Background
Vav3 oncogene, a quanine nucleotide exchange factor (GEF) for Rho family GTPases, belongs to Vav family proteins. The three mammalian Vav proteins (Vav1, Vav2, and Vav3) differ in their tissue distribution. Vav1 is primarily expressed in hematopoietic cells, while Vav2 and Vav3 are more ubiquitously expressed [
1,
2]. Vav proteins contain multiple function motifs and are involved in various cellular signaling processes, including cytoskeleton organization, calcium influx, phagocytosis, and cell transformation [
3]. Vav proteins share a common structure, including a N-terminal calponin homology (CH) domain involved in Ca
+2 mobilization and transforming activity, an acidic domain (AD) containing three regulatory tyrosines, a Dbl homology (DH) domain with a conserved region that promotes the exchange of GDP for GTP on Rac/Rho GTPases, a pleckstrin homology (PH) domain binding to PIP
3 that enables its movement to the inner face of the plasma membrane, two Src-homology 3 (SH3) domains interacting with proteins containing proline-rich sequences, and a Src-homology 2 (SH2) domain interacting with proteins containing phosphorylated tyrosines [
4,
5]. Tyrosine phosphorylation by receptor protein tyrosine kinase or cytoplasmic protein tyrosine kinase is required for Vav protein activation. In the non-phosphorylation state, Vav is folded, which is achieved by binding of the tyrosines in the AD domain to the DH domain and binding of the CH domain to the C1 region. Upon phosphorylation of the tyrosines in the AD domain, the folding is opened and the DH domain is exposed. Thus, Vav protein is activated and interacts with substrate proteins, and the PH domain is exposed for PIP3 binding [
6].
Breast cancer is the most common malignant disease worldwide and the number one cause of cancer-related death among non-smoking women in the US. The major problem in breast cancer therapy is development of estrogen-insensitive growth after hormonal therapy. Aberrant ERα activation by various mechanisms contributes to breast cancer development and estrogen-resistant diseases [
7‐
9]. This ERα hypersensitivity can be achieved by estrogen-independent mechanisms, such as ERα phosphorylation by crosstalking with signal transduction pathways and overexpression of nuclear receptor coactivator SRC3 [
10,
11]. Numerous studies have shown that EGFR/HER2-elicited signaling is involved in human breast cancer [
9]. In addition, elevated PI3K-Akt signaling, mediated by PTEN deletion and/or mutation and PI3K subunit p110a (PI3KCA) mutation, upregulates ERα activity and is correlated with the breast cancer development and anti-estrogen resistance [
12‐
15]. Activation of PI3K has been implicated in part because the downstream PI3K target, Akt, phosphorylates and promotes ligand-independent ERα activation [
16,
17]. Transgenic breast cancer mouse models have confirmed that elevated signaling in the EGFR/HER2-PI3K-Akt pathway either by targeted Akt overexpression or HER2 overexpression in breast epithelial cells induces breast cancer development [
18‐
20]. These signaling pathways have been the targets for breast cancer therapy [
7‐
9].
The classical ERα is a ligand-dependent transcription factor that activates transcription of its target genes in nucleus, which is known as genomic ERα activity. Recent findings revealed that the classical steroid hormone receptors also associate with cell membrane and mediate cell signaling through kinase cascade, defined as nongenomic activity [
21,
22]. Nongenomic ERα resides in multiprotein complexes with molecules, such as MNAR/PELP1 and src, in the cytoplasm and signals through the PI3K-Akt and MAPK pathways in breast cancer cells [
23,
24]. Nongenomic ERα signaling has been shown to contribute to estrogen-independent growth in breast cancer.
Recently, we and others found that Vav3 oncogene is overexpressed in androgen-independent prostate cancer cells, enhances androgen receptor (AR) activity, and stimulates androgen-independent growth in prostate cancer cells [
25,
26]. We further showed that Vav3, as a signal transducer, upregulates AR activity partially via PI3K-Akt signaling [
25]. The DH domain of Vav3 is responsible for AR activation. Vav3 also potentiates EGF activity for cell growth and AR activation in prostate cancer cells. More importantly, Vav3 is overexpressed in 32% of human prostate cancer. These findings suggest that Vav3 overexpression may be involved in prostate cancer.
The purpose of this study is to determine the role of Vav3 in breast cancer. We found that Vav3 is overexpressed in human breast cancer specimens and cell lines. Vav3 stimulates growth of breast cancer cells and activates ERα partially via PI3K-Akt signaling. Vav3 potentiates EGF activity for cell growth and ERα activation in breast cancer cells. These data suggest that Vav3 impacts on ERα signaling axis and its overexpression may be involved in breast cancer.
Methods
Reagents
RPMI 1640 medium was purchased from Invitrogen (Gaithersburg, MD). Fetal bovine serum (FBS) and charcoal/dextran-treated FBS were purchased from HyClone Laboratories (Logan, UT). Human Vav3-specific Stealth™ Select RNAi (siVav3-247: 5'-CCCAGTTTCTCTGTTTGAAGAACAT-3') and its control (control-247: 5'-CCCTTCTCTGTTTGTAAAGAGACAT-3') were designed by a software in Invitrogen website and we purchased both oligos from Invitrogen as described before [
25]. The transfection reagent Lipofectamine™ 2000 was from Invitrogen. Anti-Vav3 and anti-ERα antibodies were obtained from Upstate Biotechnology (Charlottesville, VA).
Cell culture
The human breast cancer cell lines MCF7 and T47D, and cervical carcinoma cell line Hela were obtained from ATCC (Rockville, MD) and maintained in RPMI-1640 medium supplemented with 10% FBS (complete medium) at 37°C in 5% CO2. Nontumoral breast epithelial MCF-10A cells were obtained from ATCC. Transient transfection experiments were performed in RPMI-1640 medium supplemented with 10% charcoal/dextran-treated FBS (stripped medium).
Plasmids
Plasmids pBEF-Vav3, pHEF-Vav3*, pHEF-Vav3*-ΔDH, pHEF-Vav3*-ΔSH, and control vector pHEF were detailed in our previous studies [
25]. pS2-Luc is a gift from Dr. Sohaib Khan, Department of Cell Biology, University of Cincinnati College of Medicine. ERα and ERE-Luc are gifts from Dr. Zafar Nawaz, Braman Breast Cancer Institute, University of Miami Miller School of Medicine.
For generation of GST-Vav3-DH+PH construct, we designed upper primer 5' CGAGAATTCAAGGCAGAGGAAGCACATCAG containing Eco RI site and lower primer 5' TCTGCGGCCGCTGTTTAGGAGTTCTTCGCAG containing Not I site flanking both the DH and PH domains of Vav3 gene. The PCR product by amplification of the DH and PH domains using this pair of primers was subcloned into pGEX-4T-1 vector (GE Healthcare Bio-Sciences Corp. Piscataway, NJ) in frame by Eco RI and Not I sites.
Cell growth assay
Tumor cell growth was estimated by MTT assay as previously described [
27]. Briefly, breast cancer cells were seeded into 96-well cell culture plates at a density of 2.5 × 10
3 cells/well in stripped medium. After incubation in 5% CO2 at 37°C overnight, the cells were transfected with Vav3 siRNA and control siRNA using Lipofectamine 2000 and then cultured in stripped medium without or with E2 (10
-9M) for 5 days. At the end of incubation, 20 ul of MTT (2.5 mg/ml in PBS) was added to each well, and the cells were further incubated for one hour at 37°C to allow complete reaction between the dye and the enzyme mitochondrial dehydrogenase in the viable cells. After removal of the residual dye and medium, 100 ul of dimethylsulfoxide was added to each well, and the absorbance at 570 nm was measured using BMG microplate Reader (BMG Labtech, Inc., Durham, NC).
Western blot analysis
Western blot analysis was performed as previously described [
27]. Briefly, aliquots of samples with the same amount of protein, determined using the Bradford assay (BioRad, Hercules, CA), were mixed with loading buffer (final concentrations of 62.5 mM Tris-HCl, pH 6.8, 2.3% SDS, 100 mM dithiothreitol, and 0.005% bromophenol blue), boiled, fractionated in a SDS-PAGE, and transferred onto a 0.45-um nitrocellulose membrane (BioRad). The filters were blocked with 2% fat-free milk in PBS, and probed with first antibody in PBS containing 0.1% Tween 20 (PBST) and 1% fat-free milk. The membranes were then washed four times in PBST and incubated with horseradish peroxidase-conjugated secondary antibody (BioRad) in PBST containing 1% fat-free milk. After washing four times in PBST, the membranes were visualized using the ECL Western blotting detection system (Amersham Co., Arlington Height, IL). For western blot analysis of Vav3 expression, the first antibody was incubated overnight at 4°C.
Reporter assay
Cells (105/well) were seeded in 12 well tissue culture plates. Next day, Optifect-mediated transfection was used for the transient transfection assay according to the protocol provided by Invitrogen/Life Technologies, Inc. The cells were then treated with hormone or drugs in stripped medium for 24 hours. Subsequently, the cell extracts were prepared and luciferase activity was assessed in a Berthold Detection System (Pforzheim, Germany) using a kit (Promega, Madison, WI) following the manufacture's instruction. For each assay, cell extract (20 ul) was used and the reaction was started by injection of 50 ul of luciferase substrate. Each reaction was measured for 10 seconds in the Luminometer. Luciferase activity was defined as light units/mg protein.
GST pull down
GST-Vav3-DH+PH and control GST vectors were transformed into BL21 bacteria, respectively (Protein Express, Inc. Cincinnati, OH). The transformed bacteria were cultured in L-Broth with addition of 100 uM of IPTG to induce GST-fusion protein expression. Then, the bacteria were harvested and subjected to GST fusion protein purification by Sonication and using Glutathione Sepharose 4B (Amersham Bioscience).
For pull down reaction, 5~10 ug of GST or GST-Vav3-DH+PH was incubated with 1 mg of cell extracts from MCF7 cells in a binding buffer [20 mM of Tris.CL, PH. 7.9; 300 mM of KCL; 0.05% of NP-40; 0.2 mM of EDTA; 20% of Glycerol; 1 mM of Dithiothritol; 1 mM of phenylmethylsulfonyl fluoride (PMSF), 1× of protease inhibitor cocktail (Roche Diagnostics)] for overnight [
28,
29]. Then, the beads were washed for five times in a washing buffer (20 mM of Tris.CL, PH. 7.9; 300 mM of NaCL; 0.01% of NP-40; 0.2 mM of EDTA; 20% of Glycerol; 0.5 mM of Dithiothritol) and boiled in 1 × SDS loading buffer. The proteins in the supernatant were subjected for SDS-PAGE, which was visualized by Coomassie Blue staining. The samples were also subjected to western blot analysis for ERα.
Immunohistochemistry (IHC) staining
IHC staining was performed as detailed in our previous studies [
25]. Briefly, paraffin-embedded section of breast cancer tissue array (US Biomax, Rockville, MD) was deparaffinized in xylene, rehydrated in graded alcohol, and transferred to PBS. The slides were treated with a citric acid-based antigen-retrieval buffer (DAKO Co., Carpinteria, CA), followed by 3% H
2O
2 in methanol, incubated in blocking buffer (5% BSA and 5% horse serum in PBS) and then in the blocking buffer containing antibodies against human Vav3 (Upstate Biotechnology Inc.). After washing, the slide was incubated with a biotinylated secondary antibody (BioGenex Laboratories, San Ramon, CA), followed by washing and incubation with the streptavidin-conjugated peroxidase (BioGenex). A positive reaction was visualized by incubating the slides with stable diaminobenzidine and counterstaining with Gill's hematoxylin (BioGenex) and mounted with Universal Mount mounting medium (Fisher Scientific, Pittsburgh, PA). The intensity and extent of cytoplasm-positive labeling for Vav3 in tissue arrays were assessed semiquantitatively and scored as 0 (no staining), 1+ (weak and focal staining in <25% of tissue), 2+ (moderate intensity in 25–50% of tissue), and 3+ (moderate intensity in >50% of tissue), and 4+ (strong and diffused staining in >50% of tissue).
Discussion
Previous studies from our group have demonstrated that Vav3 is overexpressed in human prostate cancer and potentiates AR signaling [
25]. Breast cancer and prostate cancer are steroid-dependent tumors and share a significant similarity in their characteristics and treatment. For instance, growth of these cancer cells, mediated by their corresponding hormone receptors ERα and AR, is hormone-dependent. Hormone ablation is common therapy for both cancers. Recurrent diseases develop hormone-independent growth. Given that steroidal nuclear receptors share many common properties, we hypothesized that Vav3 may regulate ERα activity and is involved in human breast cancer. We tested this hypothesis in the present study by examining the expression of Vav3 in human breast cancer specimens and cell lines and investigated a potential role of Vav3 in breast cancer cell growth and ERα signaling. We found that Vav3 was overexpressed in human breast cancer, particularly in the poorly differentiated lesions and in the two most commonly used breast cancer cell lines. The knockdown expression of Vav3 compromised both estrogen-stimulated and -independent growth of breast cancer cells. On the other hand, overexpression of Vav3 enhanced ERα signaling. These data strongly suggest that Vav3 may play an important role in breast cancer development and/or progression.
Vav3 is an oncogene identified in cell transformation experiments [
3]. Vav3 is activated upon ligand stimulation of EGF, insulin, Ros, and IGF receptors and physically associates with a variety of signaling molecules, including Rac1, Cdc42, PI3K, Grb2, and PLC-γ, leading to alteration in cell morphology and cell transformation [
33]. Overexpression of Vav3 leads to PI3K activation and focus formation in NIH3T3 cells [
34]. In contrast, blocking PI3K activation by PTEN and LY294002 inhibits Vav3-induced cell transformation. Furthermore, it has been shown that Vav3*, a Vav3 mutant with N-terminal domain deletion including the acidic domain, is a constitutive active form and has much stronger oncogenic effect compared with that by Vav3 [
30]. Consistently, we found that the augmentation of ERα signaling by Vav3 overexpression was similarly inhibited by Wortmannin and by overexpression of a dominant-negative Akt. In addition, Vav3 showed a lower activity for ERα activation relative to that by Vav3*. EGF treatment significantly potentiated Vav3 activity for ERα activation. These data suggest that Vav3 is subjected to regulation by phosphorylation, most likely at the three tyrosines in the AD domain, which may cause conformation change, release the inhibitory effect of the N-terminal domain, and expose the DH domain for ERα binding.
Many coactivators of steroid hormone receptors have the LXXLL motifs, where L is leucine and X is any amino acid [
37,
38]. These coregulators interact with and upregulate ERα-mediated signaling in both nucleus and cytoplasm. For instance, SRC-1 and its related proteins are a family of coactivators containing the homologous bHLH-PAS domain and receptor-interacting domain (RID) with multiple LXXLL motifs and enhance transcription activity of nuclear receptors [
37,
38]. PELP1/MNAR containing the LXXLL motif interacts with and enhances both genomic and nongenomic ERα activities [
21,
24]. Recent findings implicate that Vav family proteins also complex with transcription factors and regulate gene expression. Vav1 was identified in the component of transcriptionally active nuclear factor of activated T cells (NFAT)- and nuclear factor NFkB-like complexes [
35,
36]. A nuclear localization signal (NLS) in the PH domain is solely responsible for nucleus localization of Vav1 protein, indicating a role of Vav family proteins as a transcription coregulator. We found that Vav3 contains the LXXLL motifs in the DH domain and NLS in the PH domain. This finding suggests that Vav3 is also a nuclear protein.
Previous study has shown that Vav protein can be activated by receptor tyrosine kinase upon activation of EGFR [
39]. Furthermore, ERα resides in multi-protein complexes with molecules, such as MNAR/PELP1 and src, in the cytoplasm and signals through the PI3K-Akt and MAPK pathways in breast cancer cells [
23,
24]. ERα was also found localized in lipid rafts and involved in signaling elicited by EGFR and HER2 receptors [
40,
41]. We found that Vav3 activates ERα partially via PI3K-Akt signaling and potentiates EGF effect for cell growth and ERα activation in breast cancer cells. More interestingly, we found that Vav3 complexes with ERα. These findings suggest that Vav3 enhances ERα signaling axis in breast cancer cells. Vav3 overexpression may confer ERα hypersensitivity and play a role in breast cancer. Given both nuclear and cytoplasmic localization of Vav3 protein, our data implicate that Vav3 may impact on both genomic and nongenomic ERα activity. Furthermore, the relationship of Vav3 and ERα in the context of EGFR/HER2 and PI3K-Akt signaling is remained to be determined.
Our findings support the notion that Vav3 overexpression may play a role in breast cancer, based on the following reasons: 1) Vav3 is overexpressed and correlated with poorly differentiated tumors in human breast cancer; 2) Vav3 contains the LXXLL motifs and complexes with ERα; 3) Vav3 enhances ERα activity partially via the PI3K-Akt pathway; 4) Vav3 is a protein with multiple domains and functions, including the SH2 domain interacting with receptor protein tyrosine kinase, the PH domain binding PIP3 involved in association with the cell membrane, and the DH domain involved in interaction with ERα; 5) Vav3 potentiates EGF for cell growth and ERα activation. Taken together, these findings suggest that Vav3 overexpression enhances ERα-mediated signaling axis and may be involved in breast cancer.
Data presented in this report clearly show that Vav3 is overexpressed in human breast cancer and is involved in growth of breast cancer cells and ERα signaling. Whereas our data showed that Vav3 complexes with ERα, molecular mechanisms underlying the enhancement of ERα signaling remain to be elucidated. Nevertheless, data presented here strongly suggest a novel mechanism that potentially leads to ERα hypersensitivity and breast cancer development and/or progression.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
KL generated GST fusion protein for pull down analysis. YL performed cell cultures, proliferation assays, Western blot analysis, and reporter assay. ZD performed IHC. JQM did histopathological analysis of breast cancer tissues. JZ provided plasmid and expertise in protein/protein interaction. SL contributed to conception and design of study and interpretation of data. All authors read and approved the final manuscript.