Background
The Ser/Thr kinase LIMK1, originally characterized within the central nervous system, serves to regulate actin cytoskeletal dynamics by phosphorylation and inactivation of cofilin [
1,
2]. The kinase domain of LIMK1 is activated via phosphorylation at Thr 508 [
3]. This phosphorylation can be mediated by myotonic dystrophy kinase-related Cdc42-binding kinase alpha (MRCKα), Rho-associated coiled-coil domain kinase (ROCK) and p21-activated kinase (PAK), acting downstream of Rho/Rac/Cdc42 signaling [
3‐
6]. The substrates for LIMK1 are members of the actin depolymerizing factor (ADF) and cofilin family, commonly referred to collectively as cofilin. Serine-3 phosphorylation of cofilin by LIMK1 results in inactivation of cofilin and a subsequent stabilization of actin filaments in the region of LIM kinase activity [
1,
7]. Opposing the activity of LIM kinase on coflilin are a family of phosphatases, slingshot (SSH) and chronophin (CIN) [
8,
9]. Activated LIMK1 contributes to formation of key actin structures, such as membrane protrusions, stress fibers, and the contractile ring that forms during cytokinesis [
3,
6,
10,
11]. Further, the dynamic assembly and disassembly of actin in membrane structures, such as lamellipodia and filopodia, regulated in part by LIMK1, has been postulated to be the basis for LIMK1-mediated cell motility, and an integral component of LIMK1-mediated cell invasion [
12‐
14].
Structurally, the LIMK1 protein is composed of two N-terminal LIM domains, a central PDZ domain, and a C-terminal kinase domain [
15]. Within the PDZ domain, there are two functional nuclear export signals (NES), as well as one nuclear localization signal (NLS) within the kinase domain [
15]. The leucine-rich NES sequences are sensitive to inhibition by leptomycin B, as addition of leptomycin B results in nuclear accumulation of LIMK1 within cells that otherwise express predominantly cytoplamic LIMK1. Predictably, deletion of the NLS from the kinase domain abrogates this effect [
15]. Immunohistochemical studies in cultured mammalian cell lines, as well as paraformaldehyde (PFA)-fixed mammalian tissues, indicate that the subcellular compartmentalization of LIMK1 within cells is generally cytoplasmic, although many cell types express moderate to strong nuclear LIMK1, in addition to the cytoplasmic component [
16]. Although it is clear that LIMK1 protein is expressed in both the cytoplasm and nucleus, the majority of LIMK1 studies have focused on the role of LIMK1 in regulating actin dynamics within the cytoplasm.
Functional studies have found that increasing LIMK1 expression in human breast cancer cell lines results in increased cellular invasion and xenograft tumor growth [
13,
17]. For example, over-expression of LIMK1 in MDA-MB-231, MCF-7 and MDA-MB-435 human breast cancer cell lines resulted in increased cellular migration and invasion through Matrigel [
13,
17]. In contrast, inhibiting LIMK1 expression, or blocking LIMK1 activity, reduced the aggressive behavior of human MDA-MB-231 and MDA-MB-435 breast cancer cell lines [
13,
17]. For example, expression of dominant-negative LIMK1 in breast cancer cell lines resulted in suppression of matrigel invasion
in vitro, and inhibition of liver, lung and bone metastasis
in vivo[
13,
17]. Pharmacological inhibition of upstream regulators of LIMK1, co-expression of nischarin (a protein that specifically binds to and inhibits LIMK1), or RNAi-mediated knockdown of LIMK1, all block LIMK1-mediated cellular invasion [
18]. Finally, tumor xenograft assays in female nude mice injected with MDA-MB-435 cells over-expressing LIMK1 resulted in tumors that were larger, more vascularized, and more likely to metastasize to the liver and lungs, compared to controls [
17].
Despite these advances in our understanding of LIMK1 functions, several key questions remain regarding the ability of LIMK1 to promote cancer progression. In this regard, one of the most intriguing questions is whether the subcellular localization, cytoplasmic versus nuclear, of LIMK1 affects its ability to promote the transformed phenotype. For example, an immunohistochemical (IHC) study in prostate cancer found an association between the amount of nuclear LIMK1, higher Gleason scores, and incidence of metastasis [
19], suggesting that nuclear LIMK1 may contribute to progression of human cancer. In this study, we sought to determine whether cytoplasmic and/or nuclear LIMK1 localization has a pro-tumorigenic activity in breast cancer cells. Thus, we first performed IHC analysis of LIMK1 expression in normal and malignant human breast specimens and found that LIMK1 expression is increased in both subcellular compartments in human breast cancer, with nuclear levels being highest in those tumors displaying strong cytoplasmic staining. Having demonstrated that LIMK1 can be expressed both cytoplasmically and nuclearly in human breast cancers, we next developed a model system to segregate GFP-tagged LIMK1 to the cytoplasm or the nucleus in MDA-MB-231 breast cancer cells. Using this model, we found that both cytoplasmically-targeted NES-GFP-LIMK1 and nuclearly-targeted NLS-GFP-LIMK1 increased phosphorylation of cofilin, FAK, paxillin, AKT and Erk1/2, both increased cellular invasion, and both enhanced xenograft tumor growth in nude mice. In sum, these studies reveal that LIMK1 has important cytoplasmic and nuclear functions that contribute to breast cancer progression.
Methods
Cell lines and cell culture
MDA-MB-231 cells, originally obtained from ATCC, were a kind gift from Dr. Rytis Prekeris, University of Colorado. MDA-MB-231 cells were cultured in high glucose (4.5 g/l), DMEM medium (Invitrogen #11965) supplemented with 15% horse serum (Invitrogen #16050-122), 2.5% fetal bovine serum (FBS, Invitrogen #16000-044) and non-essential amino-acids (Invitrogen #11140-050). Cells were passaged with trypsin three times a week.
Plasmid constructs
The Bgl II -Sac II LIMK1 cDNA fragment (without the start AUG codon) was excised from FPC-1-myc LIMK1 (kind gift from Dr. K Mizuno, Tohoku University, Japan) and ligated into Bgl II -Sac II -cut pEGFP-C1 plasmid DNA (Invitrogen Inc., Carlsbad, CA), in-frame and downstream of EGFP, to produce pEGFP-C1-LIMK1. Generation of NES- and NLS-tagged GFP-LIMK1 in the pQCXIN retroviral vector (Clonetech, Inc) was achieved by using oligonucleotides encompassing a Kozak recognition sequence, an AUG start codon (underlined below) and either two NLS or NES sequences, and fusing these oligonucleotides in-frame to amino-terminus of EGFP-C1-LIMK1 template by PCR.
Primers used to generate NLS-GFP-LIMK1:
NLS: 5'-ATTAACCGGTACCATG GCGCCAAAGAAGAAGAGAAAAGTGAGCGGCG GCAGCCCAAAGAAGAAGAGAAAAGTGGTGAGCAAGGGCGAG
LIMK1 Reverse: 5'- TATATTAATTAATGATCAGTTATCTAGATCCG
Primers used to generate NES-GFP-LIMK1:
NES: 5'-ATTAACCGGTACCATG GCGTTAGCACTTAAATTAGCTGGTTTGGACATAG GCGGCTTAGCACTTAAATTAGCTGGTTTGGACATAGTGAGCAAGGGCGAG
LIMK1 reverse: 5'- TATATTAATTAATGATCAGTTATCTAGATCCG
The PCR products and GFP-LIMK1 fragment were then ligated in the Age I -Pac I -cut pQCXIN plasmid. The coding sequence for all NLS-GFP-LIMK1, NES-GFP-LMIK1 and GFP-LIMK1 constructs was verified by dideoxy sequencing in the UC Denver Cancer Center DNA Sequencing Core facility.
Transduction and generation of stable cell pools
Phoenix™ cells (a kind gift from Dr. Heide Ford, UC Denver) were used to package pQCXIN-based retroviruses. For retrovirus production, packaging cells were cultured on 10 cm gelatin-coated plates in 10 ml of DMEM medium supplemented with 10% FBS. Transfection with Effectene (Qiagen #301425) was conducted with 10 μg of retroviral DNA in 80 μl of Enhancer reagent plus 150 μl of Effectene reagent, following the manufacturer's protocol. Virus-containing supernatant was collected at 48 h and 72 h time points, filtered through 0.45 μm syringe filter, aliquoted and stored at -80°C. To infect MDA-MB-231 cells, virus-containing supernatant was diluted in growth medium 1:3, supplemented with polybrene (8 ug/ml) (Sigma cat#107689), and incubated on the target cells. After overnight incubation with the viral supernatant, medium was changed to fresh culture medium. Pools of MDA-MB-231 cells stably-expressing GFP-LIMK1 fusions were selected with G-418 (Invitrogen cat#11811-023). Expression of EGPF from the EGFP-tagged LIMK1 was detected by fluorescence microscopy 48 h-72 h post-infection.
IHC analysis
For IHC analysis, antigen retrieval was performed by soaking slides in sodium citrate (10 mM solution in phosphate-buffered saline containing 0.1% Tween-20 (PBST), pH 6.0) (Fisher #S279-3) and heating to 120°C for 5 minutes in a decloaker (Biocare Medical). Endogenous peroxidases were blocked by placing slides in 0.3% hydrogen peroxide (Fisherbrand) for 0.5 h, and washed in deionized water. Slides were then washed with PBST (0.1%Tween) and blocked with 10% goat serum for 1 hour. All IHCs were performed using a goat polyclonal antibody that specifically recognizes the C-terminus of LIMK1 [
20,
21] Primary anti-LIMK1 goat antibody (Santa Cruz #sc8387) diluted 1:100 in the blocking buffer was incubated on samples at 4°C overnight. The slides were then washed in blocking buffer and incubated for 1 h with biotinylated anti-goat IgG secondary antibodies (Jackson Immunoresearch) diluted 1:200 in blocking buffer. All IHC slides were incubated with avidin-biotinylated-horse radish peroxidase (HRP) complexes (Vectastain ABC kit, Vector Laboratories) for 0.5 h, according to the manufacturer's protocol. The antigen-antibody complex was then visualized by a 5-minute treatment with the DAB Plus peroxidase substrate (3,3' diaminobenzidine, Dako Cytomation, # K3468), according to the manufacturer's instructions. Nuclei were visualized with Mayer's hematoxylin (Fisher, 1:10 dilution in water, 30 sec). For mounting, the sections were rinsed in water, dehydrated in graded ethanol (90% ethanol, 3 × 30 sec, 100% ethanol 3 × 30 sec), cleared in xylene (2 × 30 sec), and sealed using Permount (Fisher #SP15-100).
Western Blots
MDA-MB-231 cell pools stably expressing GFP-LIMK1 fusions were grown in high glucose, DMEM medium supplemented with 15% horse serum, 2.5% fetal bovine serum and non-essential amino-acids, except for lysates prepared for phospho-Erk1/2 and phospho-AKT analysis, which were prepared from cells serum-starved for 24 hours prior to cell harvesting. Cells were washed with cold PBS and lysed on ice in either CHAPS lysis buffer, extraction buffer (EB), or Laemmli Sample buffer (Bio-Rad #161-0737). CHAPs lysis buffer consists of 10 mM CHAPS (Sigma #C926), 50 mM Tris (pH 8.0), 150 mM NaCL, and 2 mM EDTA with 10 μM sodium orthovanadate (Sigma #S6508). EB lysis buffer consists of 10 mM Tris (pH 7.4), 5 mM EDTA, 50 mM NaCl, 1%Triton X100 (Sigma #T9284), and 1 mM DL-Dithiothreitol (DTT) (Sigma #D9779). For lysis with separation of nuclear and cytoplasmic components, 1 × 106 cells of each cell type were lysed with Pierce NE-PER Nuclear and Cytoplasmic Extraction Reagents. Subcellular fractionation was performed per manufacturer's instructions (Pierce #78833). All lysis buffers were supplemented with Complete protease inhibitor cocktail (Roche #12656900) and PhosSTOP phosphatase inhibitor cocktail (Roche #04906845001), per manufacturer's instructions. Protein concentration was determined using the Bio-Rad DC Protein Assay kit (#500-0116). Total protein (25-100 μg) from each lysate was subjected to sodium dodecyl sulfate 10% polyacrylamide gel electrophoresis (SDS-PAGE) and electrophoresed proteins were transferred to Immobilon-P membranes (Millipore Inc., Bedford MA). Membranes were blocked for 1 - 2 hr in non-fat dry milk (Kroger brand), or ECL Advance blocking agent (GE Healthcare #RPN418V) for phospho-specific primary antibodies. Primary antibodies, rat anti-LIMK1 (100 ng/ml; kindly provided by Dr. James Bamburg, Colorado State University), anti-phospho-LIMK1 (Thr508; 1:2000; Cell Signaling #3841), anti-LIMK1 (1:100,000 Sigma #L-2290), anti-PARP (1:1000; BD Pharmingen #556362), anti-tubulin (1:10,000; Calbiochem #CP06), anti-cofilin (1:500; Abcam #ab54532), anti-phospho-cofilin (Ser3; 1:2000; Cell Signaling #3313), anti-GAPDH (1:40,000; Applied Biosystems #AM4300), anti-FAK (1:1000; Cell Signaling #3285), anti-phospho-FAK (1:4000; Invitrogen #44-626G), anti-paxillin (1:1000; Cell Signaling #2542), anti-phospho-paxillin (Tyr118; 1:1000 Cell Signaling #2541), anti-Src (1:5000; Cell Signaling #2109), anti-phospho-Src (Tyr416; 1:1000; Cell Signaling #2101), anti-Erk1/2 (1:1000; Upstate #06-182), anti-phospho-Erk1/2 (1:1000; Cell Signaling 9101), anti-AKT (1:1000; Cell Signaling #9272), and anti-phospho-AKT (Ser473; Cell Signaling #9271) were incubated overnight at 4°C. Polyclonal goat HRP-conjugated secondary antibodies against mouse, rabbit or rat (Bio-Rad Inc., Hercules, CA, 1:5000 dilution), were incubated on membranes for 1 hr at room temperature. After primary analysis, each blot was stripped using the Chemicon strong reblot reagent (Chemicon, Inc., Temecula, CA) prior to re-probing with additional primary antibodies.
Immunofluorescence microscopy
MDA-MB-231 cells expressing GFP or the various GFP-LIMK1 fusions were fixed in 4% PFA and then permeabilized with 0.5% Triton X-100 in PBS for 5 min, followed by washing with 100 mM glycine solution three times, 5 min per wash. Cells were then blocked for 1 h - 2 h in PBST with 5% goat serum. Following the blocking incubation, sections were incubated overnight at 4°C with phospho-FAK antibody (Tyr861; Invitrogen #44-626G) diluted 1:100 in blocking buffer. After three 5-minute washes in PBST, sections were incubated for 1 h with a goat IgG secondary antibody (Jackson Immunoresearch) in PBST, followed again by three washes and 1 h counterstain with Alexa Fluor 647-conjugated phalloidin (Invitrogen, #A22287, 1:2000) to visualize the filamentous actin. Slides were sealed using Fluoromount-G (Southern Biotech #0100-01) medium. The slides were imaged via fluorescence microscopy at 40 × magnification (OLYMPUS IX81 inverted microscope at the University of Colorado Denver Light Microscopy Facility utilizing the Intelligent Imaging Slidebook v.4.067 software).
Invasion assay
Matrigel-based trans-well invasion assays (BD Biosciences cat# 354483) were performed following the manufacturer's guidelines. Briefly, 5 × 104 MDA-MB-231 cells in DMEM+0.1% BSA were plated in 24-well plates with DMEM+5% FBS as chemo-attractant. After 24 hours, the cells were fixed in 4% PFA and the invading cells on the underside of the filter were stained with Hoechst stain. Invading cells on the bottom of the filters were imaged by fluorescence microscopy. Five high-power fields were counted per filter to score for invasion. Cell number was quantitated with Image J software.
Nude mouse xenograft tumor assay
Xenograft experiments were conducted in 7-8 week old female nude mice, purchased from the NCI or Harlan Laboratories. MDA-MB-231 cells expressing each of the GFP-LIMK1 fusions as stable pools were harvested in PBS/EDTA and re-suspended in Matrigel (BD Biosciences #356230) at a density of 40 × 106 cells/ml. For each injection, 2 × 106 MDA-MB-231 cells were injected bilaterally onto mammary fat pads #5 in a 50 μl volume of Matrigel, with 6-10 animals injected per cell line, per study. Tumor size was assessed by measurements with an electronic caliper. Volume was calculated as 0.52 × length × width × 2. Nude mouse xenograft experiments were performed under animal protocol (#63801707(03)1E), approved by the Animal Care and Use Committee of the University of Colorado Denver.
Statistical Methods
Statistical analysis of Matrigel invasion assay data was performed in consultation with the Colorado Biostatistics Consortium. The data analysis was generated using SAS software, Version 9.2 (SAS Institute, NC). Briefly, within each experiment, cell count data were standardized by dividing the mean cell count by the control group (GFP). The standardized data was fit to a general linear mixed model. Parameter estimates and statistical test results were obtained using the maximum likelihood method and containment degrees of freedom in SAS 9.2 proc mixed. A global F test for the group effect determined whether any differences existed between group means. Pair-wise comparisons of group means were conducted using the Tukey-Kramer method for multiple comparisons.
Statistical analysis of mouse tumor data sets was performed in consultation with the Biostatistics and Informatics division of the Colorado School of Public Health. All data analyses were performed using SAS software, Version 9.2 (SAS Institute, NC). Briefly, tumor volumes from the entire course of each experiment were used to generate linear mixed regression models. These models were used to analyze the associations between log-tumor volume and cell line-type, over the course of each assay. Pair-wise comparisons of group means were conducted using the Tukey-Kramer method for multiple comparisons. Differences of tumor weights were compared using a one-way ANOVA. A pair-wise comparison was done via a two-sample t-test, and the p-values were calculated based on the specific mean differences and the overall between-animal standard deviation.
Discussion
The recognized role of LIMK1 is to regulate cell motility and invasion by phosphorylating cofilin, and thus stabilizing actin filaments in the cytoplasm. Not surprisingly, LIMK1 studies have until now focused on the role of LIMK1 within the cytoplasm. However, LIMK1 has also been found in the nucleus and the functional role of nuclear LIMK1 remains unknown. We sought to directly interrogate whether LIMK1 localized to the nucleus (NLS-GFP-LIMK1) displayed tumorigenic properties, compared to LIMK1 targeted to the cytoplasm (NES-GFP-LIMK1) or both subcellular compartments (GFP-LIMK1) (Figure
2). Using this model of GFP-LIMK1 targeted to distinct subcellular compartments in MDA-MB-231 breast cancer cells, we found that both nuclear- and cytoplasmic-targeted GFP-LIMK1 enhanced FAK/paxillin/Src/AKT/Erk signaling, increased cellular invasion, and promoted xenograft tumor growth in nude mice. These data are significant because they show for the first time that LIMK1 targeted to the nucleus evinces similar signaling pathway activation and tumor-promoting properties as LIMK1 targeted either to the cytoplasm or to both subcellular compartments. While it is possible that trace amounts of nuclearly-enforced NLS-GFP-LIMK1 is expressed in the cytoplasm and contributes to its tumor promotion effects, we would point out that direct fluorescence imaging fails to show any NLS-GFP-LIMK1 in the cytoplasm. Moreover, the trace amount detected in the cytoplasmic fraction in the biochemical fractionation study (Figure
2C) is more likely due to protein leak from the nucleus during cell lysis and fractionation. Indeed, the GFP-LIMK1 fusion, without any additional NLS fusion, is clearly evident in the nucleus by direct imaging (Figure
2B), yet upon subcellular fractionation, GFP-LIMK1 is only detected in the "cytoplasmic" fraction, and none appears to be detected in the nuclear fraction (Figure
2C). Such discrepancies between imaging and fractionation studies are best explained by nuclear-to-cytoplasmic leak in these fractionation approaches, since the cytoplasmic leak appears to correlate with the overall strength of interactions with chromatin and nuclear matrix components, such as lamins [
23]. Nevertheless, these data support the interesting concept that nuclear LIMK1 contributes to the tumor-promoting effects of total cellular LIMK1.
Using our model of LIMK1 targeted to distinct subcellular compartments, we also observed that expression of LIMK1 in the nuclear and/or cytoplasmic compartments resulted in increased phosphorylation of FAK, paxillin, Src, AKT and Erk1/2 (Figure
4). The mechanism by which cytoplasmically-targeted LIMK1 activates the FAK/paxillin/Src/AKT/Erk signaling pathway is likely via LIMK1 phosphorylation of cytoplasmic cofilin, which stabilizes actin fibers, thus permitting mechanotransduction to activate integrin/FAK signaling [
24,
25]. Our observation that nuclearly-targeted LIMK1 results in activation of the FAK/paxillin/Src/AKT/Erk signaling pathway is novel, and thus the mechanism by which nuclear LIMK1 stimulates this pathway is less clear. However, since cofilin is known to cycle through the nucleus [
26,
27], we speculate that nuclear NLS-GFP-LIMK1 could directly phosphorylate nuclear-transiting cofilin, resulting in increased total phospho-cofilin levels (Figure
3D). The increased phospho-cofilin would then act in the manner described above, to activate the FAK signaling pathway. Interestingly, the phospho-cofilin levels are similarly increased in the three GFP-LIMK1 fusions (Figure
3D), despite the much lower level of pT508 NLS-GFP-LIMK1 compared to pT508 NES-GFP-LIMK1 and pT508 GFP-LIMK1 (Figure
3B). These data suggest that cells tolerate a maximal level of steady-state phospho-cofilin, which is known to be regulated by slingshot phosphatase [
8]. With regards to the correlation of phospho-cofilin and activated components of the FAK/paxillin/Src/AKT/Erk signaling pathway, we found that phospho-FAK, phospho-Src, phospho-AKT and phospho-Erk did correlate with phospho-cofilin levels (Figure
4). However, phospho-paxillin was very strongly induced in the GFP-LIMK1 cells, and total paxillin levels were modestly induced by all three GFP-LIMK1 fusions (Figure
4). The basis for this marked increase in phospho-paxillin selectively in the GFP-LIMK1 cells is unclear. Nevertheless, expression of all three GFP-LIMK1 fusions resulted in increased FAK/paxillin/Src/AKT/Erk signaling, and increased MDA-MB-231 cellular invasion and xenograft tumor growth in nude mice.
While all three GFP-LIMK1 fusions resulted in an increased and equivalent invasive phenotype (Figure
6), which correlated with cofilin, FAK, Src, AKT, and Erk phosphorylation (Figures
3 &
4), the tumor growth response of the different GFP-LIMK1 fusions did not strictly correlate with their cofilin-FAK signaling activity (Figure
7). The
in vitro invasion data are consistent with previously published reports showing that phospho-cofilin is a key factor regulating cell motility and invasion [
13,
18], since MDA-MB-231 cells expressing each of the three GFP-LIMK1 fusions displayed equivalent phospho-cofilin (Figure
3D) and cellular invasion (Figure
6) levels. In contrast, these equivalent phospho-cofilin levels and FAK/paxillin/Src/AKT/Erk signaling cannot explain the differential tumor growth generated by the MDA-MB-231 cells expressing the various GFP-LIMK1 fusions (Figure
7). Undoubtedly, a key difference between the
in vitro invasion assays and the
in vivo tumor formation studies is that the latter involves multiple tissue interactions. We speculate that a threshold is reached in our system of LIMK1-mediated activation of FAK/paxillin/Src/AKT/Erk signaling as it contributes to tumor growth. Thus, there are likely other, yet uncharacterized LIMK1 pathways that are distinctly affected by nuclear or cytoplasmic LIMK1 that contribute to the differential tumor promoting effects observed
in vivo. Because LIM-domain proteins often function as nuclear scaffolds that can participate in transcription events [
28], one possibility is that nuclear LIMK1 may mediate tumor promoting events via a direct contribution to transcription control. Within the cytoplasm, LIMK1 may mediate tumor progression via effects on p57
Kip2 or serum response factor (SRF), both of which are thought to be directly regulated by cytoplasmic LIMK1 [
29,
30], and both of which are known to influence tumor biology [
31,
32].
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
BVM designed the experiments and performed IHC assays, immunofluorescence assays, cell invasion assays, Western blot assays, and xenograft tumorigenicity assays. BVM also wrote the manuscript. KK performed Western blot assays. AGH directed the overall design of the study and participated in the preparation of the manuscript. All authors read, assisted in revision, and approved the final manuscript.