1 Introduction

Since 1978 when Clostridium difficile was first recognized as a human pathogen it was often associated with hospital outbreaks (1). For this reason typing techniques were developed very early. As in other genera, initial phenotypic methods, mostly serogrouping (2), were replaced by molecular methods.

Typing is used to follow and investigate outbreaks (3–6), to identify the emergence of new strains with increased virulence (7), to track transmission of C. difficile not only locally but also globally (8), and to clarify possible animal–human transmission (9–11). Current typing methods are summarized in Table 4.1. Three of those (restriction endonuclease analysis, REA; pulsed field gel electrophoresis, PFGE; PCR ribotyping) are currently considered as standard methods and are schematically presented in Fig. 4.1. New and more discriminatory methods such as MLVA (multilocus variable-number tandem-repeat analysis) are likely to be increasingly used in routine outbreak investigations (6).

Fig. 4.1.
figure 1figure 1

Presentation of three standard molecular typing methods used for C. difficile. (a) PCR ribotyping, (b) restriction endonuclease analysis (REA), and (c) pulsed filed gel electrophoresis PFGE.

Full size image
Table 4.1 Overview of molecular typing methods described for C. difficile
Full size table

1.1 Restriction Endonuclease Analysis (REA)

For REA the whole bacterial DNA is cut with HindIII and resulting bands are visualized on agarose gels. As HindIII is a 6 bp cutter with numerous restriction sites in the genome the band pattern is not as clear as in PFGE (Fig. 4.1). Automated interpretation is still not possible and probably for this reason the method is not widely used. It was first described by Kuijper et al. (12) but later implemented by Gerding and colleagues (13). The Gerding laboratory maintains a collection of mostly clinical C. difficile isolates obtained from multiple US and other sources over a 20-year period. Isolates showing six or fewer visible restriction band differences (a similarity index of 90%) are placed within the same REA group and designated by letter. Isolates with identical restriction patterns are assigned a specific REA type designated by number (e.g., CF1, CF2).

This collection was important for the comparison of modern and historical strains during the emergence of the type BI/NAP1/027 and it demonstrated that such strains were present already in the past but were rare and that their increased virulence is correlated with the emergence of fluoroquinolone resistance (14).

1.2 Pulsed Field Gel Electrophoresis – PFGE

PFGE was one of the first molecular typing methods described for C. difficile and is still considered the standard in North America (Canada and USA). Initially, some types were untypable because of DNA degradation; however, the new improved protocols have increased typability to almost 100% (15).

Most groups use SmaI restriction (3, 15–17), while in some cases SacII is more discriminatory (18; Janezic, unpublished data).

SmaI whole genome restriction gives 7–15 restriction fragments ranging from 10 to 1,100 kbp, while SacII gives 10–20 fragments in the same size range. Band profiles can be analyzed visually or with appropriate software (e.g., BioNumerics, Applied Maths) (see Note 1). Strains with ≥ 80% similarity in band pattern are usually regarded as a single pulsotype. North America uses NAP and type number for designation of pulsotypes (North American Pulsotype; NAP1, NAP2, etc.). To date there is no standard protocol available for easy inter-laboratory comparison of pulsotypes.

1.3 PCR Ribotyping

In C. difficile PCR ribotyping is based on amplification of intergenic spacer region (ITS) between 16S and 23S rDNA (Fig. 4.1). Because this operon is present in several copies in C. difficile genome and copies also differ in the length of ITS a single primer pair can result in a pattern of bands ranging from 200 to 700 bp. The bands are usually visualized on an agarose gel. Resulting band patterns can be analyzed either visually or with suitable software (usually BioNumerics, Applied Maths) (see Note 1).

PCR ribotyping was described by several groups (19–23). Currently, most laboratories will use primers and conditions described by Stubbs et al. (23) or Bidet et al. (22) and both methods will give comparable band patterns (Fig. 4.2).

Fig. 4.2.
figure 2figure 2

Comparison of two PCR ribotyping methods using slightly different primers and thermocycling conditions. Lanes 1–8 primers described by Bidet et al.; lanes 9–15 primers described by Stubbs et al. M: 100 bp ladder.

Full size image

PCR ribotype is defined as a group of strains with identical band pattern. A single band difference represents a new ribotype. A large collection of strains from multiple sources is maintained at Anaerobe Reference Unit, Cardiff, UK. It contains more than 200 ribotypes designated by numbers (e.g., 001, 027, 106, …) (23).

PCR ribotyping is the standard typing method in Europe. However, the agarose gel analysis provides an obstacle in standardization and hence PCR ribotype can only be correctly assigned if the laboratory has reference strain(s). If the reference ribotype strains are not available a local nomenclature is used and types can be only compared within the local collection. Recently, a new method of capillary gel electrophoresis-based PCR ribotyping, supported by a web-based database has been developed which might be a solution to the problems associated with comparison of typing results between laboratories (24).

1.4 Comparative Studies and Unification of Typing Nomenclatures

Molecular typing methods differ in their discriminatory power and in the time needed to obtain the results. Many studies have compared two or more typing methods within the local setting (3, 7, 25, 26) and some large comparative international studies have typed larger and well-characterized strain collections (27, 28).

PFGE has good discriminatory power but it is labor-intensive, taking 4–5 days from pure culture to the result. REA has also very good discriminatory power but because of difficulty and subjectivity in interpretation of the banding patterns it is only performed in a single laboratory. MLVA is a method with great discriminatory power and the results are easily exchangeable between laboratories (28). PCR ribotyping is quick and easy but inter-laboratory data exchange is difficult due to the lack of standardization.

Two difficulties are currently associated with C. difficile typing. While there are good methods available to type strains in the local environment, the global, inter-laboratory comparison is impossible without exchange of reference strains. Secondly, North America and Europe use two different typing systems (PFGE and PCR ribotyping, respectively) and this obviously affects the international comparability. There were some early attempts to unify typing nomenclature, e.g., to assign a correlation between specific pulsotype and PCR ribotype (29) and this was used for the first time during the recent emergence of NAP1/BI/027 (14, 30). Development of easy interchangeable methods like MLVA, sequencer-based PCR ribotyping or single locus-based sequence typing methods should improve this situation.

2 Materials

2.1 Pulsed Field Gel Electrophoresis (PFGE)

  1. 1.

    Blood agar plates

  2. 2.

    Brain heart infusion broth (BHI)

  3. 3.

    Cell suspension buffer (CSB): 0.18 M NaCl, 10 mM Tris (pH 8.0) (see Note 2).

  4. 4.

    TE2 buffer: 10 mM Tris (pH 8.0), 2 mM EDTA (pH 8.0) (see Note 2).

  5. 5.

    Cell lysis buffer: 10 mM Tris (pH 8.0), 0.5 M EDTA, 1% (w/v) sodium dodecyl sulfate (SDS) (see Note 3).

  6. 6.

    Proteinase K (Sigma) (see Note 4).

  7. 7.

    Restriction endonuclease SmaI, SacII, and XbaI with appropriate 10X NEBuffer (New England Biolabs).

  8. 8.

    Pre-restriction incubation mixture: 10X NEBuffer diluted 1:10 in nuclease-free water.

  9. 9.

    Restriction mixture: 1X NEBuffer and 15 U of SmaI, SacII, or XbaI.

  10. 10.

    TBE buffer: Prepare 5X stock with 0.445 M Tris, 0.445 M boric acid, and 10 mM EDTA. Store at room temperature. Working solution (0.3X) is prepared by diluting 60 ml of 5X TBE with 940 ml of distilled water.

  11. 11.

    Pulsed Field Certified™ agarose (Bio-Rad, California).

  12. 12.

    DNA staining solution: 0.2 μg/ml of ethidium bromide (EtBr) in distilled water.

  13. 13.

    Salmonella ser. Braenderup is used as a reference standard (see Note 5).

2.2 PCR Ribotyping

  1. 1.

    TAE buffer: Prepare 50X stock with 2.0 M Tris, 2.0 M acetic acid, and 50 mM EDTA. Adjust pH to 7.5–8.0. Working solution (1X) is prepared by diluting 20 ml of 50X TAE with 980 ml of distilled water. Cool the buffer to 4–8°C before use.

  2. 2.

    DNA staining solution: 0.2 μg/ml of ethidium bromide (EtBr) in distilled water.

3 Method

3.1 PFGE

Inoculate 3–5 C. difficile colonies from blood agar plate (28–48 h culture) into 5 ml of brain heart infusion broth (BHI) and incubate in an anaerobic atmosphere at 37°C.

Inoculate 0.1 ml of overnight culture into 5 ml of fresh pre-reduced BHI and incubate for 5 h anaerobically at 37°C.

Prepare 1.5% gel by mixing 0.3 g of Pulsed Field Certified™ agarose and 20 ml of TE2 buffer. Dissolve agarose by heating in a microwave oven. Cool the agarose to 60°C and maintain the temperature until use.

Remove 3 ml of culture, centrifuge, and wash it in 500 μl of CSB buffer. Pellet suspension by centrifugation at 10,000×g for 10 min, resuspend the pellet in CSB buffer, and adjust the concentration of suspension to 1.5 × 109 bacteria/ml.

To prepare agarose plugs, mix an equal volume of cell suspension and 1.5% agarose. Mix gently by pipetting. Immediately dispense the mixture into appropriate well of the plug mold (avoid bubbles). Leave plugs to solidify at 4°C for 15–30 min.

In 2 ml tubes prepare 990 μl of cell lysis buffer and 10 μl of proteinase K in final concentration of 0.1 mg/ml. Transfer the plugs from mold to the tube and incubate overnight at 37°C.

Carefully pour off the lysis buffer and add 1 ml of TE2 buffer. Incubate at 37°C for 30 min. Pour off TE2 buffer and repeat the washing step five times. If plugs are not used immediately, store them at 4°C in TE2 buffer.

Remove the plug from TE2 buffer with a spatula and place it on parafilm or glass slide. Cut off the small slice of a plug (approximately 5 × 3 mm) with a scalpel and transfer it to the tube containing 100 μl of pre-restriction incubation mixture. The shape and size of the plug slice will depend on the size of comb teeth used for casting the gel. Incubate for 30 min at room temperature.

Pour off the pre-restriction incubation mixture and add 100 μl of restriction mixture. Incubate at 37°C (for SacII and XbaI) or at room temperature (for SmaI) for at least 4 h or overnight.

The following instructions are meant for the Biometra PFGE system.

Prepare a 1.0% gel by mixing 3.0 g of Pulsed Field Certified™ agarose (Bio-Rad, California) and 300 ml of 0.3X TBE buffer. Dissolve agarose by heating in a microwave oven. Mix the agarose with a magnetic stirrer during heating (see Note 6). Save a small volume (approximately 5 ml) of melted and cooled agarose to fix plugs on comb teeth and to seal wells after plugs are loaded. Agarose can be kept at room temperature, melted and reused when needed.

Remove plug slices from tubes (excess buffer should be removed) and load them on the bottom of comb teeth. Load S. ser Braenderup standard on first, and then every fifth lane. Seal the plugs with 1% agarose (50–60°C).

Level the gel form and position the comb teeth. Carefully pour the agarose (cooled to 50–60°C) and let the gel to solidify for 30–45 min. Remove the comb and seal the holes with 1% agarose.

Pour 2.4 l of 0.3X TBE buffer into electrophoresis chamber and let the buffer to cool to 13°C. Place the gel casting tray with the gel in the electrophoresis chamber. Assemble the PFGE system following the manufacturer’s instructions. Select the following conditions for electrophoresis: initial switch time of 2 s, final switch time of 60 s, voltage 200 V, included angle 120°, temperature 13°C, and run time 21 h.

When electrophoresis is over stain the gel with ethidium bromide for 15–30 min and then destain the gel in distilled water for 20–60 min. Capture the image with gel documentation system.

3.2 PCR Ribotyping

Primers described by Bidet et al. are used to amplify intergenic regions between 16S and 23S rDNA. Sequence of primers (5′–3′):

  • Primer annealing on 3′ end of 16S rRNA gene: GTGCGGCTGGATCACCTCCT

  • Primer annealing on 5′ end of 23S rRNA gene: CCCTGCACCCTTAATAACTTGACC.

Reaction mixture:

H2O

37.0 μl

10X buffer with MgCl2 a

5.0 μl

20 mM dNTPs

2.0 μl

Primer 1 (50 pmol/μl)

1.0 μl

Primer 2 (50 pmol/μl)

1.0 μl

Taq DNA polymerase (5 U/μl)

0.25 μl

  1. aFinal concentration of MgCl2 in reaction mixture should be 1.5 mM.

Distribute PCR mastermix in PCR tubes and add 3 μl of crude template DNA or 2 μl of pure DNA.

Amplification conditions:

  • Initial denaturation at 95°C for 5 min

  • 35 cycles of

    • 1 min at 95°C for denaturation

    • 1 min at 57°C for annealing

    • 1 min at 72°C for elongation

  • Final elongation at 72°C for 10 min

After amplification, concentrate the products by heating at 75°C for 45 min (leave the lid of thermal cycler and caps on the tubes open so that the water can evaporate). For electrophoresis 20 μl of PCR product is used.

Agarose gel electrophoresis:

Prepare 3% agarose gel (Certified™ Low Range Ultra Agarose; Bio-Rad, California, USA) in 1X TAE buffer. Dissolve the agarose by heating in a microwave oven. Gently mix the agarose with a magnetic stirrer during heating (avoiding bubbles) (see Note 6). Be careful not to overboil the agarose. If it starts to overboil, pause the microwave and allow to calm down. Continue until all the agarose has dissolved. Carefully pour the agarose (cooled to 50–60°C) and let it solidify for 30–45 min before running the electrophoresis at 2.5 V/cm for 5 h. Keep the buffer cold during electrophoresis (see Note 7).

After electrophoresis stain the gel with ethidium bromide for 10–20 min and destain in distilled water for 10–30 min. Capture the image with gel documentation system. PCR ribotypes for which the reference strains are available are designated by standard Cardiff nomenclature, while others are designated by internal nomenclature.

4 Notes

  1. 1.

    BioNumerics software (Applied Maths, Sint-Martens-Latem, Belgium) is often used for analysis of banding patterns. It offers general platform for data analysis, databasing, and exchanging data in uniform way. Other gel analysis softwares (e.g., provided with hardware for gel imaging) can be used as well.

  2. 2.

    CSB buffer is stored at room temperature.

  3. 3.

    Cell lysis buffer can be stored at room temperature. Because SDS in buffer will precipitate at room temperature, store the bottle for 2–4 h (depending of the buffer volume) at about 37°C prior to use.

  4. 4.

    Prepare 10 mg/ml stock solution, aliquot, and store at –20°C.

  5. 5.

    Salmonella DNA must be digested with XbaI to give the appropriate band pattern. Follow instructions for C. difficile for making plugs and preparing restriction digest. Agarose plugs can be stored in TE2 buffer at 4°C for at least 3 months.

  6. 6.

    If using microwave oven for melting the agarose use only stirrers that are coated in plastic. Do not put metal stirrers in microwave oven.

  7. 7.

    To prevent excessive heating of the buffer and consecutive DNA degradation during electrophoresis you can either change the buffer every 1.5–2 h or you can surround the electrophoresis chamber with ice bags.