Ras/MEK pathway is required for NGF-induced expression of tyrosine hydroxylase gene☆
Section snippets
Materials and methods
Plasmids. Firefly luciferase reporter genes containing mouse TH promoter regions (mTHpro4.3-Luc, mTHpro0.8-Luc, and mTHpro0.8CREmt-Luc) were constructed as previously described [24]. A mutation in the AP-1-binding motif of mTHpro0.8-Luc (ATTCA) was generated by a PCR method using a forward primer (TAGCCCGGGCTCGAGACCATGATGCAGG) and a mutated reverse primer (TTAGATCTAATTGCATCCACTGTCGCAGGCACCTGCCTCTGAATCCCTCCGCCCTAG ACACG) and the wild-type vector, mTHpro4.3-Luc (TGATTCA). The mutation was
An inhibitor of MEK blocked induction of TH mRNA in response to NGF
First, we examined induction of TH mRNA by NGF in PC12D cells. Real-time PCR analysis demonstrated that induction of TH mRNA was detectable within 1 h after exposure to NGF. The level reached its maximum at 2–3 h and remained there for at least 24 h after the start of exposure (Fig. 1A). To explore the signaling cascades activated by NGF to regulate the TH gene expression, we examined the effect of inhibitors specific for protein kinases known to be activated in response to NGF. We found that the
Discussion
In the present study, we demonstrated that the Ras/MEK pathway was required for the NGF-mediated transcriptional activation to express the TH gene in PC12D, a subclone of the PC12 cell line. We also showed that the Ras/MEK pathway acted on AP1 and CRE in the TH promoter to transcribe the TH gene in response to NGF.
NGF has been demonstrated to up-regulate the TH gene expression in peripheral sympathetic and sensory neurons. In addition, TrkB ligands, i.e., BDNF and NT-4/5, recently have been
Acknowledgements
This work was supported by grants from the programs Grants-in-Aid for Encouragement of Young Scientists (to T.S.) and Grants-in-Aid for Scientific Research on Priority Areas (C)—Advanced Brain Science Project—(to H.I.) from the Ministry of Education, Culture, Sports, Science and Technology of Japan; Health Science Research Grants—Research on Human Genome, Tissue Engineering, Food Biotechnology—from the Ministry of Health, Labour and Welfare of Japan (to H.I.); and by the Human Frontier Science
References (36)
- et al.
Both the basal and inducible transcription of the tyrosine hydroxylase gene are dependent upon a cAMP response element
J. Biol. Chem.
(1993) - et al.
Specification of neurotransmitter identity by Phox2 proteins in neural crest stem cells
Neuron
(1999) - et al.
The homeodomain protein Arix interacts synergistically with cyclic AMP to regulate expression of neurotransmitter biosynthetic genes
J. Biol. Chem.
(1997) - et al.
The cyclic AMP response element directs tyrosine hydroxylase expression in catecholaminergic central and peripheral nervous system cell lines from transgenic mice
J. Biol. Chem.
(1995) - et al.
Tyrosine hydroxylase gene promoter activity is regulated by both cyclic AMP-responsive element and AP1 sites following calcium influx. Evidence for cyclic amp-responsive element binding protein-independent regulation
J. Biol. Chem.
(1997) - et al.
CREB mediates the cAMP-responsiveness of the tyrosine hydroxylase gene: use of an antisense RNA strategy to produce CREB-deficient PC12 cell lines
Mol. Brain Res.
(1999) - et al.
Neurotrophin signaling via Trks and p75
Exp. Cell Res.
(1999) - et al.
Development of sensory neurons in the absence of NGF/TrkA signaling in vivo
Neuron
(2000) Functions of the neurotrophins during nervous system development: what the knockouts are teaching us
Cell
(1994)- et al.
Mice lacking nerve growth factor display perinatal loss of sensory and sympathetic neurons yet develop basal forebrain cholinergic neurons
Cell
(1994)
Nerve growth factor uses Ras/ERK and phosphatidylinositol 3-kinase cascades to up-regulate the N-methyl-d-aspartate receptor 1 promoter
J. Biol. Chem.
The signal transduction pathway underlying ion channel gene regulation by SP1-C-Jun interactions
J. Biol. Chem.
AP-1, CREB and CBP transcription factors differentially regulate the tyrosine hydroxylase gene
Mol. Brain Res.
Identification of ATF-2 as a transcriptional regulator for the tyrosine hydroxylase gene
J. Biol. Chem.
The signal-dependent coactivator CBP is a nuclear target for pp90RSK
Cell
Nerve growth factor activates a Ras-dependent protein kinase that stimulates c-fos transcription via phosphorylation of CREB
Cell
Tissue-specific and high-level expression of the human tyrosine hydroxylase gene in transgenic mice
Neuron
Tyrosine hydroxylase: human isoforms, structure and regulation in physiology and pathology
Essays Biochem.
Cited by (0)
- ☆
Abbreviations: TH, tyrosine hydroxylase; NGF, nerve growth factor; MAPK, mitogen activated protein kinase; ERK, extracellular signal regulated kinase; MEK, MAP and ERK kinase; PI3K, phosphatidylinositol 3-kinase; CRE, cAMP-responsive element; CREB, CRE-binding protein; AP1, AP-1-binding site; PKA, protein kinase A; kb, kilobase(s); bp, base pair(s); FSK, forskolin.