Journal of the American Academy of Dermatology
Multiple idiopathic mucosal neuromas: A minor form of multiple endocrine neoplasia type 2B or a new entity?☆,☆☆
Section snippets
CASE REPORT
A 35-year-old woman had multiple painless papules on the lower lip and tongue that had appeared at age 7. Past medical and familial history were unremarkable.
At age 12 examination revealed an apparently healthy girl whose height and weight were within the normal range. Multiple nontender pedunculated papules and nodules, 2 to 25 mm in diameter, were seen on the lateral and dorsal aspects of the tongue (Fig. 1) .
RET protooncogene mutation analysis
RET protooncogene mutations were evaluated by polymerase chain reaction (PCR) and by either a single-strand conformational polymorphism (SSCP) analysis (exons 10, 11, and 16), restriction analysis (exon 16), and direct sequencing. Briefly, genomic DNA was obtained from peripheral blood and purified. 7 Amplification of exons 10, 11, and 16 was performed by means of specific primers 8 (10SE: CTCAGGGGGCAGCATTGTT and 10 AN: CACTCACCCTGGATGTCTT; 11SE: CCTCTGCGGTGCCAAGCCTC and 11AN:
RESULTS
PCR-SSCP analysis of exons 10, 11, and 16 did not show bands with altered migration relative to wild control samples. FokI enzyme restriction analysis demonstrated the presence of the restriction site in both alleles of exon 16 (Fig. 3) .
DISCUSSION
MEN 2B is a rare syndrome that can occur sporadically or can be inherited in an autosomal dominant pattern. It is characterized by the concurrence of mucosal neuromas, MTC, and pheochromocytoma. 3
Other commonly associated manifestations are thickened corneal nerves and ganglioneuromatosis of the alimentary tract. Physical features of patients with MEN 2B (the mucosal neuroma syndrome) include marfanoid appearance with arachnodactyly, poor muscular development, and little subcutaneous fat.
References (22)
- et al.
Multiple endocrine neoplasia 2B (MEN 2B)/MEN 3
Dermatol Clin
(1995) - et al.
Mucosal ganglioneuromatosis, medullary thyroid carcinoma, and pheochromocytoma: multiple endocrine neoplasia, type 2b
Oral Surg
(1976) - et al.
Familial medullary and multiple endocrine neoplasia type 2B map to the same region of chromosome 10 as multiple endocrine neoplasia type 2A
Genomics
(1991) - et al.
Relationship of familial prominent corneal nerves and lesions of the tongue resembling neuromas to multiple endocrine neoplasia type 2B
Am J Ophthalmol
(1995) - et al.
Multiple endocrine neoplasia type III: case report and review
Pediatr Dermatol
(1991) - et al.
Point mutation within the tyrosine kinase domain of the RET proto-oncogene in multiple endocrine neoplasia type 2B and related sporadic tumours
Hum Mol Genet
(1994) - et al.
Mucosal neuromas and plexiform neurofibromas: an immunocytochemical study
Pediatr Pathol
(1993) - et al.
Mucosal neuroma, pheochromocytoma and medullary thyroid carcinoma: multiple endocrine neoplasia type 3
Medicine
(1975) - et al.
A simple salting out procedure for extracting DNA from human nucleated cells
Nucleic Acids Res
(1988) - et al.
DNA polymorphisms and conditions for SSCP analysis of the 20 exons of the ret proto-oncogene
Oncogene
(1994)
Detection of point mutations in the androgen receptor gene using nonisotopic single strand conformation polymorphism analysis
Hum Mol Genet
Cited by (38)
Syndromic Medullary Thyroid Cancer: MEN 2A and MEN 2B
2021, Surgery of the Thyroid and Parathyroid GlandsOrofacial overgrowth with peripheral nerve enlargement and perineuriomatous pseudo-onion bulb proliferations is part of the PIK3CA-related overgrowth spectrum
2020, Human Genetics and Genomics AdvancesCitation Excerpt :In their report, these authors concentrated on peripheral nerve lesions observed microscopically in the ipsilateral buccal mucosa and vestibule and referred to them as orofacial intraneural perineuriomas, but they are likely to be POP.5 As well, the individual described by Pujol et al.19 as having multiple idiopathic mucosal neuromas may instead have PROS. Maclellan et al.3 and Couto et al.4 reported individuals with facial infiltrating lipomatosis that shared features with CLOVES, including abnormal nerves3 and mucosal neuromas,4 respectively.
Lesions of the Oral Cavity
2020, Gnepp's Diagnostic Surgical Pathology of the Head and Neck, Third EditionHurwitz Clinical Pediatric Dermatology, Fouth Edition
2011, Hurwitz Clinical Pediatric Dermatology, Fouth EditionTeratomas, Dermoids, and other Soft Tissue Tumors
2010, Ashcraft's Pediatric SurgeryNeural and neuroendocrine tumors
2009, Weedon's Skin Pathology: Third Edition
- ☆
Reprint requests: Ramon M. Pujol, MD, Department of Dermatology, Hospital de la Santa Creu i Sant Pau, Avda. Sant Antoni M. Claret 167, 08025, Barcelona, Spain.
- ☆☆
0190-9622/97/$5.00 + 0 16/4/80729