The zebrafish retinoid-related orphan receptor (ror) gene family
Section snippets
Results and discussion
Retinoid-related orphan receptors (ROR) (Nuclear Receptor Committee, 1999) belong to the nuclear hormone receptor family that performs diverse roles in embryonic development and physiological processes (Dzhagalov et al., 2004b, Jetten, 2004, Jetten et al., 2001, Jetten and Ueda, 2002). The mammalian ROR family consisting of RORA, B and C (Human Gene Nomenclature Committee) more commonly referred to as ROR α, β and γ, respectively, are evolutionarily related transcription factors with homologs
Zebrafish stocks and embryo collection
Wild-type zebrafish (D. rerio) embryos were obtained from natural spawnings, raised in embryo medium (E3) at 28.5 °C (Westerfield, 2000), and developmentally staged as described (Kimmel et al., 1995).
Cloning of the zebrafish ror genes
The EST zgc:55954 (Accession No.: BC051158; cDNA clone MGC:55954; IMAGE:3819342) has been predicted to represent zebrafish rora. Zebrafish rorb and rorc sequences were cloned by RT-PCR from adult cDNA preparations using the following primers (5′–3′):
rorb (1438 bp): GAGCGAGTCGCCAACACTATGCGAG and
Acknowledgements
We thank Lisa Pullin and Christopher Taylor for their technical assistance, and Alhad Mahagaonkar for managing the zebrafish facility. This work was supported by a grant from the Foundation for Research Science and Technology of New Zealand.
References (46)
- et al.
Pineal gland hormone melatonin binds and activates an orphan of the nuclear receptor superfamily
J. Biol. Chem.
(1994) - et al.
Orphan nuclear receptor ROR alpha-deficient mice display the cerebellar defects of staggerer
Mech. Dev.
(1998) - et al.
Genetic evidence supporting selection of the Valpha14i NKT cell lineage from double-positive thymocyte precursors
Immunity
(2005) - et al.
RORgamma t, a novel isoform of an orphan receptor, negatively regulates Fas ligand expression and IL-2 production in T cells
Immunity
(1998) - et al.
ROR gamma: the third member of ROR/RZR orphan receptor subfamily that is highly expressed in skeletal muscle
Biochem. Biophys. Res. Commun.
(1994) - et al.
The ROR nuclear orphan receptor subfamily: critical regulators of multiple biological processes
Prog. Nucleic Acid. Res. Mol. Biol.
(2001) - et al.
Whole-mount in situ hybridizations on zebrafish embryos using a mixture of digoxigenin- and fluorescein-labelled probes
Trends Genet.
(1994) - et al.
Crystal structure of the human RORalpha Ligand binding domain in complex with cholesterol sulfate at 2.2 Å
J. Biol. Chem.
(2004) - et al.
X-ray structure of the hRORalpha LBD at 1.63 Å: structural and functional data that cholesterol or a cholesterol derivative is the natural ligand of RORalpha
Structure
(2002) - et al.
Cloning of a cDNA encoding the murine orphan receptor RZR/ROR gamma and characterization of its response element
Gene
(1996)
Automated analysis of conserved syntenies for the zebrafish genome
Methods Cell Biol.
Interplay between RORgammat, Egr3, and E proteins controls proliferation in response to pre-TCR signals
Immunity
Disruption of retinoid-related orphan receptor beta changes circadian behavior, causes retinal degeneration and leads to vacillans phenotype in mice
EMBO J.
RORalpha, a pivotal nuclear receptor for Purkinje neuron survival and differentiation: from development to ageing
Cerebellum
Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors
EMBO J.
The orphan nuclear receptor ROR alpha is a negative regulator of the inflammatory response
EMBO. Rep.
Lymphocyte development and function in the absence of retinoic acid-related orphan receptor alpha
J. Immunol.
The roles of orphan nuclear receptors in the development and function of the immune system
Cell. Mol. Immunol.
Inducible lymphoid tissues in the adult gut: recapitulation of a fetal developmental pathway?
Nat. Rev. Immunol.
Thymic origin of intestinal alphabeta T cells revealed by fate mapping of RORgammat+ cells
Science
An essential function for the nuclear receptor RORgamma(t) in the generation of fetal lymphoid tissue inducer cells
Nat. Immunol.
Ligand binding was acquired during evolution of nuclear receptors
Proc. Natl. Acad. Sci. USA
The steroid and thyroid hormone receptor superfamily
Science
Cited by (40)
Characterization of ccl20a.3 and ccl20l as gene markers for Th17 cell in turbot
2023, Fish and Shellfish ImmunologyCytokine networks provide sufficient evidence for the differentiation of CD4<sup>+</sup> T cells in teleost fish
2023, Developmental and Comparative ImmunologyTeleost CD4<sup>+</sup> helper T cells: Molecular characteristics and functions and comparison with mammalian counterparts
2021, Veterinary Immunology and ImmunopathologyCirc_0081572 inhibits the progression of periodontitis through regulating the miR-378h/RORA axis
2021, Archives of Oral BiologyThe interbranchial lymphoid tissue likely contributes to immune tolerance and defense in the gills of Atlantic salmon
2017, Developmental and Comparative ImmunologyTh17 master transcription factors RORα and RORγ regulate the expression of IL-17C, IL-17D and IL-17F in Cynoglossus semilaevis
2016, Developmental and Comparative ImmunologyCitation Excerpt :Th1 cells may secrete effector cytokines IL-12 and IFN-γ; Th2 cells secrete IL-4, IL-5 and IL-13; Th17 cells secrete IL-17A and IL-17F; Treg cells secrete IL-10 and TGF-β (Bevan, 2004; Harrington et al., 2005; Steinman, 2007; Stockinger et al., 2007; Zhu and Paul, 2008; Swain et al., 2012). In teleosts, RORα, RORγ, T-bet, GATA-3, and the cytokines related to Th-cells have been identified in some species (Flores et al., 2007; Castro et al., 2011; Du et al., 2012; Monte et al., 2012; Zhu et al., 2012). However, unlike mammals, little is known about CD4+ T-cell diversity and the nature of the initial signals that determine the T-cell response pattern in teleosts.