Background
Methods
Ethical approval
Otitis media definitions
Specimens
DNA extraction
General parameters for bacterial load qPCR assays
A. otitidis qPCR
Assay | Gene | Primer and Probe sequences | Position | Amplicon size (bp) | Reference |
---|---|---|---|---|---|
Ao | 16S rRNA | Forward primer 5'- CTACGCATTTCACCGCTACAC -3' | 437-457 | 265 | [33] |
Reverse primer 5'- GGGGAAGAACACGGATAGGA -3' | 702-483 | ||||
TBL | 16S rRNA | Forward primer 5'- TCCTACGGGAGGCAGCAGT -3' | 331-349 | 466 | |
Reverse primer 5'- GGACTACCAGGGTATCTAATCCTGTT -3' | 797-772 | ||||
Hi |
hpd
| Forward primer 5’- GGTTAAATATGCCGATGGTGTTG -3’ | 822-844 | 151 | |
Reverse primer 5’- TGCATCTTTACGCACGGTGTA -3’ | 972-953 | ||||
Probe 5’Hex- TTGTGTACACTCCGT “T” GGTAAAAGAACTTGCAC -SpC6 -3’* | 928-896 | ||||
Spn |
lytA
| Forward primer 5'- TCTTACGCAATCTAGCAGATGAAGC -3' | 306-326 | 101 | [6] |
Reverse primer 5'- GTTGTTTGGTTGGTTATTCGTGC -3' | 406-386 | ||||
Probe 5'- [6-FAM]-TTTGCCGAAAACGCTTGATACAGGG -[TAMRA] -3' | 354-330 | ||||
Mc |
copB
| Forward primer 5'- GTGAGTGCCGCTTTTACAACC -3' | 50-70 | 72 | [6] |
Reverse primer 5'- TGTATCGCCTGCCAAGACAA -3' | 121-102 |
Other bacterial load qPCR assays
A. otitidis culture and identification
A. otitidis antibiotic susceptibility testing
Results
qPCR detection of A. otitidis
Culture of A. otitidis qPCR-positive swabs
Sample | Days of culture until A. otitidis was isolated | Penicillin MIC | Erythromycin MIC | Azithromycin MIC | |
---|---|---|---|---|---|
HBA agar | BHI agar with 6.5%NaCl | ||||
Child A (Left ear) | 5 | 7 | 0.19 | 4 | 1.5 |
Child A (Right ear) | 2 | 5 | 0.125 | 3 | 2 |
Child B | 14 | 5 | 0.006 | >256 | 128 |
Child C | Not detected* | 9 | 0.19 | >256 | >256 |
Child D | 7 | Not detected | 0.032 | 96 | 64 |
Susceptibility of A. otitidis isolates
Other bacteria cultured from A. otitidis-positive ear discharge swabs
Swab |
S. pneumoniae
|
H. influenzae
|
M. catarrhalis
| β-haemolytic streptococci |
Staphylococcus sp. |
P. aeruginosa
|
Proteus sp.
| Other |
---|---|---|---|---|---|---|---|---|
Child A (Left ear) | - | + | - | - | - | - | - | + |
Child A (Right ear) | - | + | - | - | + | - | - | - |
Child B | - | - | n/a | - | + | n/a | + | + |
Child C | - | - | n/a | - | + | - | + | + |
Child D | - | - | - | + | + | - | - | + |
Child E | + | + | - | - | + | - | - | - |
Child F | - | - | n/a | - | + | n/a | + | + |
Child G | + | + | + | - | + | - | - | + |
Child H | - | - | - | - | + | - | - | + |
Child I | - | - | - | - | + | + | - | + |
Child J | - | - | - | - | + | + | - | + |
A. otitidis bacterial load and relative abundance in polymicrobial ear discharge specimens
A. otitidis
|
H. influenzae
|
S. pneumoniae
|
M. catarrhalis
| |
---|---|---|---|---|
In A. otitidis-positive ED swabs (n = 11#) | ||||
qPCR-positive swabs | 11 | 10 | 3 | 4 |
Culture-positive swabs | 5 | 4 | 2 | 1 |
Bacterial load range (cells/swab) | 2.2 × 104-1.1 ×108
| 4.3 ×104-1.2 ×107
| 3.5 ×104-1.8 ×105
| 4.3 ×104-5.9 ×105
|
Number of swabs with bacterial load >1x106 cells/swab | 5 | 5 | 0 | 0 |
Number of swabs culture-positive and bacterial load >1x106 cells/swab | 4 | 3 | 0 | 0 |
Number of swabs with relative abundance <1% | 6 | 5 | 3 | 4 |
Relative abundance range (%) | 0.01-0.70 | 0.02-0.79 | 0.01-0.68 | 0.01-0.89 |
Number of swabs with relative abundance >1% | 5 | 5 | 0 | 0 |
Relative abundance range (%) | 2-34 | 4-27 | 0 | 0 |