Effects of anterior thalamic nuclei deep brain stimulation on neurogenesis in epileptic and healthy rats

doi:10.1016/j.brainres.2017.07.021

Brain Research

Volume 1672, 1 October 2017, Pages 65-72

https://doi.org/10.1016/j.brainres.2017.07.021 Get rights and content

Highlights

•
ANT-DBS could reduce neuronal loss in epileptic rats at the chronic stage.
•
ANT-DBS was capable of increasing neurogenesis in epileptic rats at the chronic stage.
•
ANT-DBS was able to enhance neurogenesis in healthy rats.

Abstract

Background

The efficacy of anterior thalamic nuclei (ANT) deep brain stimulation (DBS) in mitigating epileptic seizures has been established. Though the neuroprotection of ANT-DBS has been illustrated, the seizure mitigating mechanism of ANT-DBS has not been thoroughly elucidated. In particular, the effect of ANT-DBS on neurogenesis has not been reported previously.

Method

Thirty-two male Sprague Dawley rats were randomly assigned to the following groups: sham-DBS-healthy (HL) (n = 8), DBS-HL (n = 8), sham-DBS-epilepsy (EP) (n = 8) and DBS-EP (n = 8). Normal saline and kainic acid were injected, respectively, into the former and later two groups, and seizures were monitored. One month later, rats received electrode implantation. Stimulation was exerted in the DBS group but not in the sham-DBS group. Next, all rats were sacrificed, and the ipsilateral hippocampus was dissected and prepared for quantitative real time PCR (qPCR) and western blot analysis in order to measure neuronal nuclear (NeuN), brain-derived neurotrophic factor (BDNF), doublecortin (DCX) and Ki-67 expressions.

Results

A 44.4% seizure frequency reduction was obtained after ANT-DBS, and no seizures was observed in healthy rats. NeuN, BDNF, Ki-67 and DCX expression levels were significantly decreased in the epileptic rats compared to healthy rats (P < 0.01 or P < 0.05). Obvious increases in NeuN, Ki-67 and DCX expressions were observed in epileptic and healthy rats receiving stimulation compared to rats receiving no stimulation (all Ps < 0.01). However, BDNF expression was not affected by ANT-DBS (all Ps > 0.05).

Conclusions

(1) ANT-DBS reduces neuronal loss during the chronic stage of epilepsy. (2) Neurogenesis is elevated by ANT-DBS in both epileptic and healthy rats, and this elevation may not be regulated via a BDNF pathway.

Introduction

Deep brain stimulation (DBS), a novel neuromodulation technique, is capable of delivering an electronic stimulation pulse to specific brain regions (Shi et al., 2015). DBS has been considered to be one of the most effective treatments in controlling Parkinson’s disease, dystonia, epilepsy, Tourette syndrome and psychiatric disorders (Van Den Berge et al., 2015). Currently, numerous animal and clinical studies have verified that anterior thalamic nuclei (ANT) DBS reduces seizure frequency and remodels abnormal brain function (Salanova et al., 2015, Yang et al., 2015). Recently, a randomized, double-blind and multicenter trial showed that the seizure frequency reduction was 41% in the first year and 69% in the fifth year in epileptic patients who received ANT-DBS (Salanova et al., 2015). Furthermore, numerous studies have investigated the mechanisms of ANT-DBS in seizure protection. For instance, our previous research found that ANT-DBS is neuroprotective and normalizes cytokines expression levels (Chen et al., 2017, Yang et al., 2015).

Epilepsy, one of the most common neurological disorders, has a complex pathogenesis (Chen et al., 2017, Miyata et al., 2013). In addition to abnormal levels of neurotransmitters, ion channel dysfunction, oxidative stress response and immunoreaction, neuronal loss also plays a crucial role in the pathology of epilepsy (Chen et al., 2017, Klang et al., 2014, Naegele, 2007). Our previous study has confirmed the increased number of neurons in the epileptic brain after ANT-DBS, as well as the neuroprotective effect of ANT-DBS (Yang et al., 2015). However, to the best of our knowledge, there has been no study published on the neurogenic effects of ANT-DBS. Previous studies demonstrated that decreased neurogenesis occurs as the result of epileptogenesis (Zhong et al., 2016). An in vivo study demonstrated that neurogenesis is separate from neuronal death and is related to seizures (Smith et al., 2005). An increase in neurogenesis would impede the progress of epileptogenesis and relieve the seizure (Jing et al., 2009). Hence, we designed this trial to administer ANT-DBS to both an epileptic animal and a healthy one to illustrate rigorously the effect of ANT-DBS on neurogenesis.

In summary, considering that neurogenesis plays a crucial role in epilepsy and considering the difference between neuroprotection and neurogenesis, it would be valuable to investigate the effect of ANT-DBS on neurogenesis, and we designed this trial (Fig. 1A), which would advance the understanding of ANT-DBS.

Section snippets

Animal model and accuracy of the coordinates of ANT

To ensure that rats received exactly positioned kainic acid (KA) and normal saline intra-hippocampal injections, a magnetic resonance imaging (MRI) scan was conducted and is shown in Fig. 2A and B. All rats in the sham-DBS epilepsy (sham-DBS-EP) group and DBS epilepsy (DBS-EP) group developed consecutive stage 5 seizures at the acute stage and behavioral seizures were observed at the chronic stage. A typical epileptic electroencephalogram (EEG) is shown in Fig. 3A. Fig.2C shows an example of an

Discussion

Clinical studies have shown that ANT-DBS produces an ideal therapeutic outcome in controlling epilepsy (Salanova et al., 2015). In this study, a 44.4% seizure frequency reduction was obtained after ANT-DBS, and the stimulation parameters were based on the previous study (Hamani et al., 2010). Many studies have investigated the mechanism of ANT-DBS. There is a close relationship between neuronal loss and epilepsy(Jardim et al., 2012). Our previous study observed that ANT-DBS reduced apoptosis

Conclusions

Based on the results described above, we can present the following conclusions: (1) ANT-DBS could reduce neuronal loss in the epileptic animal at the chronic stage, and (2) neurogenesis is elevated by ANT-DBS, both in epileptic and healthy animals, and this effect may not be regulated via the BDNF pathway. The results from our trial could provide critical information concerning the mechanisms of ANT-DBS in treating epilepsy.

Animals and ethnic

Our study was approved by Beijing Neurosurgical Institute Ethics Committee (No. 201603002) according to the Guidelines for Use and Care of Experimental Animals. Thirty-two male adult male Sprague Dawley (SD) rats (240–260 g), provided by the Vital River Laboratories (Beijing, China), were randomly assigned to the sham-DBS-HL group (n = 8), DBS-HL group (n = 8), sham-DBS-EP group (n = 8) and DBS-EP group (n = 8). All animals had free access to food and water and were housed in cages (temperature: 23–25

Acknowledgements

This study was supported by National Nature Science Foundation of China (Nos. 81501185; 81501118, 81641052, 81527901) and the National Key Technology R&D Program of China (2016YFC0105902).

References (43)

Y.-C. Chen et al.
Deep brain stimulation of the anterior nucleus of the thalamus reverses the gene expression of cytokines and their receptors as well as neuronal degeneration in epileptic rats
Brain Res.
(2017)
Z.S. Costa-Ferro et al.
Transplantation of bone marrow mononuclear cells decreases seizure incidence, mitigates neuronal loss and modulates pro-inflammatory cytokine production in epileptic rats
Neurobiol, Dis.
(2012)
L. D’Alessio et al.
Doublecortin (DCX) immunoreactivity in hippocampus of chronic refractory temporal lobe epilepsy patients with hippocampal sclerosis
Seizure
(2010)
A. Fukushima et al.
Ketogenic diet does not impair spatial ability controlled by the hippocampus in male rats
Brain Res.
(2015)
C. Hamani et al.
Anterior thalamus deep brain stimulation at high current impairs memory in rats
Exp. Neurol.
(2010)
C. Heinrich et al.
Increase in BDNF-mediated TrkB signaling promotes epileptogenesis in a mouse model of mesial temporal lobe epilepsy
Neurobiol. Dis.
(2011)
M. Jing et al.
The combined therapy of intrahippocampal transplantation of adult neural stem cells and intraventricular erythropoietin-infusion ameliorates spontaneous recurrent seizures by suppression of abnormal mossy fiber sprouting
Brain Res.
(2009)
R. Kälviäinen et al.
Do recurrent seizures cause neuronal damage? A series of studies with MRI volumetry in adults with partial epilepsy
Prog. Brain Res.
(2002)
J.-S. Kim et al.
Differences in immunoreactivities of Ki-67 and doublecortin in the adult hippocampus in three strains of mice
Acta Histochem.
(2009)
G.M. Lopim et al.
Relationship between seizure frequency and number of neuronal and non-neuronal cells in the hippocampus throughout the life of rats with epilepsy
Brain Res.
(2016)

A. Pitkänen et al.

Mechanisms of epileptogenesis and potential treatment targets

Lancet Neurol.

(2011)

L. Shi et al.

Favorable modulation in neurotransmitters: Effects of chronic anterior thalamic nuclei stimulation observed in epileptic monkeys

Exp. Neurol.

(2015)

P.D. Smith et al.

Seizures, not hippocampal neuronal death, provoke neurogenesis in a mouse rapid electrical amygdala kindling model of seizures

Neuroscience

(2005)

F. Twele et al.

Significant effects of sex, strain, and anesthesia in the intrahippocampal kainate mouse model of mesial temporal lobe epilepsy

Epilepsy Behav.

(2016)

S. Xu et al.

Neuronal apoptosis in the resected sclerotic hippocampus in patients with mesial temporal lobe epilepsy

J. Clin. Neurosci.

(2007)

A.-C. Yang et al.

Potential Protective Effects of Chronic Anterior Thalamic Nucleus Stimulation on Hippocampal Neurons in Epileptic Monkeys

Brain Stimulation

(2015)

G. Baj et al.

Regulation of the spatial code for BDNF mRNA isoforms in the rat hippocampus following pilocarpine-treatment: A systematic analysis using laser microdissection and quantitative real-time PCR

Hippocampus

(2013)

V. Begni et al.

Cellular and molecular mechanisms of the brain-derived neurotrophic factor in physiological and pathological conditions

Clin. Sci.

(2017)

J. Bengzon et al.

Apoptosis and proliferation of dentate gyrus neurons after single and intermittent limbic seizures

Proc. Natl. Acad. Sci.

(1997)

B.J. Bhattacharyya et al.

The chemokine stromal cell-derived factor-1 regulates GABAergic inputs to neural progenitors in the postnatal dentate gyrus

J. Neurosci.

(2008)

Cardiff, R.D., Miller, C.H., Munn, R.J., 2014. Manual hematoxylin and eosin staining of mouse tissue sections. Cold...

Cited by (16)

Deep brain stimulation of the anterior nuclei of the thalamus in focal epilepsy
2022, Clinical Neurophysiology
Citation Excerpt :
The synthesis of neurofilaments was detected in hippocampal tissue following chronic ANT stimulation; ANT-DBS might support neuronal fiber regeneration (Salanova, 2018, Yang et al., 2015). Similar findings reported Chen et al., whose results shown that ANT-DBS reduces neuronal loss in epileptic rats at the chronic epilepsy stage and neurogenesis is increased by ANT-DBS in both healthy and epileptic rats (Chen et al., 2017). Encinas et al. reported hippocampal neurogenesis in the adult mouse dentate gyrus after high frequency ANT stimulation (Encinas et al., 2011).
To review the therapeutic effects of deep brain stimulation of the anterior nuclei of the thalamus (ANT-DBS) and the predictors of its effectiveness, safety, and adverse effects.
A comprehensive search of the medical literature (PubMed) was conducted to identify relevant articles investigating ANT-DBS therapy for epilepsy. Out of 332 references, 77 focused on focal epilepsies were reviewed.
The DBS effect is probably due to decreased synchronization of epileptic activity in the cortex. The potential mechanisms from cellular to brain network levels are presented. The ANT might participate actively in the network elaborating focal seizures. The effects of ANT-DBS differed in various studies; ANT-DBS was linked with a 41% seizure frequency reduction at 1 year, 69% at 5 years, and 75% at 7 years. The most frequently reported adverse effects, depression and memory impairment, were considered non-serious in the long-term follow-up view. ANT-DBS also has been used in a few cases to treat status epilepticus.
We reviewed the clinical literature and identified several factors that may predict seizure outcome following DBS therapy. More large-scale trials are required since there is a need to explore stimulation settings, apply patient-tailored therapy, and identify the presurgical predictors of patient response.
A critical review of the published literature on ANT-DBS in focal epilepsy is presented. ANT-DBS mechanisms are not fully understood; possible explanations are provided. Biomarkers of ANT-DBS effectiveness may lead to patient-tailored therapy.
Antidepressant-like effects of transcorneal electrical stimulation in rat models
2022, Brain Stimulation
Citation Excerpt :
Fold change was determined relative to the TES sham group after normalizing to Hprt using the 2-(ΔΔCt) method. The primers (Integrated DNA Technologies, Iowa, USA) used in this study were as follows: Ki67 (forward 5′-ACTTGCCTCCTAATACTCCACTCA-3′, reverse 5′-ATCTTCGTCTTTCATCATTTGTCC-3’ [53]), Nestin (forward 5′-TAAGTTCCAGCTGGCTGTGG-3′, reverse 5′-ATAGGTGGGATGGGAGTGCT-3’ [35]), Dcx (forward 5′-CTCCTATCTCTACACCCACAAGCC-3′, reverse 5′-GAATCGCCAAGTGAATCAGAGTC-3’ [54]), Neun (forward 5′-GGCTGGAAGCTAAACCCTGT-3′, reverse 5′-TCCGATGCTGTAGGTTGCTG-3’ [35]), and Hprt (forward 5′-CTCATGGACTGATTATGGACAGGAC-3′, reverse 5′GCAGGTCAGCAAAGAACTTATAGCC -3’ [55]). The procedures were performed as previously described [56,57].
Given that visual impairment is bi-directionally associated with depression, we examined whether transcorneal electrical stimulation (TES), a non-invasive treatment for visual disorders, can ameliorate depressive symptoms.
The putative antidepressant-like effects of TES and the underlying mechanisms were investigated in an S334ter-line-3 rat model of retinal degeneration and a rat model of chronic unpredictable stress (CUS).
TES was administered daily for 1 week in S334ter-line-3 and CUS rats. The effects of TES on behavioral parameters, plasma corticosterone levels, and different aspects of neuroplasticity, including neurogenesis, synaptic plasticity, and apoptosis, were examined.
In S334ter-line-3 rats, TES induced anxiolytic and antidepressant-like behaviors in the cylinder, open field, home cage emergence, and forced swim tests. In the CUS rat model, TES induced hedonic-like behavior and decreased behavioral despair, which were accompanied by reduced plasma corticosterone levels and upregulated expression of neurogenesis-related genes. Treatment with the neurogenesis blocker temozolomide only inhibited the hedonic-like effect of TES, suggesting the antidepressant-like effects of TES were mediated through both neurogenesis-dependent and -independent mechanisms. Furthermore, TES was found to normalize the protein expression of synaptic markers and apoptotic Bcl-2-associated X protein in the hippocampus and amygdala in the CUS rat model. The improvements in neuroplasticity may involve protein kinase B (AKT) and protein kinase A (PKA) signaling pathways in the hippocampus and amygdala, respectively, as demonstrated by the altered pAKT/AKT and pPKA/PKA ratios.
The overall findings suggest a possible neuroplasticity mechanism of the antidepressant-like effects of TES.
Electrical stimulation in animal models of epilepsy: A review on cellular and electrophysiological aspects
2021, Life Sciences
Citation Excerpt :
It is plausible that DBS may protect against the loss of hippocampal gabaergic neurons in epileptic animals given that the excitatory signals are more prevalent during crises. In this sense, stimulation in the anterior thalamic nucleus reduces neuronal loss in epileptic rats, as well as induces neurogenesis [86]. In a model of PILO-induced SE in rats, DBS applied to the stimulation parameters of 130 Hz, 90 μs, and 400 μA decreased IL-6 levels and countered higher caspase-3 activity in the hippocampus [87].
Epilepsy is a debilitating condition, primarily refractory individuals, leading to the search for new efficient therapies. Electrical stimulation is an important method used for years to treat several neurological disorders. Currently, electrical stimulation is used to reduce epileptic crisis in patients and shows promising results. Even though the use of electricity to treat neurological disorders has grown worldwide, there are still many caveats that must be clarified, such as action mechanisms and more efficient stimulation treatment parameters. Thus, this review aimed to explore the comprehension of the main stimulation methods in animal models of epilepsy using rodents to develop new experimental protocols and therapeutic approaches.
Anterior nucleus of thalamus stimulation inhibited abnormal mossy fiber sprouting in kainic acid-induced epileptic rats
2018, Brain Research
Citation Excerpt :
Indeed, the KA and KA + Sham-DBS groups expressed lower Sema-3A levels than the control group, which may result from cell death in layer III of the entorhinal region, where Sema-3A expression is greatest (Giger et al., 1998; Holtmaat, 2003). Alternatively, expression was normalized by ANT-DBS, possibly due to a neuroprotective effect (Chen et al., 2017a; Yang et al., 2015). Thus, the combination of GAP-43 suppression and Sema-3A maintenance induced by ANT-DBS may act to impede MFS.
Deep brain stimulation (DBS) of the anterior nucleus of the thalamus (ANT) has demonstrated antiepileptic efficacy, especially for mesial temporal lobe epilepsy (MTLE). Mossy fiber sprouting (MFS) is involved in the pathogenesis of MTLE, and Sema-3A and GAP-43 are pivotal regulators of MFS. This study investigated the effects of ANT-DBS on MFS and expression levels of Sema-3A and GAP-43 as a possible mechanism for seizure suppression.
Adult male Sprague-Dawley rats were randomly divided into four groups: (1) control (saline injection), (2) KA (kainic acid injection), (3) KA + Sham-DBS (electrode implantation without stimulation), and (4) KA + DBS (electrode implantation with stimulation). Video electroencephalography (EEG) was used to ensure model establishment and monitor seizure frequency, latency, and severity (Racine stage). Chronic ANT stimulation was conducted for 35 days in the KA + DBS group, and MFS compared to the other groups by quantitative Timm staining. Sema-3A and GAP-43 expression levels in the hippocampal formation were evaluated in all groups with western blot.
The latency period was significantly prolonged and spontaneous seizure frequency reduced in the KA + DBS group compared to KA and KA + Sham-DBS groups. Staining scores for MFS in CA3 and dentate gyrus (DG) were significantly lower in the KA + DBS group. The KA + DBS group also exhibited decreased GAP-43 expression and increased Sema-3A expression compared to KA and KA + Sham-DBS groups.
These results suggest that ANT-DBS extends the latent period following epileptogenic stimulation by impeding MFS through modulation of GAP-43 and Sema-3A expression.
Systematic review of rodent studies of deep brain stimulation for the treatment of neurological, developmental and neuropsychiatric disorders
2024, Translational Psychiatry
Influence of Simulated Deep Brain Stimulation on the Expression of Inflammatory Mediators by Human Central Nervous System Cells In Vitro
2022, NeuroMolecular Medicine

View all citing articles on Scopus

¹: Ying-Chuan Chen and Lin Shi contributed equally to this work.

View full text

Research reportEffects of anterior thalamic nuclei deep brain stimulation on neurogenesis in epileptic and healthy rats

Highlights

Abstract

Background

Method

Results

Conclusions

Introduction

Section snippets

Animal model and accuracy of the coordinates of ANT

Discussion

Conclusions

Animals and ethnic

Acknowledgements

Brain Res.

Neurobiol, Dis.

Seizure

Brain Res.

Exp. Neurol.

Neurobiol. Dis.

Brain Res.

Prog. Brain Res.

Acta Histochem.

Brain Res.

Lancet Neurol.

Exp. Neurol.

Neuroscience

Epilepsy Behav.

J. Clin. Neurosci.

Brain Stimulation

Regulation of the spatial code for BDNF mRNA isoforms in the rat hippocampus following pilocarpine-treatment: A systematic analysis using laser microdissection and quantitative real-time PCR

Hippocampus

Cellular and molecular mechanisms of the brain-derived neurotrophic factor in physiological and pathological conditions

Clin. Sci.

Apoptosis and proliferation of dentate gyrus neurons after single and intermittent limbic seizures

Proc. Natl. Acad. Sci.

The chemokine stromal cell-derived factor-1 regulates GABAergic inputs to neural progenitors in the postnatal dentate gyrus

J. Neurosci.

Research report
Effects of anterior thalamic nuclei deep brain stimulation on neurogenesis in epileptic and healthy rats