Chromosome 9p21.3 polymorphism in a Chinese Han population is associated with angiographic coronary plaque progression in non-diabetic but not in type 2 diabetic patients

The study protocol was approved by the hospital Ethics Committee, and written informed consents were obtained from all subjects.

The study population consisted of 2046 Chinese Han patients (1012 diabetic and 1034 non-diabetic cases) undergoing coronary angiography between March 2004 and December 2007 for the evaluation of suspected or established CAD (luminal diameter narrowing ≥50%); 430 of them received repeat angiography at 1-year follow-up. Type 2 diabetes was defined as a fasting plasma glucose level ≥7.0 mmol/L or non-fasting plasma glucose level≥11.1 mmol/L, or taking oral hypoglycemic drugs or receiving parenteral insulin therapy. Patients with type 1 diabetes were excluded by measuring C peptide, and excluded were also those with chronic viral or bacterial infection, tumor, or immune system disorders. Diagnosis of hypertension was based on the presence of elevated systolic (≥140 mmHg) and/or diastolic (≥90 mmHg) blood pressure, or current use of antihypertensive medications for one year before admission. Patients were diagnosed as hyperlipidemia if serum levels of total cholesterol (TC)>5.7 mmol/l (220 mg/dl), triglycerides (TG) >1.7 mmol/l (150 mg/dl), low-density lipoprotein cholesterol (LDL-C) >3.64 mmol/L (140 mg/dl), or high-density lipoprotein cholesterol (HDL-C) <0.91 mmol/L (35 mg/dl).

Coronary angiography was performed using standard Judkins techniques or through radial approach, and all major coronary arteries were carefully imaged on at least two orthogonal views. Quantitative coronary analysis (QCA) was performed (TERRA, GE, USA) by two experienced interventional cardiologists, who were unaware of clinical information of the patients. For those with coronary angiography at baseline and 1-year follow-up, all coronary arteries intervened with percutaneous coronary intervention (PCI) were excluded to avoid inclusion of post-PCI neointimal hyperplasia or restenosis [16]. The coronary artery segments analyzed included all those plaques with a reference diameter ≥ 1.5 mm and a stenosis ≥ 20% at baseline and those with new lesions at follow-up in non-PCI intervened artery. Using the outer diameter of the contrast-filled catheter as the calibration, the minimal lumen diameter (MLD) in diastole was measured from multiple projections. Atherosclerotic plaque progression was diagnosed if one of the following criteria was met: (1) ≥10% diameter reduction of a pre-existing stenosis ≥50%; (2) ≥30% diameter reduction of a stenosis <50%; (3) progression of any stenosis to total occlusion, or (4) development of a new stenosis ≥30% in a previously normal segment [17]. A new coronary lesion was defined as a stenosis that was not apparent on the initial angiogram or was <20% in diameter stenosis but that narrowed by≥0.4 mm in MLD at the follow-up angiogram [18]. Coronary artery score was calculated from per-patient average of the MLD of all the measured segments in observed coronary artery, and cumulative coronary obstruction was the sum of all percent diameter stenosis in standard index unit (50% = 0.50) [19]. Change of QCA measurements was defined as baseline QCA measurement minus follow-up measurement.

Blood samples were collected after an overnight fasting in all patients and were stored at -80°C. Serum glucose, hemoglobin A_1c (HbA_1c), insulin levels, blood urea nitrogen (BUN), creatinine, and lipid profiles (TC,LDL-C,HDL-C,TG) were measured (HITACHI 912 Analyzer, Roche Diagnostics, Germany). Serum high sensitivity C-reactive protein (hsCRP) level was determined using a high-sensitivity ELISA kit (Biocheck Laboratories, Toledo, OH, USA) with a linear range of 0.62-119.3 mg/L and an inter-assay CV <7.5%.

Genomic DNA was extracted from peripheral blood leucocytes by standard phenol-chloroform extraction. Genotyping was performed with TaqMan SNP allelic discrimination by means of an ABI 7900HT (Applied Biosystems, Foster City, CA, USA), in 384-well format. The TaqMan Assay kit was purchased from Applied Biosystems (Foster City, CA, USA). Genotypes were determined with the same method as previously described [20], in which primers of rs1333049 polymorphism were TCACTACCCTACTGTCATTCCTCAT and TTGCTTACCTCTGCGAGTGG, and probes were VIC-CAACAGTTCAAAAGCA and FAM-AACAGTTGAAAAGCA. Data were analyzed using the ABI Prism SDS software version 2.1.

As expected, patients with CAD were older and more male gender, and had more risk factors for CAD including smoking, hypertension, hyperlipidemia and diabetes and higher serum hsCRP level than those without CAD (all p < 0.05; data not shown). Despite similar medical treatments, patients with plaque progression had more diabetes, elevated serum levels of 2 h plasma glucose and hsCRP, and reduced HDL-C than those without plaque progression (Table 1).

The genotype frequencies of rs1333049 were in Hardy-Weinberg equilibrium in patients with and without CAD (all p > 0.05, data not shown). CC genotype of rs1333049 was associated with CAD in overall patients with unadjusted OR 1.524, 95% CI 1.192-1.949, p = 0.001 and adjusted OR 1.859, 95% CI 1.212-2.852, p = 0.005, respectively (Table 2). Further analysis showed that CC genotype was not significantly associated with CAD in diabetic patients (OR 1.275, 95% CI 0.843-1.930, p = 0.150) compared with non-diabetic counterparts (OR 1.446 95% CI 1.145-1.826, p = 0.020).

Biochemical measurements and angiographic features with respect to various genotypes are listed in Table 3. White blood cell (WBC) and neutrophile counts were significantly higher in CC genotype carriers. There were no significant differences in changes of MLD, percent diameter stenosis and number of new coronary lesions among the three genotypes in the whole population at follow-up angiography (all p > 0.05) (Table 3). In non-diabetic patients, risk C allele of rs1333049 was related to degree of MLD reduction (0.25 ± 0.49 mm for CC genotype, 0.20 ± 0.35 mm for GC genotype, and 0.05 ± 0.35 mm for GG genotype, respectively, p = 0.005) (Table 4). Similar findings were observed for change of percent diameter stenosis, coronary artery score and cumulative coronary obstruction (p = 0.038, 0.004 and 0.025, respectively). Although diabetic patients had more severe plaque progression than non-diabetic counterparts, no relations existed between plaque progression and genotypes (all p > 0.05) (Table 4).

Multivariable logistic regression analysis revealed that gender (male), hypertension, genotypes carrying allele C, low HDL-C and high hsCRP were independently associated with plaque progression in non-diabetic patients during 1-year follow-up (OR 3.468 95% CI 1.504-8.000, p = 0.004 for GC genotype and OR 4.339 95% CI 1.740-10.821, p = 0.002 for CC genotype). Meanwhile, gender (male), age, hyperlipidemia, smoking and high hsCRP, but not risk genotype of rs1333049, were independent determinants of plaque progression in diabetic patients (Table 5).