Background
MicroRNAs (miRNAs) are a class of small, non-coding RNAs (19–22 nucleotides) that function as posttranscriptional gene regulators by binding to the 3’UTR of mRNA, and one miRNA may potentially down-regulate multiple mRNA targets. More than 1500 human miRNAs are currently annotated in the miRBase [
1], and it has been predicted that as many as 30% of protein-encoding genes may be regulated by miRNAs [
2]. The discovery that miRNAs may function as oncogenes or tumor suppressors depending on the target mRNA, has instigated intensive research to determine the role of these molecules in cancer. MiRNAs are chemically very stable, and can be detected by a range of high-throughput detection methods in tissue, serum and plasma as well as in urine and feces, and are for these reasons considered to have great potential as cancer biomarkers.
In colorectal cancer (CRC), treatment decisions are still based essentially on anatomical extent of disease at diagnosis, and the search for better biomarkers is warranted. Several miRNAs with potential biological and clinical relevance have been identified and are being explored as diagnostic, prognostic and predictive biomarkers [
3‐
6]. Based on previous studies and our recent review of this topic, six candidate miRNAs, miR-21, miR-31, miR-92a, miR-101, miR-106a and miR-145 (Table
1), were chosen for analysis in a cohort of 193 prospectively recruited patients receiving curative surgery for CRC [
7‐
13]. Expression of the miRNA was determined by qRT-PCR and associations with clinicopathological parameters and outcome were analyzed.
Table 1
Mature sequence, miRBase accession number and proposed clinical relevance for the six chosen miRNAs
hsa-miR-21 | UAGCUUAUCAGACUGAUGUUGA | MIMAT0000076 | Overall survival | High expression associated with poor OS | |
hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCU | MIMAT0000089 | Tumor stage/ differentiation | High expression associated with advanced tumor stage and poorly differentiated tumors | |
hsa-miR-92a | UAUUGCACUUGUCCCGGCCUGU | MIMAT0000092 | Plasma marker | Elevated levels as a possible diagnostic marker | |
hsa-miR-101 | UACAGUACUGUGAUAACUGAA | MIMAT0000099 | Increased invasiveness | Decreased expression associated with invasiveness | |
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAG | MIMAT0000103 | Disease free and overall survival | Down-regulation associated with poor disease free and overall survival. | |
hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCU | MIMAT0000437 | Tumor size | Low expression associated with large tumor size | |
Methods
Patient cohort
316 patients, recruited from five hospitals in the Oslo region between the year 1998 and 2000 [
15], were prospectively included in the study at the time of primary surgery for assumed or verified colorectal cancer. The study was approved by the Regional Ethics Committee (Health Region II, Norway) and informed consent was obtained from the patients. At surgery, resected specimens were routinely processed for histopathological assessment and additional tumor tissue was sampled and snap-frozen in liquid nitrogen. A number of cases were excluded from statistical analysis for the following reasons: not invasive cancer (25), histology other than adenocarcinoma (5), distant metastasis at the time of surgery (34, tissue samples not available), preoperative chemoradiotherapy (2), inadequate surgical margins (7), unknown stage of disease (1), freshly frozen tissue samples not obtainable (46), and high Ct-values (>37; n=3). The study population thus consisted of 193 patients in TNM stage I-III (Table
2). Follow-up data was obtained from the participating hospitals and from the general practitioners (for the patients not attending scheduled controls). Metastasis was verified by radiological examination and survival data was obtained from the National Registry of Norway and updated by October 1
st 2008 with the cause of death registered and classified as death from colorectal cancer, death of other cause or death of unknown cause.
Table 2
Median expression levels of the six selected miRNAs and associations with clinicopathological data
Gender
| | | | | | | |
Female | 81 (42) | 7.78 | 0.07 | 1.64 | 0.02 | 1.16 | 0.43 |
Male | 112 (58) | 7.53 | 0.03 | 2.12 | 0.02 | 0.93 | 0.48 |
p-value
| |
0.45
|
0.14
|
0.52
|
0.78
|
0.43
|
0.99
|
TNM
| | | | | | | |
I | 35 (18) | 5.22 | 0.02 | 2.41 | 0.02 | 1.24 | 0.34 |
II | 97 (50) | 7.67 | 0.06 | 2.09 | 0.02 | 1.10 | 0.48 |
III | 61 (32) | 7.78 | 0.07 | 1.59 | 0.02 | 0.85 | 0.51 |
p-value
| |
0.23
|
0.02
|
0.80
|
0.86
|
0.54
|
0.30
|
pT
| | | | | | | |
1 | 4 (2) | 7.90 | 0.02 | 2.51 | 0.02 | 1.16 | 0.36 |
2 | 36 (19) | 5.15 | 0.02 | 2.45 | 0.02 | 1.26 | 0.36 |
3 | 133 (69) | 7.67 | 0.05 | 1.74 | 0.02 | 0.88 | 0.46 |
4 | 20 (10) | 8.50 | 0.14 | 2.58 | 0.02 | 1.33 | 0.58 |
p-value
| |
0.37
|
0.004
|
0.61
|
0.76
|
0.52
|
0.70
|
pN
| | | | | | | |
0 | 132 (68) | 7.53 | 0.04 | 2.12 | 0.02 | 1.15 | 0.44 |
1 | 39 (20) | 7.67 | 0.05 | 1.73 | 0.02 | 0.89 | 0.46 |
2 | 22 (11) | 8.47 | 0.09 | 1.39 | 0.02 | 0.82 | 0.59 |
p-value
| |
0.82
|
0.31
|
0.60
|
0.95
|
0.54
|
0.63
|
Differentiation
| | | | | | | |
Well | 6 (3) | 3.58 | 0.02 | 1.09 | 0.01 | 0.38 | 0.24 |
Intermediate | 167 (87) | 7.67 | 0.04 | 2.14 | 0.02 | 1.16 | 0.45 |
Poor | 20 (10) | 6.83 | 0.20 | 0.95 | 0.02 | 0.70 | 0.69 |
p-value
| |
0.28
|
0.001
|
0.003
|
0.33
|
0.01
|
0.12
|
Tumor localization
| | | | | | | |
Colon | 129 (67) | 7.52 | 0.07 | 1.62 | 0.02 | 0.87 | 0.43 |
Rectum | 64 (33) | 7.77 | 0.02 | 2.58 | 0.02 | 1.27 | 0.67 |
p-value
| |
0.50
|
0.02
|
0.05
|
0.32
|
0.05
|
0.08
|
Lymphocyte infiltration
| | | | | | |
High | 26 (14) | 7.93 | 0.09 | 1.96 | 0.02 | 0.88 | 0.63 |
Intermediate | 125 (65) | 7.78 | 0.03 | 2.14 | 0.02 | 1.01 | 0.51 |
Low | 40 (21) | 6.91 | 0.08 | 1.46 | 0.02 | 1.04 | 0.33 |
p-value
| |
0.47
|
0.19
|
0.49
|
0.82
|
0.37
|
0.14
|
Vascular invasion
| | | | | | | |
Present | 38 (20) | 7.73 | 0.07 | 1.54 | 0.02 | 1.17 | 0.59 |
Absent | 155 (80) | 7.36 | 0.04 | 2.01 | 0.02 | 0.98 | 0.43 |
p-value
| |
0.30
|
0.23
|
0.43
|
0.27
|
0.94
|
0.05
|
Perineural invasion
| | | | | | | |
Present | 16 (8) | 8.60 | 0.16 | 1.68 | 0.02 | 1.05 | 0.35 |
Absent | 177 (92) | 7.54 | 0.04 | 1.95 | 0.02 | 0.98 | 0.48 |
p-value
| |
0.42
|
0.43
|
0.60
|
0.29
|
0.83
|
0.49
|
Perinodal growth*
| | | | | | | |
Present | 38 (62) | 8.09 | 0.11 | 1.46 | 0.02 | 0.81 | 0.52 |
Absent | 23 (38) | 7.36 | 0.03 | 2.01 | 0.02 | 1.10 | 0.36 |
p-value
| |
0.77
|
0.36
|
0.30
|
1.00
|
0.18
|
0.49
|
MiRNA selection
MiRNA selection was based on previous studies and our literature review [
11], identifying miRNA with proposed clinical relevance in CRC, including published articles leading up to the year 2009. We wished to examine selected miRNAs in our CRC cohort and their relevance with clinicopathological data and outcome parameters (Table
2). The following six miRNAs were chosen for analysis; miR-21, miR-31, miR-92a, miR-101, miR-106a and miR-145 [
7‐
13].
Sample preparation and RNA isolation
Biopsies were sampled and snap frozen in liquid nitrogen and stored at −80°C. The biopsies were sectioned using a cryostat microtome and hematoxylin-eosin stained slides were evaluated for tumor content by a pathologist (median tumor content in the samples was 50%, range 30 - 80%). The tumor tissue was sliced into 10 μm sections using a cryostat microtome, aliquoted into 1.5 ml Micro tubes (Sarstedt, Nümbrecht, Germany) and stored at −80°C. RNA was isolated from the tumor tissue using TriReagent (Ambion Inc, TX) according to the manufacturer’s protocol and the total RNA concentration was measured by Nanodrop (ND-1000).
qRT-PCR
Total RNA from 196 patients was used to reversely transcribe miRNAs using TaqMan MicroRNA assays (Applied Biosystems, Foster City, CA). Each reverse transcriptase reaction contained 10 ng of total RNA (5μl), 0.15 μl dNTP (100 mM total), 1.0 μl Multiscribe RT enzyme (50 U/μl), 1.5 μl 10X RT buffer, 0.19 μl RNase Inhibitor (20 U/μl) , 4.16 μl nuclease free water (Sigma-Aldrich, Ayshire, UK) and 3.0 μl 5X RT Primer. The 15 μl reaction volumes were incubated in 8-well PCR strip tubes (Sarstedt) in a GeneAmp PCR System 9700 thermal cycler (Applied Biosystems) as follows; 30 min at 16°C, 30 min at 42°C, 5 min at 85°C. Real-time PCR was performed using Applied Biosystems 7500 real-time PCR system. The reversely transcribed miRNAs were diluted 1:20 before adding 1.3 μl to 10 μl 2X Universal PCR Master Mix (no AmpErase UNG), 7.7 μl water and 1.0 μl 20X MicroRNA Assay. A total volume of 20 μl per reactions was incubated in 96-well MicroAmp plates (Applied Biosystems) for 10 min 95°C followed by 40 cycles of 15 sec. 95°C and 60 sec. 60°C. All samples were run in duplicates.
RNU6B and RNU44 were tested as potential reference genes and performed equally well, and RNU44 was selected for further analysis [
16]. Each miRNA was normalized against RNU44 and the relative expression was calculated using 2
-dCt method [
17].
Statistical analysis
All statistical analyses were performed using SPSS version 18.0 (SPSS Inc., Chicago, MO) and P-values < 0.05 were considered to be statistically significant. Associations between miRNA expression and clinicopathological variables were explored using Mann–Whitney U and Kruskal-Wallis test as appropriate. Survival was estimated using the Kaplan-Meier method and compared using the log-rank test. Overall and metastasis-free survival was calculated from date of surgery until date of death or diagnosis of metastasis.
Discussion
Although miR-31 was expressed at relatively low levels compared with some of the other candidates, high expression was associated with advanced tumor stage at diagnosis, and particularly with pT-stage, in accordance with previous results [
9,
10]. There are multiple predicted targets for miR-31, but few have been fully validated at present. One proposed target of miR-31 that has been experimentally investigated is Special AT-rich Binding protein 2 (SATB2), which is involved in transcriptional regulation and chromatin remodeling [
18]. In an immunohistochemical study performed in 146 colorectal tumors, low expression of SATB2 was associated with metastasis development and poor prognosis [
19]. Another target that has been shown to be regulated by miR-31 is the T lymphoma Invasion And Metastasis gene 1 (TIAM1), which is a guanidine exchange factor for Rac GTPase and when over-expressed, it prevents TGF-β and TNF-α dependent motility and invasion in CRC cell lines [
20]. The postulated effects of miR-31 on SATB2 and TIAM1 are consistent with the associations between miR-31 expression and advanced tumor stage, observed by us and others, but clearly, the regulatory activity of miR-31 is still incompletely understood in CRC.
MiR-92a was included in the analyses because it has been proposed as an early-detection biomarker in plasma and stool [
13,
21]. In general, one would expect an early-detection biomarker to be ubiquitously expressed in the tissue of interest, and although several tumors in our study had relatively high levels of miR-92a, low levels were found in a substantial proportion of the samples. Also, over-expression of miR-92a has been found in other cancer types, such as hepatocellular carcinoma and leukemia [
22,
23], which suggest that further evaluation is necessary to determine its specificity and sensitivity as an early-detection biomarker. Although miR-92a was not primarily included in this study for its prognostic relevance, it was recently proposed as a key oncogenic component of the miR-17-92 cluster through targeting and down-regulating the proapoptotic protein Bim in CRC, suggesting that the functional role of miR-92a in CRC should be further elucidated [
24].
MiR-21 is one of the more extensively studied miRNAs in CRC and was included in our study because of its proposed association with advanced tumor stage and outcome in CRC [
12,
14]. In the present work, miR-21 exhibited the highest relative expression and the widest expression range of the examined candidates, but no significant associations with clinicopathological data or outcome were found. Although some investigators have identified this miRNA as clinically relevant, other exploratory studies of miRNA expression in CRC have not been able to verify these findings [
25‐
27]. It has been speculated that discrepancies might be explained by the composition of patient cohorts, particularly regarding tumor localization, as the association between miR-21 and survival has primarily been documented in colon cancer [
28]. However, in our cohort no differences were found when comparing the clinical relevance of miR-21 expression in colon and rectum cancer. In most of the previous studies, miR-21 expression was reported relative to paired normal tissues, whereas only tumor tissue was available from our patients, which might influence interpretation of results [
17]. However, among the reports that did not identify miR-21 as relevant for outcome in CRC, both analysis of tumor tissue alone and paired tumor and normal samples were used, suggesting that this may not be the only explanation for the discrepancies.
When the primary objective is to identify cancer specific molecules, the inclusion of normal tissues is necessary, whereas, in the current project the aim was to evaluate previously identified potential biomarkers, which is a different setting. Importantly, normal tissue is often not obtainable for analysis, and expression of molecular targets in normal tissues might vary considerably between patients, and not necessarily in concert with the corresponding tumor sample. Thus, it is probably both practicable and necessary to develop assays that are independent of normal tissue. Another related challenge concerns the definition of biologically relevant cut-off levels, which have not been determined for specific miRNA in different tissues. We explored multiple cut-off levels, but associations with clinicopathological parameters and outcome for all the candidates remained relatively similar.
MiR-101, miR-145 and miR-106a have previously been associated with cancer-relevant biological processes, such as growth, proliferation and inhibition of apoptosis, or with clinical outcome in CRC [
7‐
9], but few associations with clinicopathological parameters or outcome were found in our cohort. MiR-101 was hardly detectable in tumor samples, which is in accordance with its proposed function as a tumor suppressor that is lost during tumorigenesis. Interesting recent findings in pancreatic cancer suggest miR-101 as a key regulator of stem cell protein markers; its loss favoring the stem cell phenotype and its re-expression constituting a possible therapeutic strategy [
29]. Down-regulation of miR-145 was also identified as an early event in CRC carcinogenesis, which might explain why associations with clinical variables in invasive tumors were absent in our tumor panel. The biological relevance of miR-145 in CRC has, however, been repeatedly confirmed, and this miRNA is also being explored as a therapeutic target [
30,
31]. MiR-106a was in a recent review identified as consistently up-regulated in CRC (relative to normal colon) which would be in agreement with our findings [
32]. It has also been identified in stool samples in CRC patients, and has been suggested as an early detection biomarker [
33], but even if extensively studied in several cancer forms, its function and clinical relevance remain unclear.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
KS carried out the qRT-PCR and normalization, performed parts of the statistical analysis and drafted the manuscript. KB performed the main statistical analysis. TWA carried out the tissue preparation and RNA isolation. ØF contributed with critical revisions of the manuscript. KF participated in the study design and coordination and helped draft the manuscript. All authors have read and approved the final manuscript.