Skip to main content
Erschienen in: Malaria Journal 1/2015

Open Access 01.12.2015 | Methodology

COIL: a methodology for evaluating malarial complexity of infection using likelihood from single nucleotide polymorphism data

verfasst von: Kevin Galinsky, Clarissa Valim, Arielle Salmier, Benoit de Thoisy, Lise Musset, Eric Legrand, Aubrey Faust, Mary Lynn Baniecki, Daouda Ndiaye, Rachel F Daniels, Daniel L Hartl, Pardis C Sabeti, Dyann F Wirth, Sarah K Volkman, Daniel E Neafsey

Erschienen in: Malaria Journal | Ausgabe 1/2015

download
DOWNLOAD
print
DRUCKEN
insite
SUCHEN

Abstract

Background

Complex malaria infections are defined as those containing more than one genetically distinct lineage of Plasmodium parasite. Complexity of infection (COI) is a useful parameter to estimate from patient blood samples because it is associated with clinical outcome, epidemiology and disease transmission rate. This manuscript describes a method for estimating COI using likelihood, called COIL, from a panel of bi-allelic genotyping assays.

Methods

COIL assumes that distinct parasite lineages in complex infections are unrelated and that genotyped loci do not exhibit significant linkage disequilibrium. Using the population minor allele frequency (MAF) of the genotyped loci, COIL uses the binomial distribution to estimate the likelihood of a COI level given the prevalence of observed monomorphic or polymorphic genotypes within each sample.

Results

COIL reliably estimates COI up to a level of three or five with at least 24 or 96 unlinked genotyped loci, respectively, as determined by in silico simulation and empirical validation. Evaluation of COI levels greater than five in patient samples may require a very large collection of genotype data, making sequencing a more cost-effective approach for evaluating COI under conditions when disease transmission is extremely high. Performance of the method is positively correlated with the MAF of the genotyped loci. COI estimates from existing SNP genotype datasets create a more detailed portrait of disease than analyses based simply on the number of polymorphic genotypes observed within samples.

Conclusions

The capacity to reliably estimate COI from a genome-wide panel of SNP genotypes provides a potentially more accurate alternative to methods relying on PCR amplification of a small number of loci for estimating COI. This approach will also increase the number of applications of SNP genotype data, providing additional motivation to employ SNP barcodes for studies of disease epidemiology or control measure efficacy. The COIL program is available for download from GitHub, and users may also upload their SNP genotype data to a web interface for simple and efficient determination of sample COI.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1475-2875-14-4) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

KG and DEN conceived the approach. KG performed the analyses and wrote the software. CV, PCS, RD, DLH, DFW, SKV, and DEN wrote the manuscript. AS, BdT, and LM generated the microsatellite data and contributed the French Guiana P. vivax samples. AF and MLB generated and analysed the SNP genotype data for the French Guiana samples. DN and RFD contributed the Senegal samples and generated the data. All authors read and approved the final manuscript.
Abkürzungen
COI
Complexity of infection
LD
Linkage disequilibrium
MAF
Minor allele frequency
PCR
Polymerase chain reaction
SNP
Single nucleotide polymorphism.

Background

Complexity of infection (COI) in the context of malaria may be defined as the number of genetically distinct Plasmodium parasite types simultaneously infecting a patient. Complex (COI >1) infections may be generated by multiple bites from parasite-infected mosquitoes or by a single bite from a mosquito infected with multiple genetic parasite types. COI is an important parameter to measure for two reasons: 1) its potential bearing on clinical disease outcome and, 2) the information it can provide about disease transmission.
The relevance of COI to disease manifestation and immune response is well established, but mechanisms are not yet understood and correlations are sometimes contradictory. Investigators have found an inverse association between COI and patient age in diverse geographic study sites [36], suggesting that acquired immunity to specific parasite strains may cumulatively impact COI. Immunization with the SPf66 [7] or RTS,S/AS02A [8] vaccines has been found to reduce both COI and disease morbidity, suggesting a possible causal link between these two phenomena. While some studies have documented a positive association between COI and symptomatic malaria [9, 10] others have found an inverse association [1113], suggesting that the clinical and epidemiological consequences of COI are important but not yet fully understood. One recent study found a highly significant positive association between COI and severe malaria in Kampala, Uganda [14]. The true relationship between COI and disease outcome may differ in Plasmodium vivax from Plasmodium falciparum, and disease outcome may further be complicated by simultaneous infections of both species.
Knowing the distribution of COI across a patient population can reveal much about the nature of disease transmission and epidemiology. For P. falciparum infections, COI in Senegal has been found to be seasonal and positively associated with the degree of parasitaemia in individual patients [15]. In Sudan and Tanzania, COI has been used as a metric to study the rate of disease transmission [16, 17]. Nkhoma and colleagues recently observed that polymorphic SNP genotypes (expected if COI >1) declined in prevalence over the course of a decade along the Thai-Burma border, in tandem with a decline in disease transmission in that region [18].
Given the usefulness of COI, a variety of methods have been developed for estimation of this statistic from clinical samples. The most common method to evaluate COI involves PCR amplification of one or more genetic loci (msp1, msp3, glurp) known to be segregating numerous insertion/deletion (indel) polymorphisms, and then estimating COI as the maximum number of amplicon-length alleles observed at the most diverse locus for a given sample [19]. This method requires subjective interpretation of agarose gels, has been observed to yield inconsistent PCR results, and may be insensitive due to the relatively small number of indel polymorphisms surveyed [20]. Other methods of evaluating COI have focused on reconstructing haplotypes from sequencing or genotyping data at one or a few loci [21]. These haplotype-reconstruction approaches are computationally intensive, making their application to more than five loci hard to implement, with consequent limited sensitivity for reliable COI estimation in highly complex infections. The F WS metric of Auburn and colleagues [22] captures within-host heterozygosity relative to population diversity from sequence-based SNP data, but does not provide a direct estimate of COI. The estMOI software developed recently by Assefa and colleagues [23] utilizes phasing information of alleles in SNP-dense regions of the genome to estimate COI, but requires deep whole genome shotgun sequence data, which is costly to generate at large scale.
With the advent of sequence-based genome-wide polymorphism catalogues for many parasite populations, it is becoming feasible to design panels of SNP-based genotyping assays for assessing parasite genetic diversity and geographic origin in collections of clinical samples [18, 2428]. Because Plasmodium parasites are haploid during the stages of their life history during which they infect humans, the presence of polymorphic genotype calls in a SNP-based genotyping assay panel, or molecular barcode, is a clear indication that COI is greater than one for a particular sample. However, no formal method exists to directly estimate COI from genotyping data in a haploid organism such as Plasmodium spp.
Given the potential importance of COI and the potential inaccuracy or computational complexity of existing methods for estimating COI, there was a perceived need for new tools. This manuscript describes a computationally efficient, likelihood-based method that produces an estimation of COI from SNP genotyping data, using binomial probability calculations of monomorphic vs polymorphic genotype likelihoods produced using the population minor allele frequency (MAF) of the SNPs comprising the barcode panel. Via in silico simulation and empirical validation, it is shown that SNP barcodes containing at least 24 unlinked assays can reliably resolve COI up to a level of three, and that panels of at least 96 unlinked assays can resolve COI up to a level of five, which is sufficient for a majority of transmission conditions. Though this manuscript focuses on applications to Plasmodium spp., this method is suitable for application to any haploid organism with polymorphism genotype data meeting the assumptions described below.

Methods

COIL employs a Bayesian approach to assign probabilities to distinct COI levels (C) given the data in a genotyping barcode (G). This approach requires a prior probability distribution for COI and the ability to compute the likelihood of COI given a barcode, which is equivalent to computing the probability of observing the barcode at a given COI:
https://static-content.springer.com/image/art%3A10.1186%2F1475-2875-14-4/MediaObjects/12936_2014_3719_Equa_HTML.gif
Two assumptions are made to simplify the computation of the COI likelihood. The first is that the individual assays in the barcode (G i ) are independent, and do not exhibit significant linkage disequilibrium (LD) with other assays. In most P. falciparum and P. vivax populations, LD is found over physical distances of 10 kb or less [29, 30], suggesting a minimum spacing for SNP assays used in this application. When this assumption of assay independence is met, it means that the probability of observing the composite barcode genotype for a sample with a particular COI is equivalent to the product of the probability of observing the results of each of the component assays:
https://static-content.springer.com/image/art%3A10.1186%2F1475-2875-14-4/MediaObjects/12936_2014_3719_Equb_HTML.gif
The second simplifying assumption is that the individual parasite lineages comprising a complex infection are independent and randomly selected from the larger parasite population. In a complex infection assayed for biallelic polymorphisms, the contribution of each strain to the final genotype for each particular assay is therefore equivalent to a series of independent Bernoulli trials, and the overall tally of the number of alternate (non-wild-type/non-reference) alleles conditional upon a given COI follows a binomial distribution. If one denotes X i as the count of alternate alleles at site i with minor allele frequency, then
https://static-content.springer.com/image/art%3A10.1186%2F1475-2875-14-4/MediaObjects/12936_2014_3719_Equc_HTML.gif
Biallelic genotyping assays yield three possible results (not including assay failure) for a haploid pathogen like Plasmodium, enumerated as:
0.
No alternate alleles (monomorphic reference)
 
1.
Only alternate alleles (monomorphic alternate)
 
2.
Mixture of reference and alternate alleles (polymorphic)
 
The probabilities of observing these outcomes can be computed using the binomial distribution:
https://static-content.springer.com/image/art%3A10.1186%2F1475-2875-14-4/MediaObjects/12936_2014_3719_Equd_HTML.gif
Assay failures are ignored and do not contribute to the likelihood calculation. The minor allele frequencies for each assay can be supplied if they are already known for a given population. Alternatively, they can be estimated from singleton infections (which are assumed to be those containing no polymorphic calls) in a given sample. For the methods here, a Bayesian approach to assay MAF is used, where the allele counts are expected to follow a binomial distribution and a Beta(1,1) prior distribution is applied to the MAFs (which is equivalent to the Uniform(0,1) prior). The effect of doing this is to pad the counts of the alleles by 1, which is useful when the minor allele frequency is small and the minor allele is not observed in singleton infections.
This approach was further refined by building in a tolerance for inevitable genotyping errors. A genotyping error is defined as a scenario in which the observed outcome of an assay (G i *) does not match the true state of the polymorphism in the sample. The error rates (E) can be described as a stochastic matrix as follows:
https://static-content.springer.com/image/art%3A10.1186%2F1475-2875-14-4/MediaObjects/12936_2014_3719_Eque_HTML.gif
Using this matrix, one can calculate the probability of observing any outcome of the assay as:
https://static-content.springer.com/image/art%3A10.1186%2F1475-2875-14-4/MediaObjects/12936_2014_3719_Equf_HTML.gif
To find the posterior COI distribution, the likelihood for each COI level is multiplied by the prior probability for that COI, and then the likelihoods are normalized to sum to one. The choice of prior can be informative if there is some information about the prevalence of complex infections. Alternatively, the COI prior can simply be defined as a discrete uniform distribution with the maximum value being the limit of detection for the given barcode. The default prior on the web implementation of COIL assumes no external information exists about the prevalence of complex infections, and utilizes a uniform distribution with a maximum COI level of five. The downloadable version of COIL allows users to manipulate the prior.

Results

The fundamental utility of this algorithm derives from the property that, for a given minor allele frequency and genotyping error rate, the number of polymorphic calls in a composite genotype is expected to follow a binomial distribution, the moments of which are dependent on the underlying COI of the sample. Figure 1 illustrates the degree to which the underlying probability mass distributions of the expected number of polymorphic calls vary depending on MAF, for barcodes based on 24 vs 96 assays. Increasing the MAF from 0.2 to 0.4, or the number of assays from 24 to 96, greatly increases the separation of the probability mass distributions for samples of different COI levels, especially when COI is less than five. Mass distributions for samples with COI = 1 depart from the y-axis (zero polymorphic calls) due to the built-in tolerance for genotyping errors. The power of this algorithm is contingent on the separation of these probability mass distributions within the relevant COI range.
The potential performance of this approach was first evaluated using in silico simulations. Simulated genotypes were generated for samples with a true COI ranging from one to five, under conditions in which the assayed SNPs all had minor allele frequencies of 0.2 or 0.4, and in which the size of the assay set was either 24 or 96. After generating 100 simulated genotypes for each condition under a range of COI levels, the genotypes were run through the COIL algorithm and checked for concordance between the true COI and the maximum a posteriori COI predicted by COIL. Figure 2 illustrates the outcome of this in silico experiment. Accuracy is relatively low with 24 assays and an assay MAF of 0.2 (Figure 2a), but improves markedly up to a level of COI = 3 (84.4% correct calls) when assay number is kept the same and MAF is increased to 0.4 (Figure 2b). For a barcode of 96 assays, performance is improved at MAF = 0.2 (Figure 2c) relative to the set of 24 assays, but remains deficient for COI >3. For a barcode containing 96 SNPs with MAF = 0.4 (Figure 2d), accuracy is high up to a COI level of five (91.4% correct calls). These results indicate that while increasing assay number can compensate somewhat for low assay MAF, high assay MAF is a very important parameter for reliable COI estimation at complexity levels greater than two.
Next, the performance of the COIL algorithm was evaluated on a collection of empirical genotype data from 21 clinical DNA samples obtained from patients infected with P. vivax in French Guiana. Plasmodium vivax infections have been increasing in prevalence in this region over the past ten years. Plasmodium vivax is distinct from P. falciparum in its capacity to remain latent in the liver and induce relapse infections weeks or months later, leading to the expectation that polygenomic infections could be more common even in relatively low transmission settings. Each sample was genotyped at 36 SNPs using an Illumina Eco platform, as described elsewhere [31]. Each sample was also previously genotyped for length polymorphisms at 15 microsatellite loci (Additional file 1), and COIL was run using previously determined MAF estimates for each assayed SNP (Additional file 2). Because microsatellite loci commonly harbour more than two segregating alleles, sample COI was evaluated as the maximum number of alleles observed at any single locus within the microsatellite panel. The microsatellite-based COI estimates and the SNP-based COI estimates produced with COIL were found to exhibit general concordance (Table 1).
Table 1
Concordance of SNP and microsatelitte-based COI estimates in 21 clinical Plasmodium vivax samples
Sample
SNP barcode
No. poly SNPs
SNP estimated COI [95% CI]
Max. posterior probability
MS estimated COI
No. poly MS
SNP/ MS agree?
L066
CGTCGTACAGACCCATCCATCCGCTGCACCACGTAA
0
1 [1,1]
1
1
0
Yes
L099
CGCTNCACNAACCTATCCAGNCANTGNNNCNAGTAC
8
2 [2,2]
0.9994
2
2
Yes
N121
CGTCGCGCGGACCTGTCCGTCCGCTACGCTGAACGC
0
1 [1,1]
1
1
0
Yes
N188
CGCCGTACGGACTTGTCCGTTCGTTGCGCTGAATAC
0
1 [1,1]
1
1
0
Yes
N257
NGNNNNANNNNCTCANNNNGNNNCNNNGCCAAGNNC
21
3 [3,5]
0.5813
3
7
Yes
N315
CGNNNNGTAAACNCATCCNGNCGCTACGCNNAGNAN
11
2 [2,2]
0.9881
2
2
Yes
N426
CGNTNNATNNNCNCATNNNNCTNNNNCGNNNAGCAN
19
3 [2,4]
0.6174
3
6
Yes
N464
CGTCGCACGGACTCACCTGTTCGCTGCGCCGAGCAC
0
1 [1,1]
1
1
0
Yes
N471
CTCCGTACGGACTTGTCCGTCCGCTGCGCCAAGTAC
0
1 [1,1]
1
1
0
Yes
M396
CNCCGTNCGGACCCANNCANCCNCTNCGCCNNGNNN
12
2 [2,2]
0.972
2
1
Yes
J073
CGCTGCATNNACCTGNCNNGTCNCNNCGCCAAGTAC
8
2 [2,2]
0.9989
2
3
Yes
J116
CGTCATGTAGGCCTACCTGGCCGCTGCGTCACGTAC
0
1 [1,1]
1
1
0
Yes
J244
CGTTATATGGACCTACCCAGCTGCCGCGCCAAATAC
0
1 [1,1]
1
1
0
Yes
J255
CGCCGTGCGGACTTGCCCGTTCATTGCGCCAAGTAC
0
1 [1,1]
1
1
0
Yes
J268
CGCTATACAAACCCATCCGTTCACTGTGCCACGCAC
0
1 [1,1]
1
1
0
Yes
L285
CGCCGTGCNGACTNGTCCGTCCGCTGCNCCAAGCNC
4
1 [1,2]
0.7197
2
3
Partial
J096
NGCNGNACGGACTTGCCCGTCCGTTGCGCTGAATAC
3
1 [1,1]
0.9988
2
2
No
L110
CNCCGTACNNANTTNNCCGTCNGTTGNGCTGAATAC
8
2 [2,2]
0.999
1
0
No
N427
CGCTATACGAACTTACCTATCTGCTGCGCCAAGCGC
0
1 [1,1]
1
2
1
No
N492
CGTCGCACAAGCTCGTCCGGTCGTTGCGCTGAGTAC
0
1 [1,1]
1
2
1
No
N524
CGNCGTNTNAACCCNCCNGGCTNCCANNCTAAGNNC
10
2 [2,2]
0.9989
3
5
No
M496
CGCTGCATAAACCCATCTAGTTACTGCGCCACGTAC
0
1 [1,1]
1
2
1
No
J249
CTCCGCACAAACTCGTCCGTCTACTACGCCGAGCAC
0
1 [1,1]
1
2
2
No
In 15 of 23 samples there was perfect agreement between the maximum a posteriori COIL estimate of COI and the maximum number of alleles observed at any microsatellite locus. In one case (sample L285) the maximum a posteriori COIL estimate was incorrect, but the 95% credibility interval captured the microsatellite-based COI estimate. The remaining seven cases of disagreement in COI estimates fall into three categories. In some cases COIL may underestimate COI as a result of over-tolerance for occasional SNP genotyping errors that render polymorphic calls from presumably monomorphic loci (e.g., sample N524, which exhibits ten polymorphic calls but is called as COI = 2 by COIL). In other cases, COIL may be correctly estimating COI, but the microsatellite data may be incorrectly indicating a higher COI level on the basis of a single locus yielding two or more alleles with similar lengths (Additional file 1; e.g., samples N427, N492). Resolution of two microsatellite alleles with a length difference of 10 bp or less could be subject to interpretation error, and the biallelic microsatellite results for samples N427 and N492 have not been confirmed by subcloning and sequencing or an alternate methodology. Finally, some cases of disagreement appear difficult to explain on the basis of simple genotyping error or algorithmic bias, and may result from legitimate discordance in the underlying biological signal between the SNP and microsatellite assays (e.g., samples J249, L110). For example, some complex infections may contain highly related parasite strains that exhibit a polymorphic signal only in limited genomic regions that were differentially covered by these small panels of SNP and microsatellite markers.
Following these validation experiments, COIL was applied to several additional collections of patient samples. First, genotype data were acquired from a recently published collection of Illumina Goldengate genotyping results for 96 SNPs assayed in a longitudinal collection of 1,731 P. falciparum samples from northwest Thailand. The authors of the original study observed a steady decline from 2001-2010 in the proportion of samples exhibiting polymorphic SNP calls (63 vs 14% in 2001 vs 2010), and noted that this signal was among the strongest genomic correlates of the decrease in disease incidence and transmission observed in the region during that time interval. When these data are translated into COI estimates the decline in disease incidence manifests as a very consistent change in the distribution of COI in the patient population (Figure 3). Approximately half of the patient samples in 2001 exhibited COI >1, and over 5% exhibited COI >2. By 2010, over 90% of patient samples exhibited COI = 1, and virtually all complex infections were COI = 2.
A comparable observation of longitudinal variation in the COI distribution over time can be made from SNP barcode data (Additional file 3) from P. falciparum samples collected in Senegal, using 24 SNPs genotyped with a high resolution melting (HRM) platform on 974 clinical samples collected between 2006 and 2012 [26], with MAF estimates derived from presumed singleton infections. The change in the distribution of COI exhibits less of a consistent temporal trend (Figure 4), possibly owing to lower baseline level of disease transmission. However, a clear decrease in the proportion of single infections is observable in 2007 and 2012 relative to other years, perhaps indicative of temporarily increased transmission rates during those intervals.

Discussion

Two assumptions of independence were made in the creation of the COIL algorithm: 1) independence of genotypes among barcode assays, and 2) independence of parasite lineages within complex infections. To evaluate the usefulness of COIL in situations where one or both of these assumptions may be violated, the consequences of departures from these assumptions were evaluated. The binomial distribution is the basis of COIL, and is key to understanding the consequences of departures from the assumptions. The binomial distribution is the result of n independent Bernoulli trials, each of which return a binary outcome. This is applied in two ways to the data: first, whether a genotype call at a particular assay is polymorphic, and secondly, in the distribution of alleles at a binary assay. If n independent Bernoulli trials are performed each with the probability of success p, the expected value of the resulting binomial distribution is np and the variance is np(1-p).
Because Bernoulli trials are by definition independent, correlation between the trials naturally results in a different distribution. The expected value is the same, but the variance changes. If X is a random variable that is the sum of n Bernoulli random variables X i each with probability of success p, where the i th and j th variables have correlation ρ ij , then the variance of X increases with ρ ij :
https://static-content.springer.com/image/art%3A10.1186%2F1475-2875-14-4/MediaObjects/12936_2014_3719_Equg_HTML.gif
This equation illustrates that increased genotypic correlation will cause an increased variance, resulting in more extreme values in the correlated binomial distribution. This notion will be revisited below.
The first assumption is that the assays within a particular barcode are independent. This may not be true if a particular sample exhibits high levels of LD. The effects of this can be minimized by genotyping loci that are physically distant in the genome (at least 10-100 kb for most parasite populations [29]) or that reside on different chromosomes. In a highly inbred population, however, even polymorphic loci on different chromosomes may exhibit significant LD, making it impossible to conform with the assumption of assay independence.
Violation of the independent-assay assumption will result in overdispersion of the binomial distribution, and as a result COIL will render more extreme COI estimates (see in silico simulations in Additional file 4). If one member in a pair of correlated assays returns a polymorphic call, then the other member of the pair is likely to be polymorphic as well. The converse is also true in the case of monomorphic calls. Thus, an infection that has a true COI of three will be more likely to yield a COI estimate of two or four. The net result is that the COI estimates for individual samples will be less accurate. However, these antagonistic effects cancel each other in large collections of samples, and therefore population estimates of COI distribution are predicted to be unbiased by violation of the assumption of assay independence. This underscores the value of using large sample sets for obtaining accurate COI estimates with COIL.
COIL’s second assumption is that the individual parasite lineages comprising complex infections are randomly chosen from the larger parasite population, exhibiting a degree of genomic similarity to each other comparable to that observable between any set of strains observed in single infections. If this assumption is violated (for example if strains within complex infections exhibit higher genomic similarity to each other than randomly chosen strains from single infections) COIL will naturally underestimate the COI for such complex infections (Additional file 4). Recent common ancestry will result in a higher incidence of monomorphic genotypes, and there is no balancing effect as in the assay non-independence example.
Several studies suggest that complex infections may be serially co-transmitted, resulting in increasing levels of genomic homogenization via multiple generations of inbreeding [9, 3234]. Over time, this process may yield complex infections composed of parasite strains exhibiting extremely high genomic similarity to each other. COIL is unequipped to reliably estimate COI in such situations, which may require single cell sequencing or genotyping approaches for precise disambiguation of highly similar genomic lineages.
A meristic measurement such as COI may be inappropriate for describing complex infections composed of highly similar parasite lineages, and that a continuous metric could better capture the complexity of such situations. In addition to discrete maximum a posteriori estimates, COIL provides a posterior distribution describing the uncertainty of the COI prediction, which may prove useful in detecting the presence of serially co-transmitted complex infections. The incidence of such infections and their relevance to predicting clinical outcome or understanding disease transmission dynamics remain to be thoroughly described, in part due to the current cost and technical complexity of single-cell genomic approaches.
This report demonstrates that the number of genetically unrelated parasite lineages in patient samples can be estimated inexpensively from SNP genotyping data, which can be derived from bulk genomic DNA extracted from a wide variety of clinical sample formats. The applications of such data for understanding disease etiology and epidemiology will multiply as the size and number of such datasets grow and yield new insights into parasite biology.

Conclusions

COI will be a useful parameter to estimate to judge the efficacy of early-stage malaria elimination campaigns. This manuscript demonstrates that SNP genotype data have the potential to yield accurate estimates of COI, especially in cases where at least 96 SNPs are assayed and most SNPs exhibit a high MAF in the studied population. The COIL program is available for download from GitHub [1], and users may also upload their SNP genotype data to a web interface [2] for simple and efficient determination of sample COI.

Acknowledgements

This work was supported in part by the Bill and Melinda Gates Foundation.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
The Creative Commons Public Domain Dedication waiver (https://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

KG and DEN conceived the approach. KG performed the analyses and wrote the software. CV, PCS, RD, DLH, DFW, SKV, and DEN wrote the manuscript. AS, BdT, and LM generated the microsatellite data and contributed the French Guiana P. vivax samples. AF and MLB generated and analysed the SNP genotype data for the French Guiana samples. DN and RFD contributed the Senegal samples and generated the data. All authors read and approved the final manuscript.
Literatur
3.
Zurück zum Zitat Smith T, Beck HP, Kitua A, Mwankusye S, Felger I, Fraser-Hurt N, Irion A, Alonso P, Teuscher T, Tanner M: Age dependence of the multiplicity of Plasmodium falciparum infections and of other malariological indices in an area of high endemicity. Trans R Soc Trop Med Hyg 1999,93(Suppl 1):15–20.CrossRefPubMed Smith T, Beck HP, Kitua A, Mwankusye S, Felger I, Fraser-Hurt N, Irion A, Alonso P, Teuscher T, Tanner M: Age dependence of the multiplicity of Plasmodium falciparum infections and of other malariological indices in an area of high endemicity. Trans R Soc Trop Med Hyg 1999,93(Suppl 1):15–20.CrossRefPubMed
4.
Zurück zum Zitat Felger I, Smith T, Edoh D, Kitua A, Alonso P, Tanner M, Beck HP: Multiple Plasmodium falciparum infections in Tanzanian infants. Trans R Soc Trop Med Hyg 1999,93(Suppl 1):29–34.CrossRefPubMed Felger I, Smith T, Edoh D, Kitua A, Alonso P, Tanner M, Beck HP: Multiple Plasmodium falciparum infections in Tanzanian infants. Trans R Soc Trop Med Hyg 1999,93(Suppl 1):29–34.CrossRefPubMed
5.
Zurück zum Zitat Guerra-Neira A, Rubio JM, Royo JR, Ortega JC, Auñón AS, Diaz PB, Llanes AB: Plasmodium diversity in non-malaria individuals from the Bioko Island in Equatorial Guinea (West Central-Africa). Int J Health Geogr 2006, 5:27. 10.1186/1476-072X-5-27CrossRefPubMedCentralPubMed Guerra-Neira A, Rubio JM, Royo JR, Ortega JC, Auñón AS, Diaz PB, Llanes AB: Plasmodium diversity in non-malaria individuals from the Bioko Island in Equatorial Guinea (West Central-Africa). Int J Health Geogr 2006, 5:27. 10.1186/1476-072X-5-27CrossRefPubMedCentralPubMed
6.
Zurück zum Zitat Ntoumi F, Contamin H, Rogier C, Bonnefoy S, Trape JF, Mercereau-Puijalon O: Age-dependent carriage of multiple Plasmodium falciparum merozoite surface antigen-2 alleles in asymptomatic malaria infections. Am J Trop Med Hyg 1995, 52:81–8.PubMed Ntoumi F, Contamin H, Rogier C, Bonnefoy S, Trape JF, Mercereau-Puijalon O: Age-dependent carriage of multiple Plasmodium falciparum merozoite surface antigen-2 alleles in asymptomatic malaria infections. Am J Trop Med Hyg 1995, 52:81–8.PubMed
7.
Zurück zum Zitat Beck HP, Felger I, Huber W, Steiger S, Smith T, Weiss N, Alonso P, Tanner M: Analysis of multiple Plasmodium falciparum infections in Tanzanian children during the phase III trial of the malaria vaccine SPf66. J Infect Dis 1997, 175:921–6. 10.1086/513991CrossRefPubMed Beck HP, Felger I, Huber W, Steiger S, Smith T, Weiss N, Alonso P, Tanner M: Analysis of multiple Plasmodium falciparum infections in Tanzanian children during the phase III trial of the malaria vaccine SPf66. J Infect Dis 1997, 175:921–6. 10.1086/513991CrossRefPubMed
8.
Zurück zum Zitat Enosse S, Dobaño C, Quelhas D, Aponte JJ, Lievens M, Leach A, Sacarlal J, Greenwood B, Milman J, Dubovsky F, Cohen J, Thompson R, Ballou WR, Alonso PL, Conway DJ, Sutherland CJ: RTS, S/AS02A malaria vaccine does not induce parasite CSP T cell epitope selection and reduces multiplicity of infection. PLoS Clin Trials 2006, 1:e5. 10.1371/journal.pctr.0010005CrossRefPubMedCentralPubMed Enosse S, Dobaño C, Quelhas D, Aponte JJ, Lievens M, Leach A, Sacarlal J, Greenwood B, Milman J, Dubovsky F, Cohen J, Thompson R, Ballou WR, Alonso PL, Conway DJ, Sutherland CJ: RTS, S/AS02A malaria vaccine does not induce parasite CSP T cell epitope selection and reduces multiplicity of infection. PLoS Clin Trials 2006, 1:e5. 10.1371/journal.pctr.0010005CrossRefPubMedCentralPubMed
9.
Zurück zum Zitat Branch OH, Takala S, Kariuki S, Nahlen BL, Kolczak M, Hawley W, Lal AA: Plasmodium falciparum genotypes, low complexity of infection, and resistance to subsequent malaria in participants in the Asembo Bay Cohort Project. Infect Immun 2001, 69:7783–92. 10.1128/IAI.69.12.7783-7792.2001CrossRefPubMedCentralPubMed Branch OH, Takala S, Kariuki S, Nahlen BL, Kolczak M, Hawley W, Lal AA: Plasmodium falciparum genotypes, low complexity of infection, and resistance to subsequent malaria in participants in the Asembo Bay Cohort Project. Infect Immun 2001, 69:7783–92. 10.1128/IAI.69.12.7783-7792.2001CrossRefPubMedCentralPubMed
10.
Zurück zum Zitat Ofosu-Okyere A, Mackinnon MJ, Sowa MP, Koram KA, Nkrumah F, Osei YD, Hill WG, Wilson MD, Arnot DE: Novel Plasmodium falciparum clones and rising clone multiplicities are associated with the increase in malaria morbidity in Ghanaian children during the transition into the high transmission season. Parasitology 2001,123(Pt 2):113–23.PubMed Ofosu-Okyere A, Mackinnon MJ, Sowa MP, Koram KA, Nkrumah F, Osei YD, Hill WG, Wilson MD, Arnot DE: Novel Plasmodium falciparum clones and rising clone multiplicities are associated with the increase in malaria morbidity in Ghanaian children during the transition into the high transmission season. Parasitology 2001,123(Pt 2):113–23.PubMed
11.
Zurück zum Zitat Al-Yaman F, Genton B, Reeder JC, Anders RF, Smith T, Alpers MP: Reduced risk of clinical malaria in children infected with multiple clones of Plasmodium falciparum in a highly endemic area: a prospective community study. Trans R Soc Trop Med Hyg 1997, 91:602–5. 10.1016/S0035-9203(97)90046-8CrossRefPubMed Al-Yaman F, Genton B, Reeder JC, Anders RF, Smith T, Alpers MP: Reduced risk of clinical malaria in children infected with multiple clones of Plasmodium falciparum in a highly endemic area: a prospective community study. Trans R Soc Trop Med Hyg 1997, 91:602–5. 10.1016/S0035-9203(97)90046-8CrossRefPubMed
12.
Zurück zum Zitat Färnert A, Rooth I, Svensson , Snounou G, Björkman A: Complexity of Plasmodium falciparum infections is consistent over time and protects against clinical disease in Tanzanian children. J Infect Dis 1999, 179:989–95. 10.1086/314652CrossRefPubMed Färnert A, Rooth I, Svensson , Snounou G, Björkman A: Complexity of Plasmodium falciparum infections is consistent over time and protects against clinical disease in Tanzanian children. J Infect Dis 1999, 179:989–95. 10.1086/314652CrossRefPubMed
13.
Zurück zum Zitat Müller DA, Charlwood JD, Felger I, Ferreira C, Do Rosario V, Smith T: Prospective risk of morbidity in relation to multiplicity of infection with Plasmodium falciparum in São Tomé. Acta Trop 2001, 78:155–62. 10.1016/S0001-706X(01)00067-5CrossRefPubMed Müller DA, Charlwood JD, Felger I, Ferreira C, Do Rosario V, Smith T: Prospective risk of morbidity in relation to multiplicity of infection with Plasmodium falciparum in São Tomé. Acta Trop 2001, 78:155–62. 10.1016/S0001-706X(01)00067-5CrossRefPubMed
14.
Zurück zum Zitat Kiwuwa MS, Ribacke U, Moll K, Byarugaba J, Lundblom K, Färnert A, Fred K, Wahlgren M: Genetic diversity of Plasmodium falciparum infections in mild and severe malaria of children from Kampala, Uganda. Parasitol Res 2013, 112:1691–700. 10.1007/s00436-013-3325-3CrossRefPubMedCentralPubMed Kiwuwa MS, Ribacke U, Moll K, Byarugaba J, Lundblom K, Färnert A, Fred K, Wahlgren M: Genetic diversity of Plasmodium falciparum infections in mild and severe malaria of children from Kampala, Uganda. Parasitol Res 2013, 112:1691–700. 10.1007/s00436-013-3325-3CrossRefPubMedCentralPubMed
15.
Zurück zum Zitat Vafa M, Troye-Blomberg M, Anchang J, Garcia A, Migot-Nabias F: Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants. Malar J 2008, 7:17. 10.1186/1475-2875-7-17CrossRefPubMedCentralPubMed Vafa M, Troye-Blomberg M, Anchang J, Garcia A, Migot-Nabias F: Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants. Malar J 2008, 7:17. 10.1186/1475-2875-7-17CrossRefPubMedCentralPubMed
16.
Zurück zum Zitat Arnot D: Unstable malaria in Sudan: the influence of the dry season. Clone multiplicity of Plasmodium falciparum infections in individuals exposed to variable levels of disease transmission. Trans R Soc Trop Med Hyg 1998, 92:580–5. 10.1016/S0035-9203(98)90773-8CrossRefPubMed Arnot D: Unstable malaria in Sudan: the influence of the dry season. Clone multiplicity of Plasmodium falciparum infections in individuals exposed to variable levels of disease transmission. Trans R Soc Trop Med Hyg 1998, 92:580–5. 10.1016/S0035-9203(98)90773-8CrossRefPubMed
17.
Zurück zum Zitat Babiker HA: Unstable malaria in Sudan: the influence of the dry season. Plasmodium falciparum population in the unstable malaria area of eastern Sudan is stable and genetically complex. Trans R Soc Trop Med Hyg 1998, 92:585–9. 10.1016/S0035-9203(98)90774-XCrossRefPubMed Babiker HA: Unstable malaria in Sudan: the influence of the dry season. Plasmodium falciparum population in the unstable malaria area of eastern Sudan is stable and genetically complex. Trans R Soc Trop Med Hyg 1998, 92:585–9. 10.1016/S0035-9203(98)90774-XCrossRefPubMed
18.
Zurück zum Zitat Nkhoma SC, Nair S, Al-Saai S, Ashley E, McGready R, Phyo AP, Nosten F, Anderson TJ: Population genetic correlates of declining transmission in a human pathogen. Mol Ecol 2013, 22:273–85. 10.1111/mec.12099CrossRefPubMedCentralPubMed Nkhoma SC, Nair S, Al-Saai S, Ashley E, McGready R, Phyo AP, Nosten F, Anderson TJ: Population genetic correlates of declining transmission in a human pathogen. Mol Ecol 2013, 22:273–85. 10.1111/mec.12099CrossRefPubMedCentralPubMed
19.
Zurück zum Zitat Tanabe K, Sakihama N, Kaneko O, Saito-Ito A, Kimura M: A PCR method for molecular epidemiology of Plasmodium falciparum Msp-1. Tokai J Exp Clin Med 1998, 23:375–81.PubMed Tanabe K, Sakihama N, Kaneko O, Saito-Ito A, Kimura M: A PCR method for molecular epidemiology of Plasmodium falciparum Msp-1. Tokai J Exp Clin Med 1998, 23:375–81.PubMed
20.
Zurück zum Zitat Contamin H, Fandeur T, Bonnefoy S, Skouri F, Ntoumi F, Mercereau-Puijalon O: PCR typing of field isolates of Plasmodium falciparum. J Clin Microbiol 1995, 33:944–51.PubMedCentralPubMed Contamin H, Fandeur T, Bonnefoy S, Skouri F, Ntoumi F, Mercereau-Puijalon O: PCR typing of field isolates of Plasmodium falciparum. J Clin Microbiol 1995, 33:944–51.PubMedCentralPubMed
21.
Zurück zum Zitat Hill WG, Babiker HA: Estimation of numbers of malaria clones in blood samples. Proc Biol Sci 1995, 262:249–57. 10.1098/rspb.1995.0203CrossRefPubMed Hill WG, Babiker HA: Estimation of numbers of malaria clones in blood samples. Proc Biol Sci 1995, 262:249–57. 10.1098/rspb.1995.0203CrossRefPubMed
22.
Zurück zum Zitat Auburn S, Campino S, Miotto O, Djimde AA, Zongo I, Manske M, Maslen G, Mangano V, Alcock D, MacInnis B, Rockett KA, Clark TG, Doumbo OK, Ouédraogo JB, Kwiatkowski DP: Characterization of within-host Plasmodium falciparum diversity using next-generation sequence data. PLoS One 2012, 7:e32891. 10.1371/journal.pone.0032891CrossRefPubMedCentralPubMed Auburn S, Campino S, Miotto O, Djimde AA, Zongo I, Manske M, Maslen G, Mangano V, Alcock D, MacInnis B, Rockett KA, Clark TG, Doumbo OK, Ouédraogo JB, Kwiatkowski DP: Characterization of within-host Plasmodium falciparum diversity using next-generation sequence data. PLoS One 2012, 7:e32891. 10.1371/journal.pone.0032891CrossRefPubMedCentralPubMed
23.
Zurück zum Zitat Assefa SA, Preston MD, Campino S, Ocholla H, Sutherland CJ, Clark TG: estMOI: estimating multiplicity of infection using parasite deep sequencing data. Bioinformatics 2014, 30:1292–4. 10.1093/bioinformatics/btu005CrossRefPubMedCentralPubMed Assefa SA, Preston MD, Campino S, Ocholla H, Sutherland CJ, Clark TG: estMOI: estimating multiplicity of infection using parasite deep sequencing data. Bioinformatics 2014, 30:1292–4. 10.1093/bioinformatics/btu005CrossRefPubMedCentralPubMed
24.
Zurück zum Zitat Daniels R, Volkman SK, Milner DA, Mahesh N, Neafsey DE, Park DJ, Rosen D, Angelino E, Sabeti PC, Wirth DF, Wiegand RC: A general SNP-based molecular barcode for Plasmodium falciparum identification and tracking. Malar J 2008, 7:223. 10.1186/1475-2875-7-223CrossRefPubMedCentralPubMed Daniels R, Volkman SK, Milner DA, Mahesh N, Neafsey DE, Park DJ, Rosen D, Angelino E, Sabeti PC, Wirth DF, Wiegand RC: A general SNP-based molecular barcode for Plasmodium falciparum identification and tracking. Malar J 2008, 7:223. 10.1186/1475-2875-7-223CrossRefPubMedCentralPubMed
25.
Zurück zum Zitat Echeverry DF, Nair S, Osorio L, Menon S, Murillo C, Anderson TJC: Long term persistence of clonal malaria parasite Plasmodium falciparum lineages in the Colombian Pacific region. BMC Genet 2013, 14:2.CrossRefPubMedCentralPubMed Echeverry DF, Nair S, Osorio L, Menon S, Murillo C, Anderson TJC: Long term persistence of clonal malaria parasite Plasmodium falciparum lineages in the Colombian Pacific region. BMC Genet 2013, 14:2.CrossRefPubMedCentralPubMed
26.
Zurück zum Zitat Daniels R, Chang H-H, Séne PD, Park DC, Neafsey DE, Schaffner SF, Hamilton EJ, Lukens AK, Van Tyne D, Mboup S, Sabeti PC, Ndiaye D, Wirth DF, Hartl DL, Volkman SK: Genetic surveillance detects both clonal and epidemic transmission of malaria following enhanced intervention in Senegal. PLoS One 2013, 8:e60780. 10.1371/journal.pone.0060780CrossRefPubMedCentralPubMed Daniels R, Chang H-H, Séne PD, Park DC, Neafsey DE, Schaffner SF, Hamilton EJ, Lukens AK, Van Tyne D, Mboup S, Sabeti PC, Ndiaye D, Wirth DF, Hartl DL, Volkman SK: Genetic surveillance detects both clonal and epidemic transmission of malaria following enhanced intervention in Senegal. PLoS One 2013, 8:e60780. 10.1371/journal.pone.0060780CrossRefPubMedCentralPubMed
27.
Zurück zum Zitat Campino S, Auburn S, Kivinen K, Zongo I, Ouedraogo J-B, Mangano V, Djimde A, Doumbo OK, Kiara SM, Nzila A, Borrmann S, Marsh K, Michon P, Mueller I, Siba P, Jiang H, Su X-Z, Amaratunga C, Socheat D, Fairhurst RM, Imwong M, Anderson T, Nosten F, White NJ, Gwilliam R, Deloukas P, Macinnis B, Newbold CI, Rockett K, Clark TG, Kwiatkowski D: Population genetic analysis of Plasmodium falciparum parasites using a customized Illumina GoldenGate genotyping assay. PLoS One 2011, 6:e20251. 10.1371/journal.pone.0020251CrossRefPubMedCentralPubMed Campino S, Auburn S, Kivinen K, Zongo I, Ouedraogo J-B, Mangano V, Djimde A, Doumbo OK, Kiara SM, Nzila A, Borrmann S, Marsh K, Michon P, Mueller I, Siba P, Jiang H, Su X-Z, Amaratunga C, Socheat D, Fairhurst RM, Imwong M, Anderson T, Nosten F, White NJ, Gwilliam R, Deloukas P, Macinnis B, Newbold CI, Rockett K, Clark TG, Kwiatkowski D: Population genetic analysis of Plasmodium falciparum parasites using a customized Illumina GoldenGate genotyping assay. PLoS One 2011, 6:e20251. 10.1371/journal.pone.0020251CrossRefPubMedCentralPubMed
28.
Zurück zum Zitat Preston MD, Campino S, Assefa SA, Echeverry DF, Ocholla H, Amambua-Ngwa A, Stewart LB, Conway DJ, Borrmann S, Michon P, Zongo I, Ouédraogo J-B, Djimde AA, Doumbo OK, Nosten F, Pain A, Bousema T, Drakeley CJ, Fairhurst RM, Sutherland CJ, Roper C, Clark TG: A barcode of organellar genome polymorphisms identifies the geographic origin of Plasmodium falciparum strains. Nat Commun 2014, 5:4052.CrossRefPubMedCentralPubMed Preston MD, Campino S, Assefa SA, Echeverry DF, Ocholla H, Amambua-Ngwa A, Stewart LB, Conway DJ, Borrmann S, Michon P, Zongo I, Ouédraogo J-B, Djimde AA, Doumbo OK, Nosten F, Pain A, Bousema T, Drakeley CJ, Fairhurst RM, Sutherland CJ, Roper C, Clark TG: A barcode of organellar genome polymorphisms identifies the geographic origin of Plasmodium falciparum strains. Nat Commun 2014, 5:4052.CrossRefPubMedCentralPubMed
29.
Zurück zum Zitat Volkman SK, Sabeti PC, DeCaprio D, Neafsey DE, Schaffner SF, Milner DA, Daily JP, Sarr O, Ndiaye D, Ndir O, Mboup S, Duraisingh MT, Lukens A, Derr A, Stange-Thomann N, Waggoner S, Onofrio R, Ziaugra L, Mauceli E, Gnerre S, Jaffe DB, Zainoun J, Wiegand RC, Birren BW, Hartl DL, Galagan JE, Lander ES, Wirth DF: A genome-wide map of diversity in Plasmodium falciparum . Nat Genet 2007, 39:113–9. 10.1038/ng1930CrossRefPubMed Volkman SK, Sabeti PC, DeCaprio D, Neafsey DE, Schaffner SF, Milner DA, Daily JP, Sarr O, Ndiaye D, Ndir O, Mboup S, Duraisingh MT, Lukens A, Derr A, Stange-Thomann N, Waggoner S, Onofrio R, Ziaugra L, Mauceli E, Gnerre S, Jaffe DB, Zainoun J, Wiegand RC, Birren BW, Hartl DL, Galagan JE, Lander ES, Wirth DF: A genome-wide map of diversity in Plasmodium falciparum . Nat Genet 2007, 39:113–9. 10.1038/ng1930CrossRefPubMed
30.
Zurück zum Zitat Orjuela-Sánchez P, Karunaweera ND, da Silva-Nunes M, da Silva NS, Scopel KKG, Gonçalves RM, Amaratunga C, Sá JM, Socheat D, Fairhust RM, Gunawardena S, Thavakodirasah T, Galapaththy GLN, Abeysinghe R, Kawamoto F, Wirth DF, Ferreira MU: Single-nucleotide polymorphism, linkage disequilibrium and geographic structure in the malaria parasite Plasmodium vivax : prospects for genome-wide association studies. BMC Genet 2010, 11:65.CrossRefPubMedCentralPubMed Orjuela-Sánchez P, Karunaweera ND, da Silva-Nunes M, da Silva NS, Scopel KKG, Gonçalves RM, Amaratunga C, Sá JM, Socheat D, Fairhust RM, Gunawardena S, Thavakodirasah T, Galapaththy GLN, Abeysinghe R, Kawamoto F, Wirth DF, Ferreira MU: Single-nucleotide polymorphism, linkage disequilibrium and geographic structure in the malaria parasite Plasmodium vivax : prospects for genome-wide association studies. BMC Genet 2010, 11:65.CrossRefPubMedCentralPubMed
32.
Zurück zum Zitat Druilhe P, Daubersies P, Patarapotikul J, Gentil C, Chene L, Chongsuphajaisiddhi T, Mellouk S, Langsley G: A primary malarial infection is composed of a very wide range of genetically diverse but related parasites. J Clin Invest 1998, 101:2008–16. 10.1172/JCI119890CrossRefPubMedCentralPubMed Druilhe P, Daubersies P, Patarapotikul J, Gentil C, Chene L, Chongsuphajaisiddhi T, Mellouk S, Langsley G: A primary malarial infection is composed of a very wide range of genetically diverse but related parasites. J Clin Invest 1998, 101:2008–16. 10.1172/JCI119890CrossRefPubMedCentralPubMed
33.
Zurück zum Zitat Nkhoma SC, Nair S, Cheeseman IH, Rohr-Allegrini C, Singlam S, Nosten F, Anderson TJC: Close kinship within multiple-genotype malaria parasite infections. Proc Biol Sci 2012. Nkhoma SC, Nair S, Cheeseman IH, Rohr-Allegrini C, Singlam S, Nosten F, Anderson TJC: Close kinship within multiple-genotype malaria parasite infections. Proc Biol Sci 2012.
34.
Zurück zum Zitat Nair S, Nkhoma SC, Serre D, Zimmerman PA, Gorena K, Daniel BJ, Nosten F, Anderson TJC, Cheeseman IH: Single-cell genomics for dissection of complex malaria infections. Genome Res 2014, 24:1028–38. 10.1101/gr.168286.113CrossRefPubMedCentralPubMed Nair S, Nkhoma SC, Serre D, Zimmerman PA, Gorena K, Daniel BJ, Nosten F, Anderson TJC, Cheeseman IH: Single-cell genomics for dissection of complex malaria infections. Genome Res 2014, 24:1028–38. 10.1101/gr.168286.113CrossRefPubMedCentralPubMed
Metadaten
Titel
COIL: a methodology for evaluating malarial complexity of infection using likelihood from single nucleotide polymorphism data
verfasst von
Kevin Galinsky
Clarissa Valim
Arielle Salmier
Benoit de Thoisy
Lise Musset
Eric Legrand
Aubrey Faust
Mary Lynn Baniecki
Daouda Ndiaye
Rachel F Daniels
Daniel L Hartl
Pardis C Sabeti
Dyann F Wirth
Sarah K Volkman
Daniel E Neafsey
Publikationsdatum
01.12.2015
Verlag
BioMed Central
Erschienen in
Malaria Journal / Ausgabe 1/2015
Elektronische ISSN: 1475-2875
DOI
https://doi.org/10.1186/1475-2875-14-4

Weitere Artikel der Ausgabe 1/2015

Malaria Journal 1/2015 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.