Skip to main content
Erschienen in: Virchows Archiv 3/2008

Open Access 01.03.2008 | Case Report

Occurrence of ocular melanoma thirteen years after skin melanoma: two separate primaries or metastatic disease? A case solved with NRAS and CDKN2A (INK4A-ARF) mutational analysis

verfasst von: Heidi V. N. Küsters-Vandevelde, Jan E. E. Keunen, Pieter Wesseling, Marian A. J. Verdijk, Marjolijn J. L. Ligtenberg, Willeke A. M. Blokx

Erschienen in: Virchows Archiv | Ausgabe 3/2008

Abstract

The differential diagnosis between primary uveal melanoma and cutaneous melanoma metastasis in the eye may be difficult, both clinically and histologically. We report successful application of combined mutational analysis of the NRAS and the CDKN2A gene to discriminate between these two entities. The patient had a history of a superficial spreading cutaneous melanoma of the left shoulder. Nine years later, she developed a lymph node metastasis in the left axilla, and 13 years later she presented with an atypical, pigmented tumor in the uvea. Histologically, the origin of the uveal melanoma could not be determined with certainty. We performed molecular analysis on the skin melanoma, the lymph node metastasis and the uveal melanoma. We detected an NRAS codon 61 mutation (c.182A>G, p.Gln61Arg) in all three tumor specimens. This mutation was absent in the normal control tissue of the patient, thereby excluding a germline mutation. To confirm a clonal relationship between the tumors, we also performed CDKN2A mutational analysis. We detected a CDKN2A mutation ((p16) c.238C>T, p.Arg80X, (p14) c.404C>T, p.Pro135Leu)) in the tumor samples, but not in the normal control tissue of the patient. We concluded that the uveal melanoma is a metastasis from the cutaneous melanoma removed 13 years before.

Introduction

Especially in case of two cutaneous melanomas or a combination of an ocular and cutaneous melanoma, the clinical and histological differential diagnosis between a second primary melanoma and a melanoma metastasis can be very difficult, as both organs show a relative high frequency of primary melanomas. The commonest primary intraocular malignancy of adults is uveal melanoma [10]. Metastatic melanoma to the eye is rare and generally occurs in patients with widespread metastatic disease [17]. The most common site of metastatic cutaneous melanoma involvement of the eye is the choroid (46%). Metastatic melanoma to the vitreous and anterior chamber is rare (11–18% of all intraocular cutaneous melanoma metastases) [6]. Differentiation between a primary uveal melanoma and an intraocular metastasis is of prognostic and clinical importance, as intraocular metastases imply systemic spread and have a poor prognosis with a patient survival rarely exceeding more than 1 year [17].
Mutations in BRAF and less frequently in NRAS are involved in cutaneous melanoma development [4, 11]. In contrast, in primary uveal melanomas, BRAF and NRAS do not appear to be involved in tumorigenesis [3, 8, 15].
CDKN2A mutations have been detected in cutaneous melanoma, both in sporadic melanoma and especially in familial melanoma, with frequencies ranging up to 30% for the latter [16]. Both in primary sporadic ocular melanoma and in familial cases of primary uveal melanoma, CDKN2A mutations are very rarely detected (5%) [9, 14].
We present a case of a rare and relatively late occurrence of an intraocular melanoma metastasis 13 years after development of a primary cutaneous melanoma, and illustrate the diagnostic use of RAS and CDKN2A mutational analysis.

Clinical history

In November 2005, a 47-year-old caucasian female presented to her local ophthalmologist because of mouches volantes in her left eye. She had a history of a superficial spreading cutaneous melanoma of the left shoulder (Clark level IV) removed in 1994, and a lymph node metastasis in the left axilla excised in 2003. Since then no systemic metastasis was detected at annual control. Visual acuity was 20/20 in both eyes and the vitreous of the left eye showed some opacities. These opacities increased gradually over a 2-month period, but resolved spontaneously thereafter. In July 2006, she again developed complaints of recurrent mouches volantes. The diagnosis revealed uveitis, and the patient was treated with local steroids. However, local treatment was not effective and the patient was referred to our center. Examination of the right eye revealed no abnormalities. The visual acuity in the left eye was 20/40, and non-pigmented cells were noticed in the anterior chamber, along with a vitreous haze. As an extensive uveitis screening revealed no abnormalities, intraocular metastasis of the cutaneous melanoma removed 13 years earlier was suspected. A focal, white, and preretinal condensation of vitreous cells developed within a few weeks and some pigmented cells became visible in the vitreous. Subsequently, the intraocular pressure increased to 25 mmHg due to non-pigmented cells in the anterior chamber. A diagnostic vitrectomy was performed. Vitreous samples were positive for malignant melanoma cells. A total body examination excluded systemic metastasis outside the eye. Progressive worsening of the condition of the left eye turned into a visual acuity of 20/80 and a secondary glaucoma up to 50 mmHg occurred, refractive to topical medication. On patient’s request, no eye salvaging treatment such as external beam radiation was performed, and the affected eye was enucleated. Histological examination of the eye ball revealed an atypical melanocytic lesion in the iris and ciliary body, with extension under the retina and invasion of the sclera. Although histologically the growth pattern was consistent with primary uveal melanoma, an intraocular metastasis could not be excluded with certainty. As discrimination between second primary and metastatic melanoma was of prognostic importance, we decided to perform mutational analysis for the BRAF, NRAS, HRAS, and CDKN2A genes on all tumor samples, as well as on the normal control skin of this patient.

Materials and methods

BRAF, NRAS, and HRAS mutational analysis

DNA isolation was performed as previously described [1, 2]. Briefly, of all tissue samples about three 10-μm unstained sections of formalin-fixed paraffin-embedded tissue were manually microdissected, using H&E stained sections as a reference. The tumor cell percentage in the microdissected specimens was estimated as 70% for the cutaneous and uveal melanoma and as 90% for the lymph node metastasis. DNA was purified using the DNeasy Blood and Tissue kit (Qiagen). Primer sequences are shown in Table 1. Polymerase chain reaction (PCR) amplification of BRAF exon 15, NRAS exons 2 and 3, and HRAS exon 3 was performed in a total volume of 50-μl PCR mix containing 50 ng template DNA, 5 μl PCR buffer IV (Integro), 10 μl dNTP 0.2 mM, 6.0 μl MgCl2 3.0 mM, 0.125 μl Taq DNA polymerase (Integro, 5 U/μl), and 22.9 μl mQ. An initial denaturation at 92°C for 5 min was followed by 35 cycles of denaturation at 94°C for 45 s, annealing at 60°C for 45 s, and extension at 72°C for 45 s with a final extension of 5 min at 72°C. DNA amplification was performed in a MJ PTC 200 PCR cycler (Biozym). After purification of the PCR products using a Qiaquick PCR purification kit (Qiagen), sequence analysis was performed using BigDye terminator version 2 of Applied Biosystems on an ABI 3730 automatic sequencer (Applied Biosystems).
Table 1
Primers used in the analysis of CDKN2A, BRAF, NRAS and HRAS, and the size of their PCR products
Exon
Forward
Reverse
Size PCR product (bp)
CDKN2A (INK4a-ARF)*
 1B
TCAGGGAAGGCGGGTGCGCG
GCCGCGGGATGTGAACCAC
244
 1B
CGCCGCGAGTGAGGGTTTT
CACCGCGGTTATCTCCTCC
263
 1A
GAGAGGGGGAGAGCAGGCAG
GCACCTCCTCTACCCGACC
122
 1A
GGAGCAGCATGGAGCCTTC
AGTCGCCCGCCATCCC CTG
177
 2
AGCTTCCTTTCCGTCATGC
GCAGCACCACCAGCGTGTC
202
 2
AGCCCAACTGCGCCGACCC
CCAGGTCCACGGGCAGACG
146
 2
TGGACGTGCGCGATGCCTG
GGAAGCTCTCAGGGTACAAATTC
188
 3
CGGTAGGGACGGCAAGAGAG
GAGGGACCTTCGGTGACTGATG
162
BRAF* exon 15
CCTTTACTTACTACACCTCAG
AAAAATAGCCTCAATTCTTAC
197
NRAS* exon 2
GGTTTCCAACAGGTTCTTGC
TGGGTAAAGATGATCCGACA
240
NRAS* exon 3
GATTCTTACAGAAAACAAGTGG
TAATGCTCCTAGTACCTGTAGAG
230
HRAS* exon 3
CTGCAGGATTCCTACCGGA
ACTTGGTGTTGTTGATGGCA
196
*All forward primers contained the M13 consensus sequence TGT AAA ACG ACG GCC AGT at the 5′ end. All reverse primers contained the M13 consensus sequence CAG GAA ACA GCT ATG ACC.

CDKN2A mutational analysis

The CDKN2A mutation analysis was performed as previously described [1, 2]. Briefly, PCR was performed with AmpliTaq Gold DNA Polymerase (Applied Biosystems) using an optimized MgCl2 concentration (varying from 1 to 2 mM) in a MJ PTC 200 PCR cycler (Biozym). All primers used in the analysis contained either an M13 forward or M13 reverse consensus sequence. All primers and sizes of the PCR products are listed in Table 1. The entire open reading frames of CDKN2A were analyzed in DNA isolated from the tumor samples and normal skin.

Results

Revision of the primary cutaneous melanoma removed in 1994 revealed an asymmetric compound melanocytic lesion with focal ulceration and lack of maturation toward the base of the lesion. The melanocytes showed an epithelioid phenotype with anisokaryosis and prominent nucleoli. Deep mitotic figures were present (Fig. 1). A satellite lesion was present at the junction of the dermis toward the subcutis. Tumor thickness measured 1.5 mm, not including the satellite. Focally, a preexistent nevus was present. Resection margins were at least 2 mm free of tumor. Revision of the lymph node metastasis in the left axilla that was excised in 2003 revealed a large tumor surrounded by limited preexistent lymphoid tissue. The tumor cells showed morphological resemblance to the cutaneous melanoma cells with an epithelioid phenotype and frequent mitotic figures. In addition, in the lymph node metastasis large areas of necrosis were present.
Histological examination of the eye ball revealed an atypical melanocytic lesion in the iris and ciliary body, with extension under the retina and invasion of the sclera. Tumor cells were also present at the surface of the ciliary body in the anterior angle, and showed invasion in the area containing the canal of Schlemm (Fig. 1). The melanocytic cells showed an epithelioid morphology, with focally spindle cell pattern, marked pleiomorphism of tumor cell nuclei, and occasional mitotic figures. Tumor thickness measured 3 mm.
Molecular analysis of the NRAS gene revealed a codon 61 mutation (c.182A>G, p.Gln61Arg) in all three tumor samples. This mutation was not present in the normal control skin of the patient (Fig. 2). No mutations were detected in NRAS exon 2, BRAF exon 15, and HRAS exon 3. We also performed CDKN2A mutational analysis on all samples. A CDKN2A mutation ((p16)c.238C>T, p.Arg80X, (p14)c.404C>T, p.Pro135Leu)) was present in all three tumor samples, but absent in the normal control tissue of the patient, indicating that this is a somatic mutation (Fig. 3). It was concluded that the ocular melanoma should be considered as a metastasis of the cutaneous melanoma diagnosed 13 years before.

Discussion

This case report illustrates that molecular analysis can be very helpful in the differential diagnosis between a second primary melanoma and a melanoma metastasis. We chose for mutational analysis of the BRAF gene and the ras proto-oncogenes NRAS and HRAS, because these genes are frequently involved in cutaneous melanocytic lesions, with a reported total mutation frequency for NRAS or BRAF of 82% in cutaneous melanoma [4]. Furthermore, these mutations are described to occur early in tumorigenesis, before the development of metastasis [4, 11]. We detected in all three tumor samples an NRAS codon 61 mutation (c.182A>G, p.Gln61Arg). NRAS mutations are known to occur in up to 30% of all cutaneous melanoma cases, the most common being mutations in NRAS codon 61 [4, 7, 11]. In contrast, NRAS mutations have been reported to be absent in primary uveal melanoma [3, 15]. The NRAS mutation thus strongly supports the metastatic nature of the intraocular melanoma in our patient. The finding of the same somatic mutation in CDKN2A in both cutaneous and intraocular melanoma confirms the metastatic nature of the disease in this patient. In contrast to NRAS mutations that are limited to codon 61 and codon 12 in cutaneous melanoma, somatic CDKN2A mutations are much more tumor specific and thus are not expected to be identical in two different primary melanomas [7]. Furthermore, activating CDKN2A mutations are described to be very rare in primary ocular melanomas [9, 13].
Eskandarpour et al. reported specific activating mutations in NRAS codon 61 in 95% of primary hereditary cutaneous melanomas (20/21), but in only 10% of sporadic cutaneous melanomas (1/10) [5]. Therefore, the presence of a somatic NRAS codon 61 mutation might indicate a familial predisposition to melanoma instead of a clonal relationship.
Discriminating between a second primary intraocular melanoma and metastatic disease is of prognostic importance. Intraocular metastases of melanoma are associated with a poor prognosis with a mean interval between diagnosis of the intraocular metastasis and death of 8.8 months [17]. In contrast, survival in patients diagnosed with a primary intraocular melanoma is more variable, with a reported 5-year cumulative survival rate of up to 60% [12].
In conclusion, this case report illustrates that mutational analysis for the RAS proto-oncogenes and CDKN2A can be useful in the clinically relevant, but sometimes difficult, differential diagnosis between a second primary intraocular melanoma and an intraocular metastasis of a cutaneous melanoma.

Conflict of interest statement

We declare that we have no conflict of interest.
We declare that the molecular analyses comply with the current laws in The Netherlands.
Open AccessThis is an open access article distributed under the terms of the Creative Commons Attribution Noncommercial License (https://​creativecommons.​org/​licenses/​by-nc/​2.​0), which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

Unsere Produktempfehlungen

e.Med Interdisziplinär

Kombi-Abonnement

Für Ihren Erfolg in Klinik und Praxis - Die beste Hilfe in Ihrem Arbeitsalltag

Mit e.Med Interdisziplinär erhalten Sie Zugang zu allen CME-Fortbildungen und Fachzeitschriften auf SpringerMedizin.de.

© Springer Medizin

Bis 11. April 2024 bestellen und im ersten Jahr 50 % sparen!

Literatur
1.
Zurück zum Zitat Blokx WA, Lesterhuis JJ, Andriessen MP, Verdijk MA, Punt KJ, Ligtenberg MJ (2007) CDKN2A (INK4A-ARF) mutation analysis to distinguish cutaneous melanoma metastasis from a second primary melanoma. Am J Surg Pathol 31:637–641PubMedCrossRef Blokx WA, Lesterhuis JJ, Andriessen MP, Verdijk MA, Punt KJ, Ligtenberg MJ (2007) CDKN2A (INK4A-ARF) mutation analysis to distinguish cutaneous melanoma metastasis from a second primary melanoma. Am J Surg Pathol 31:637–641PubMedCrossRef
2.
Zurück zum Zitat Blokx WA, Ruiter DJ, Verdijk MA, de Wilde PC, Willems RW, de Jong EM, Ligtenberg MJ (2005) INK4-ARF and p53 mutations in metastatic cutaneous squamous cell carcinoma: case report and archival study on the use of Ink4a-ARF and p53 mutation analysis in identification of the corresponding primary tumor. Am J Surg Pathol 29:125–130PubMedCrossRef Blokx WA, Ruiter DJ, Verdijk MA, de Wilde PC, Willems RW, de Jong EM, Ligtenberg MJ (2005) INK4-ARF and p53 mutations in metastatic cutaneous squamous cell carcinoma: case report and archival study on the use of Ink4a-ARF and p53 mutation analysis in identification of the corresponding primary tumor. Am J Surg Pathol 29:125–130PubMedCrossRef
3.
Zurück zum Zitat Cruz F III, Rubin BP, Wilson D, Town A, Schroeder A, Haley A, Bainbridge T, Heinrich MC, Corless CL (2003) Absence of BRAF and NRAS mutations in uveal melanoma. Cancer Res 63:5761–5766PubMed Cruz F III, Rubin BP, Wilson D, Town A, Schroeder A, Haley A, Bainbridge T, Heinrich MC, Corless CL (2003) Absence of BRAF and NRAS mutations in uveal melanoma. Cancer Res 63:5761–5766PubMed
4.
Zurück zum Zitat Edlundh-Rose E, Egyhazi S, Omholt K, Mansson-Brahme E, Platz A, Hansson J, Lundeberg J (2006) NRAS and BRAF mutations in melanoma tumours in relation to clinical characteristics: a study based on mutation screening by pyrosequencing. Melanoma Res 16:471–478PubMedCrossRef Edlundh-Rose E, Egyhazi S, Omholt K, Mansson-Brahme E, Platz A, Hansson J, Lundeberg J (2006) NRAS and BRAF mutations in melanoma tumours in relation to clinical characteristics: a study based on mutation screening by pyrosequencing. Melanoma Res 16:471–478PubMedCrossRef
5.
Zurück zum Zitat Eskandarpour M, Hashemi J, Kanter L, Ringborg U, Platz A, Hansson J (2003) Frequency of UV-inducible NRAS mutations in melanomas of patients with germline CDKN2A mutations. J Natl Cancer Inst 95:790–798PubMedCrossRef Eskandarpour M, Hashemi J, Kanter L, Ringborg U, Platz A, Hansson J (2003) Frequency of UV-inducible NRAS mutations in melanomas of patients with germline CDKN2A mutations. J Natl Cancer Inst 95:790–798PubMedCrossRef
6.
Zurück zum Zitat Gunduz K, Shields JA, Shields CL, Eagle RC Jr (1998) Cutaneous melanoma metastatic to the vitreous cavity. Ophthalmology 105:600–605PubMedCrossRef Gunduz K, Shields JA, Shields CL, Eagle RC Jr (1998) Cutaneous melanoma metastatic to the vitreous cavity. Ophthalmology 105:600–605PubMedCrossRef
7.
Zurück zum Zitat Hocker T, Tsao H (2007) Ultraviolet radiation and melanoma: a systematic review and analysis of reported sequence variants. Hum Mutat 28:578–588PubMedCrossRef Hocker T, Tsao H (2007) Ultraviolet radiation and melanoma: a systematic review and analysis of reported sequence variants. Hum Mutat 28:578–588PubMedCrossRef
8.
Zurück zum Zitat Kilic E, Bruggenwirth HT, Verbiest MM, Zwarthoff EC, Mooy NM, Luyten GP, de KA (2004) The RAS-BRAF kinase pathway is not involved in uveal melanoma. Melanoma Res 14:203–205PubMedCrossRef Kilic E, Bruggenwirth HT, Verbiest MM, Zwarthoff EC, Mooy NM, Luyten GP, de KA (2004) The RAS-BRAF kinase pathway is not involved in uveal melanoma. Melanoma Res 14:203–205PubMedCrossRef
9.
Zurück zum Zitat Lamperska K, Mackiewicz K, Kaczmarek A, Kwiatkowska E, Starzycka M, Romanowska B, Heizman J, Stachura J, Mackiewicz A (2002) Expression of p16 in sporadic primary uveal melanoma. Acta Biochim Pol 49:377–385PubMed Lamperska K, Mackiewicz K, Kaczmarek A, Kwiatkowska E, Starzycka M, Romanowska B, Heizman J, Stachura J, Mackiewicz A (2002) Expression of p16 in sporadic primary uveal melanoma. Acta Biochim Pol 49:377–385PubMed
10.
Zurück zum Zitat Lyons CJ, Hungerford J (1990) Detection of ocular malignancies. J R Soc Med 83:165–167PubMed Lyons CJ, Hungerford J (1990) Detection of ocular malignancies. J R Soc Med 83:165–167PubMed
11.
Zurück zum Zitat Omholt K, Karsberg S, Platz A, Kanter L, Ringborg U, Hansson J (2002) Screening of N-ras codon 61 mutations in paired primary and metastatic cutaneous melanomas: mutations occur early and persist throughout tumor progression. Clin Cancer Res 8:3468–3474PubMed Omholt K, Karsberg S, Platz A, Kanter L, Ringborg U, Hansson J (2002) Screening of N-ras codon 61 mutations in paired primary and metastatic cutaneous melanomas: mutations occur early and persist throughout tumor progression. Clin Cancer Res 8:3468–3474PubMed
12.
Zurück zum Zitat Park WL, Jenison-Williams T, Pasqua-Darnell T (2003) Uveal melanoma and poor treatment compliance: an atypical outcome with literature review. Optom Vis Sci 80:344–355PubMedCrossRef Park WL, Jenison-Williams T, Pasqua-Darnell T (2003) Uveal melanoma and poor treatment compliance: an atypical outcome with literature review. Optom Vis Sci 80:344–355PubMedCrossRef
13.
Zurück zum Zitat Smith JH, Padnick-Silver L, Newlin A, Rhodes K, Rubinstein WS (2007) Genetic study of familial uveal melanoma: association of uveal and cutaneous melanoma with cutaneous and ocular nevi. Ophthalmology 114:774–779PubMedCrossRef Smith JH, Padnick-Silver L, Newlin A, Rhodes K, Rubinstein WS (2007) Genetic study of familial uveal melanoma: association of uveal and cutaneous melanoma with cutaneous and ocular nevi. Ophthalmology 114:774–779PubMedCrossRef
14.
Zurück zum Zitat Smith JH, Padnick-Silver L, Newlin A, Rhodes K, Rubinstein WS (2007) Genetic study of familial uveal melanoma: association of uveal and cutaneous melanoma with cutaneous and ocular nevi. Ophthalmology 114:774–779PubMedCrossRef Smith JH, Padnick-Silver L, Newlin A, Rhodes K, Rubinstein WS (2007) Genetic study of familial uveal melanoma: association of uveal and cutaneous melanoma with cutaneous and ocular nevi. Ophthalmology 114:774–779PubMedCrossRef
15.
Zurück zum Zitat Soparker CN, O'Brien JM, Albert DM (1993) Investigation of the role of the ras protooncogene point mutation in human uveal melanomas. Invest Ophthalmol Vis Sci 34:2203–2209PubMed Soparker CN, O'Brien JM, Albert DM (1993) Investigation of the role of the ras protooncogene point mutation in human uveal melanomas. Invest Ophthalmol Vis Sci 34:2203–2209PubMed
16.
Zurück zum Zitat Soufir N, Basset-Seguin N (2001) The INK4a-ARF locus: role in the genetic predisposition to familial melanoma and in skin carcinogenesis. Bull Cancer 88:1061–1067PubMed Soufir N, Basset-Seguin N (2001) The INK4a-ARF locus: role in the genetic predisposition to familial melanoma and in skin carcinogenesis. Bull Cancer 88:1061–1067PubMed
17.
Zurück zum Zitat Zografos L, Ducrey N, Beati D, Schalenbourg A, Spahn B, Balmer A, Othenin-Girard CB, Chamot L, Egger E (2003) Metastatic melanoma in the eye and orbit. Ophthalmology 110:2245–2256PubMedCrossRef Zografos L, Ducrey N, Beati D, Schalenbourg A, Spahn B, Balmer A, Othenin-Girard CB, Chamot L, Egger E (2003) Metastatic melanoma in the eye and orbit. Ophthalmology 110:2245–2256PubMedCrossRef
Metadaten
Titel
Occurrence of ocular melanoma thirteen years after skin melanoma: two separate primaries or metastatic disease? A case solved with NRAS and CDKN2A (INK4A-ARF) mutational analysis
verfasst von
Heidi V. N. Küsters-Vandevelde
Jan E. E. Keunen
Pieter Wesseling
Marian A. J. Verdijk
Marjolijn J. L. Ligtenberg
Willeke A. M. Blokx
Publikationsdatum
01.03.2008
Verlag
Springer-Verlag
Erschienen in
Virchows Archiv / Ausgabe 3/2008
Print ISSN: 0945-6317
Elektronische ISSN: 1432-2307
DOI
https://doi.org/10.1007/s00428-007-0555-8

Weitere Artikel der Ausgabe 3/2008

Virchows Archiv 3/2008 Zur Ausgabe

Neu im Fachgebiet Pathologie