Titel
Lignans from the bark of Eucommia ulmoides inhibited Ang II-stimulated extracellular matrix biosynthesis in mesangial cells
verfasst von
Zhen-yu Li
Xiao-lan Deng
Wei-hua Huang
Ling Li
Hui Li
Xian Jing
Ying-ying Tian
Pei-yu Lv
Tian-lun Yang
Hong-hao Zhou
Dong-sheng Ouyang
Publikationsdatum
01.12.2014
Verlag
BioMed Central
Erschienen in
Chinese Medicine / Ausgabe 1/2014
Elektronische ISSN: 1749-8546
DOI
https://doi.org/10.1186/1749-8546-9-8

Weitere Artikel der Ausgabe 1/2014

Chinese Medicine 1/2014 Zur Ausgabe