Background
Methods
Study area and population
Study design
Treatment
Data collection
Laboratory methods
Thick and thin smears
Haematological and biochemistry analysis
Genotyping
Gene | Name | Primer sequence | PCR program |
---|---|---|---|
msp 1 primary | O1 | 5′ CACATGAAAGTTATCAAGAACTTGTC 3′ | 94°C-3 min, [94°C-25 sec, 50 °C-45 sec, 68°C-2 min] × 30, 72°C-3 min |
O2 | 5′ GTACGTCTAATTCATTTGCACG 3′ | ||
msp 1 nested | N1 | 5′ GCAGTATTGACAGGTTATGG 3′ | 94°C-3 min, [94°C-30 sec, 50 °C-45 sec, 68°C-2 min] × 30, 72°C-3 min |
N2 | 5′ GATTGAAAGGTATTTGAC 3′ | ||
msp2 primary | S3 | 5′ GAAGGTAATTAAAACATTGTC 3′ | 94°C-3 min, [94°C-30 sec, 42′C-60 sec, 65°C-2 min] × 30, 72°C-3 min |
S2 | 5′ GAGGGATGTTGCTGCTCCACAG 3′ | ||
msp2 nested | S1 | 5′ GAGTATAAGGAGAAGTATG 3′ | 94°C-3 min, [94°C-30 sec, 50 °C-60 sec, 72°C-2 min] × 45, 72°C-3 min |
S4 | 5′ CTAGAACCATGCATATGTCC 3′ |
Statistical methods
Ethical considerations
Results
Baseline characteristics
Artesunate Mefloquine (n = 157) | Artemether Lumefantrine (n = 153) | p value | |
---|---|---|---|
Age (mean ± SD, years) | 25 ± 11 | 23.2 ± 10,5 | 0.15 |
Weight (mean ± SD, Kg) | 62.1 ± 11.8 | 58.2 ± 11.5 | 0.08 |
Sex ratio (male/female) | 1.2 | 0.6 | 0.03 |
Temperature (mean ± SD) | 37.8 ± 1.2 | 37.7 ± 1.1 | 0.41 |
Median Parasitemia (trophozoites/μL) | 17411 | 17688 | 0.88 |
Mean haemoglobin (g/dl) | 12.2 ± 1.7 | 11.7 ± 1.7 | 0.99 |
Anaemia (Hb < 11 g/dl,%) | 36.3 | 40.5 | 0.44 |
ASAT (UI/L, mean ± SD) | 31.2 ± 18.7 | 33.1 ± 16.8 | 0.38 |
Patients with normal level of ASAT (ASAT < 40 UI/L) (%) | 128 (81.5%) | 123 (80.4%) | 0.79 |
ALAT (UI/L, mean ± SD) | 28.2 ± 20.3 | 26.3 ± 24.1 | 0.47 |
Patients with normal level of ALAT (ALAT < 40 UI/L) (%) | 119 (82.1%) | 138 (90.2%) | 0.04 |
Creatinine (mean ± SD) | 7.6 ± 5.4 | 8.2 ± 3.5 | 0.24 |
Patients with normal level of creatinine (<13 mg/L) (%) | 148 (94.3%) | 143 (93.5%) | 0.76 |
Median Bilirubunemia (mg/L) | 1.91 | 1.71 | 0.51 |
Patients with normal level of Biliribunemia (<10 mg/L) (%) | 48 (30.6%) | 55 (35.9%) | 0.31 |
Treatment efficacy
Outcome | Artesunate Mefloquine (n = 157) | Artemether Lumefantrine (n = 153) | p value |
---|---|---|---|
Intention to treat analysis | |||
Early treatment failure | 00 | 00 | - |
NA | 6 (3.82%) | 4 (2.61%) | 0.77 |
Crude Parasitological failure at day 28 | 1 (0.64%) | 4 (2.61%) | 0.35 |
PCR adjusted failure rate | 1 (0.64%) | 1 (0.65%) | |
PCR adjusted cure rate at day 28 | 150 (95.54%) | 148 (96.73%) | 0.58 |
Artesunate Mefloquine
|
Artemether Lumefantrine
| ||
Per protocol analysis | |||
Early treatment failure | 00 | 00 | - |
Crude parasitological failure | 1/151 (0.66%) | 4/149 (2.6%) | 0.17 |
PCR adjusted failure rate | 1/151 (0.66%) | 1/149 (0.67%) | 0.99 |
PCR adjusted cure rate at day 28 | 150/151 (99.34%) | 148/149 (99.33%) | 0.99 |
Crude parasitological failure at day 42 | 2/70 (2.8%) | 5/57 (8.7% | 0.20 |
PCR adjusted ACPR at day 42 | 69/70 (98.5%) | 56/57 (98.2%) | 1 |
Crude parasitological failure at day 63 | 4/57 (7%) | 6/44 (13%) | 0.32 |
PCR adjusted ACPR at day 63 | 56/57 (98.2%) | 43/44 (97.7%) | 1 |
Safety and tolerability
Day 1 | Day 2 | Day 3 | Day 7 | |||||
---|---|---|---|---|---|---|---|---|
Adverse event | AM | AL | AM | AL | AM | AL | AM | MF |
Dizziness (n,%) | 35 (22.3) | 17 (11.1) | 61 (38.8) | 8 (5.2) | 58 (38.1) | 11 (7.1) | 15 (10.2) | 6 (4.03) |
Vomit (n,%) | 16 (10.2) | 11 (7.2) | 09 (5.7) | 0 | 04 (2.6) | 0 | 0 | 0 |
Abdominal pain | 15 (9.5) | 11 (7.2) | 11 (7.2) | 10 (6.5) | 10 (6.5) | 4 (2.6) | 1 (0.66) | 0 |
Pruritus (n,%) | 0 | 2 (1.3) | 0 | 1 (0.6) | 0 | 0 | 0 | 0 |
Oral herpes (n,%) | 0 | 2 (1.3) | 0 | 3 (1.9) | 1 (0.66) | 3 (1.9) | 0 | 1 (0.67) |
Dizziness | |||||||||
---|---|---|---|---|---|---|---|---|---|
Day 1 | Day 2 | Day 3 | |||||||
n (%) | aOR** (95%CI) | p value | n (%) | aOR (95%CI) | p value | n (%) | aOR (95%CI) | p value | |
*Treatment
| |||||||||
AL (n = 153)
| 17 (11.1%) | 1 | 8 (5.2) | 1 | 11 (7.1) | 1 | |||
AM (n = 157)
| 35 (22.3%) | 2.2 (1.1-4.4) | .02 | 61 (38.8) | 12.5 (5.5 – 28.1) | .001 | 58 (38.1) | 10.2 (4.7-22.3) | .001 |
AM | AL | p value | |
---|---|---|---|
Day 7 | Day 7 | ||
Mean haemoglobin | 11.3 ± 1.8 | 10.6 ± 1.5 | 0.11 |
Anaemia (%) | 86 (54.7%) | 105 (68.6%) | 0.01 |
Median ALAT | 19 | 19.3 | 0.93 |
Median ASAT | 24 | 25 | 0.53 |
Patients with ASAT < 40 (%) | 143 (91%) | 139 (90.8%) | 0.94 |
Patients with ALAT < 40 (%) | 146 (92.9%) | 145 (94.7%) | 0.51 |
Mean creatinine | 7.7 ± 4.7 | 8.2 ± 7.0 | 0.50 |
Patients with normal level of creatinine (%) | 149 (94.9%) | 150 (98.0%) | 0.13 |
Median bilirubin | 1.10 | 1.08 | 0.36 |
Patients with normal level of bilirubin (%) | 92 (58.6%) | 82 (53.6%) | 0.37 |