Background
Ranking the fifth most common cancer, Hepatocellular carcinoma (HCC) is the third leading cause of cancer-related death worldwide [
1]. Lots of HCC patients are at the late stages of the disease when they are diagnosed. In addition, there is a high frequency of tumor recurrence in HCC patients although they have surgical resection and this contributes to the poor prognosis of HCC [
2]. Therefore, it is urgent in need to develop novel strategies for the diagnosis and treatment of HCC.
Approximately 2% of the human genome accounts for protein coding genes. However, the majority of transcripts consists of non-coding RNAs (ncRNAs) [
3] that can be grouped into the following classes depending on their transcript size: long non-coding RNAs (lncRNAs) and small ncRNAs [
4]. LncRNAs are transcripts with a length greater than 200 nucleotides (nt). The abnormal expression of lncRNAs often contributes to tumor initiation, growth and metastasis [
5]. Many studies have demonstrated that lncRNAs are dysregulated in many cancers, including HCC [
6]. For instance, lncRNA CRNDE is upregulated in HCC and significantly associated with poor clinical outcomes, and knockdown of its expression impairs cell proliferation and invasion [
7]. In addition, lncRNA TUG1 contributes to HCC cells proliferation, migration and tumorigenesis via interacting with miR-144 [
8]. Moreover, NEAT1 upregulates TGF-β1 to induce HCC progression by sponging hsa-miR-139-5p [
9]. Although large numbers of lncRNAs have been annotated, the role and molecular regulatory mechanisms of lncRNAs in HCC still require further clarification.
MicroRNAs (miRNAs), a group of small and non-coding RNAs, regulate down-stream targets expression via modulation of post-transcriptional [
10].Mounting evidence has demonstrated that miRNAs regulate diverse biological process, including cancer cell proliferation, apoptosis and invasion [
11]. It is worth to note that lncRNAs can function as ceRNAs that compete for miRNA binding, and therefore, they derepress the expression of miRNA-targeted mRNAs [
12]. The lncRNA-miRNA-mRNA regulatory network has been implicated to regulate tumorigenesis [
13,
14].
In the current study, we explore the role and underlying mechanism of LINC01287 in HCC. We also explore the interaction between LINC01287 and miR-298.
Methods
Cell culture and collection of HCC patient samples
HCC cell lines (HepG-2, Huh7, Bel7402 and Hep3B) and the normal liver epithelial cell line LO2 were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China). All cell lines were maintained at 37 °C in a humidified 5% CO2 atmosphere in RPMI-1640 medium supplemented with 10% fetal bovine serum.
HCC tissues and matched normal tissue samples (98 pairs, formalin-fixed and paraffin-embedded) were obtained from patients at Gaozhou People’s Hospital. These patients were diagnosed with hepatocellular carcinoma in our hospital from Sep. 2011 to Nov. 2016. Written informed consent was obtained from all patients, and the project was approved by the Ethical and Scientific Committees of Gaozhou People’s Hospital. All experimental protocols were approved by the Clinical Research Ethics Committees of Gaozhou People’s Hospital.
Cell transfection, lentivirus production and transduction
The cell transfections were performed using lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions. siRNA against STAT3 (Ruibio, Guangzhou, China) and a non-targeting siRNA control (Ruibio, Guangzhou, China) were used to knock down gene expression. Briefly, the oligonucleotides and plasmids were transfected using Lipofectamine 2000 (Invitrogen) according the manufacturer’s protocol. 48 h later, G418 was added into the medium to select of stable clones. The pcDNA3.1-STAT3 and pcDNA3.1 vectors were purchased from Santa Cruz Biotechnology (USA). miR-298, miR-ctrl, anti-miR-ctrl and anti-miR-298 were purchased from Genechem (Shanghai, China).
The shRNA sequence that targeted LINC01287 was AAGCATTGTAGACCTGGCTGCTGAA. The sequences were cloned into the pGFP-C-shLenti vector according to the manufacturer’s instructions (Origene). Then, the viruses were packaged in 293 T cells according to a standard protocol. HCC cells were infected with virus particles plus 6 μg/ml Polybrene.
Quantitative real-time PCR (q-RT-PCR)
Total RNA was extracted from HCC cells using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. The RNA was reverse transcribed to cDNA, which was followed by real-time PCR analyses. The primers used in the study are listed in Table
1.
Table 1
Primers used in the study
GAPDH | TCAAGATCATCAGCAATGCC | CGATACCAAAGTTGTCATGGA |
U6 | ATACAGAGAAAGTTAGCACGG | GGAATGCTTCAAAGAGTTGTG |
LINC01287 | GGTTGATGTAAGGACCTCGT | GAGACCTTGTTTCATGTGTCG |
MIR-298 | TCAGGTCTTCAGCAGAAGC | TAGTTCCTCACAGTCAAGGA |
STAT3 | CGCACTTTAGATTCATTGATGC | AGGTGAGGGACTCAAACTG |
LINC01287 P1 | CGAGTACTTCTAAATCCCAGT | AAAGGGTTCTCTCACTAAAAG |
LINC01287 P2 | AGAAATCTATATTGACAGT | CCTGGGTAGGAATTGTAAGCGA |
LINC01287 P3 | ATAGGCTGAAATGCACTGAAC | GACAAAAACCGCAGCGAGCGG |
LINC01287 P4 | TCCGTGTGTGGTGGTACTGG | GATTAAAACATAAAAATCAT |
To determine the sub-cellular distribution of LINC01287, nuclear and cytoplasmic fractions of cells were separated using the PARIS Kit (Life Technologies) according to the manufacturer’s instructions. Then, the RNA was extracted from both fractions. Subsequently, RT-PCR was performed to examine the expression ratios of specific RNA molecules between the nuclear and cytoplasmic fractions.
For the MTT assay, HCC cells were seeded in 96-well plates. After 24 h, 5 mg/ml MTT was added to each well. The HCC cells were then incubated for another 6 h. Subsequently, DMSO was added to each well, and the absorbance was measured at 490 nm by spectrophotometry.
For the colony formation assay, HCC cells were seeded in 6-well culture plates. Two weeks later, the cells were fixed in paraformaldehyde, stained with hematoxylin solution and counted under a microscope.
For the cell cycle assay, cells were harvested from the culture dishes and washed three times in cold PBS. The cells were then fixed in 70% ice-cold ethanol at 4 °C overnight. Finally, the cells were incubated in propidium iodide (supplemented with RNase A). A FACScaliber flow cytometry system (BD Biosciences) was used to examine the DNA content of labeled cells.
Boyden assay
For the Boyden assay, HCC cells in serum-free DMEM were seeded in the upper chamber, which was inserted into a 24-well plate. RPMI-1640 supplemented with 10% FBS was added to each well. After 24 h, the HCC cells that remained on the upper surface of the membrane were removed, while the cells that migrated to the lower membrane were fixed in paraformaldehyde, stained with crystal violet and counted.
Western blot and immunofluorescence (IF) assays
In the Western blot assay, the protein samples were transferred onto a PVDF membrane, which was followed by an incubation overnight at 4 °C in a 1:500 dilution of primary antibodies. Subsequently, the membrane was incubated with HRP-conjugated rabbit or mouse secondary antibodies for 1 h at room temperature and were then developed using a chemiluminescence reagent.
For the IF assay, cells were plated on culture slides. After 24 h, when the cells had adhered to the slides, the cells were rinsed in phosphate-buffered saline (PBS) three times and were then fixed in ice-cold methanol-acetone for 10 min. Subsequently, the cells were blocked for 10 min in 5% BSA in PBS, followed by incubation with the primary antibodies in PBS for 1.5 h at room temperature. After three washes in PBS, the slides were incubated with the secondary antibodies for 40 min. After three additional washes, the slides were stained with 4-, 6-diamidino-2-phenylindole (DAPI) for 10 min and were examined using an Olympus confocal imaging system.
In situ hybridization assays
The in situ detection of lncRNA was performed as previously described [
15].
Chromatin immunoprecipitation (ChIP) assay
We performed the ChIP assay using a ChIP assay kit (Millipore, catalog: 17–371) according to the manufacturer’s instructions. Briefly, the cells were fixed with 1% formaldehyde to covalently crosslink the proteins to DNA, after which the chromatin was harvested from the cells. Subsequently, the crosslinked DNA was sheared by sonication (sheared to 200–1000 base pairs in length) and was subjected to an immunoselection process. Then, PCR was performed to measure the enrichment of DNA fragments of the putative c-JUN-binding sites within the LINC01287 promoter.
Luciferase reporter assay
We cloned the full-length STAT3 cDNA (lacking the 3-UTR) into the eukaryotic expression vector pcDNA3.1 (Invitrogen). Subsequently, the 3’-UTR of STAT3 was amplified and cloned downstream of the firefly luciferase gene in the pGL3 vector (Promega); this vector was termed the wild type (WT) STAT3–3’-UTR. Using the GeneTailor™ Site-Directed Mutagenesis System (Invitrogen), we established site-directed mutagenesis of the miR-298 binding sites in the STAT3 3’-UTR. This vector was termed the mutant type (MUT) STAT3–3’-UTR. Subsequently, we co-transfected the HCC cells with the wt or mut STAT3–3’-UTR vector and the miR-298 mimic or inhibitor. Finally, we performed a luciferase assay using a dual Luciferase reporter assay system (Promega) 36 h after transfection. To perform LINC01287 promoter luciferase assays, HCC cells were seeded into 24-well plates and were co-transfected with plasmids that contained the LINC01287 promoter, the pRL-TK-Renilla plasmid (Promega, USA) and pcDNA.3-c-jun.
In vivo tumor growth and invasion assay
All procedures involving animals were approved by the Institutional Committee on Animal Care of Gaozhou People’s Hospital. For tumor growth study, five mice were included into each group. Sh-ctrl, sh-LINC01287 or sh-LINC01287/anti-miR-298 cells were injected subcutaneously into both flanks of nude mice. Four weeks after implantation, the xenografts were removed from the mice and weighed. The tumor volume was calculated according to the following formula: 4π/3 × (width/2)
2 × (length/2). The invasion assay was performed as previously described [
16]. After 3 weeks, nude mice were evaluated for lung colonization capacity.
Statistical analysis
SPSS 13.0 and Graph Pad Prism 5.0 software were used for the statistical analysis. The values are shown as the mean ± the standard error of the mean (S.E.M). Analyses of different groups were performed using one-way ANOVA or two-tailed Student’s t-test. P < 0.05 was considered statistically significant.
Discussion
LncRNAs regulate multiple biological processes, including cancer cell growth and invasion [
21]. Recent studies have suggested that lncRNAs can serve as effective therapeutic targets for cancer treatment. Recently, a list of lncRNAs have been reported to be implicated in regulating HCC proliferation, migration and invasion [
22‐
24]. These literatures suggested that lncRNAs may be a useful strategy for HCC treatment.
In the present study, we used the TGCA database to explore lncRNAs that may be involved in HCC progression. LINC01287 was identified as an oncogene whose expression is significantly increased in HCC tissues. Furthermore, we revealed that LINC01287 was up-regulated in HCC cell lines and tissues. The biological role of LINC01287 has not been investigated before. We then performed functional study to explore the role of LINC01287 in HCC cells. The knockdown of LINC01287 inhibited cell proliferation and colony formation in vitro. The in vivo study revealed that LINC01287 down-regulation decreased tumor growth. In terms of its mechanism, LINC01287 down-regulation contributed to cell cycle arrest in G1 stage. The G1/S phase checkpoint proteins (e.g., c-myc, cyclin D1 and CDK4) were altered when LINC01287 was inhibited. These data suggested that LINC01287 may lead to cell growth via changes in cell cycle progression. We also revealed that LINC01287 down-regulation inhibited GC cell invasion in vitro and decreased lung metastasis in vivo. EMT plays a vital role in promoting cancer cell invasion [
25]. We thus asked whether LINC01287 is involved in the EMT phenotype. It was revealed that LINC01287 down-regulation increased the expression of the epithelial marker E-cadherin, while it decreased the expression of the mesenchymal markers N-cadherin and Vimentin. These data suggested that LINC01287 may promote an EMT phenotype and thus lead to HCC cell invasion.
A previous study revealed that lncRNAs may act as endogenous molecular sponges that compete for miRNAs and negatively regulate miRNA expression [
26,
27]. The interaction between lncRNAs and microRNAs have well been documented in cancer. For instance, lncRNA-PAGBC competitively binds to the tumour suppressive microRNAs miR-133b and miR-511 [
28]. LncRNA FAL1 promotes cell proliferation and migration by acting as a ceRNA of miR-1236 in HCC cells [
29]. These literatures prompted us to ask whether there was interaction between LINC01287 and miRNAs. Using online software, we identified several miRNAs that may interact with LINC01287. Among these miRNAs, we selected miR-298 for further study, since the expression level of miR-298 was significantly increased in sh-LINC01287 cells. Previous documents revealed that miR-298 was implicated in regulating cancer progression. MiR-298 was frequently down-regulated in cancer tissues and acted as a tumor suppressor by inhibiting cell proliferation and migration [
30‐
32]. The role of miR-298 has seldom been reported in HCC, but we revealed that miR-298 may be a tumor suppressor in HCC. We also confirmed the regulatory relationship between LINC01287 and miR-298 based on the following data: 1) LINC01287 down-regulation increased miR-298 expression; 2) the luciferase activity assay confirmed the direct binding ability of the predicted miR-298 binding site on LINC01287; 3) The RIP assays found that LINC01287 and miR-298 were in the same RISC.
Emerging evidence has demonstrated the role of STAT3 in cancer progression, invasion and metastasis [
33]. STAT3 was identified as a down-stream target of miR-298 in our study, and our data revealed that LINC01287 inhibition decreased STAT3 expression. However, when miR-298 was inhibited, the effect of LINC01287 down-regulation on STAT3 expression was abolished. The overexpression of STAT3 can counteract the effect of LINC01287 on HCC cells. These data suggested that LINC01287 exerts its function through the miR-298/STAT3 axis.
We further sought to determine the presence of a positive feedback loop between STAT3 and LINC01287. The recruitment of specific transcription factors often leads to abnormal lncRNA expression [
34]. The transcription factor c-jun is a key regulator of cell growth [
35] and metastasis [
36] in cancer. We revealed four putative binding sites of c-jun in the region upstream of the LINC01287 locus. A subsequent experiment demonstrated that c-jun could positively regulate LINC01287 expression by directly binding to its promoter. Our study showed that STAT3 increased c-jun expression and therefore regulated LINC01287 expression. We further confirmed a positive correlation between STAT3 and LINC01287 in HCC tissues. Taken together, our findings revealed a feedback loop within the LINC01287/miR-298/STAT3 axis.
Overall, our data provided the first evidence that the LINC01287/miR-298/STAT3 axis controls cell growth and invasiveness of HCC cells. Therapeutics that target LINC01287 may therefore improve the treatment of HCC.