Background
The colony stimulating factor-1 (CSF-1) and its receptor CSF-1R (encoded by the
c-fms proto-oncogene) comprise a reciprocal system that has been previously linked to several human epithelial cancers including ovarian, breast, and prostate cancers[
1‐
4]. Besides its critical role in macrophage differentiation and proliferation[
5], CSF-1 and
c-fms are also key players in bone metabolism[
6] and female reproduction[
7]. In ovarian cancer, CSF-1 also has an important role as a biomarker and prognostic factor, as high levels of this protein were linked to poor patient outcome[
8,
9]. CSF-1 was also associated with cancer virulence by having the capacity to augment the invasive ability of human ovarian cancer cells[
10], and by promoting metastasis[
11].
CSF-1 has several alternatively spliced transcripts that encode for different sizes of CSF-1 proteins with different functionality[
12]. Its biological function as a cytokine in autocrine and paracrine signaling is achieved mostly by a secreted form that is the product of a 3,939nt transcript excluding poly A
+ tail[
13]. This transcript contains a long, 2,172nt 3’UTR. In ovarian cancer cells, a major unprocessed CSF-1 of 60.1 kDa polypeptide is produced by the 3,939nt transcript. This monomer is processed further by glycosylation and forms an over 200 kDa homodimeric glycoprotein which is the most abundant form of secreted CSF-1 in ovarian cancer[
14,
15].
Among the CSF-1 regulatory events, major importance is attributed to CSF-1 post-transcriptional regulation achieved by mRNA 3’UTR binding factors. Previously, we identified GAPDH protein which binds to ARE and stabilizes CSF-1 mRNA leading to post-transcriptional up-regulation of CSF-1 in ovarian cancer cells[
16].
MicroRNAs (miRNAs) are small single-strand RNAs of 21–23 nucleotides in length that regulate several biological functions (i.e., differentiation, hematopoiesis, tumorigenesis, apoptosis, development, and cell proliferation) through modulating the stability and/or translation efficiency of target mRNAs[
17]. They are predicted to regulate about 60% of mammalian mRNAs[
18]. It has been found that mRNAs with long 3’UTRs are more susceptible to miRNA regulation than those with short 3’UTRs as the latter ones lack in number of binding sites necessary for multiple miRNA binding and regulation[
19].
Although previous studies have reported miRNA regulation of CSF-1, most of these describe indirect regulation through additional miRNA targeted proteins in non-ovarian cells[
20]. To the best of our knowledge, there are only two previous reports of a miRNA that shows direct CSF-1 regulatory abilities in an ovarian system[
21,
22].
We predict that, since the 3,939nt CSF-1 transcript has a vast (2,172nt) 3’UTR, miRNAs may play an important regulatory role in mediating the cellular levels and biological functions of CSF-1 in ovarian cancer. In this report, we study 3’UTR targets for binding miRNAs, and find that both miR-128 and miR-152 down-regulate CSF-1 expression in ovarian cancer. Our goal is to identify miRNAs that down-regulate CSF-1 expression, and eventually open an avenue for possible treatment options for ovarian carcinomas.
Discussion
CSF-1 is an established regulator of ovarian cancer biology[
8‐
11], imparting invasiveness and metastasis[
9,
11], making it a potentially appropriate therapeutic target. The relatively long 3’UTR of CSF-1 mRNA makes the 3’UTR a likely target for post-transcriptional regulation. We have been studying the effect of GAPDH protein on CSF-1 mRNA stability. GAPDH binds to the AREs in CSF-1 mRNA 3’UTR and stabilizes CSF-1 mRNA. Down-regulation of GAPDH by siRNA decreases CSF-1 expression in ovarian cancer cells[
16].
In the present study, our goal was to identify miRNAs that down-regulate CSF-1 expression, a small step in our overall quest to find specific inhibitors which may ultimately impact on ovarian cancer metastasis. By using
in silico text-mining algorithms against the CSF-1 mRNA 3’UTR, we selected miR-128 and miR-152 that would fit the profile of having regulatory abilities of CSF-1. While miR-128 and miR-152 possess target sequences in the CSF-1 mRNA 3’UTR, their expression patterns in the ovarian cancer cell lines proved to be different. miR-128 RNA level is lower in the invasive, metastatic Hey and SKOV3 ovarian cancer cells in comparison to the less invasive and tumorigenic Bix3 ovarian cancer cells (Figure
1C). In contrast, miR-152 level was lower in the Bix3 cells than in the Hey and SKOV3 ovarian cancer cells (Figure
1D). Despite this difference in baseline expression pattern, we find that both miRNAs down-regulated CSF-1 mRNA and protein in ovarian cancer cells (Figure
5). A relatively small number of ovarian cancer cell lines may not give sufficient information when comparing miRNA expression patterns to effect on target mRNA (CSF-1 mRNA).
The majority of the miRNAs originate from intergenic regions far from other known genes and they possess independent transcription units. On the other hand, about a quarter of human miRNA loci are intragenic and they reside in the intronic regions of pre-mRNAs[
42]. Most of these latter ones will have a preferential sense orientation with the “host gene” and because they are lacking their own promoters, as a result, will be processed from introns[
43]. Sharing a common promoter can result in miRNAs and “host” genes exhibiting regulatory relationships. In our study, both miR-128 and miR-152 reside in introns of R3HDM1 gene and COPZ2 gene, respectively. Their expression patterns follow those of their host transcripts. COPZ2 encodes coatomer protein complex ζ2, which is involved in intracellular traffic and autophagy in golgi[
40]. miR-152 and its host gene COPZ2 are silenced in tumor cells and introduction of miR-152 precursor inhibited tumor cell (MDA-MB-231, HeLa) growth[
40]. Recently, both miR-128 and miR-152 have been shown to inhibit neuroblastoma invasiveness[
39]. These data suggest important biologic roles of miR-128 and miR-152 in cancer. In this report, we add the findings that over-expression of miR-128 or miR-152 in ovarian cancer cells results in a significant reduction in both motility and adhesiveness (Figure
6), therefore inhibiting important aspects of invasiveness and metastasis.
There is a recent report stating that the predominant effect of mammalian miRNAs is on mRNA decay which results reduced translation[
44]. In contrast, in zebra fish, miR-430 reduced translation initiation prior to inducing mRNA decay[
45]. Djuranovic
et al.[
46] reported miRNA-mediated translational repression is followed by mRNA deadenylation. In addition, the concept of mRNA destabilization by miRNAs gained support by genome-wide observation studies[
47]. In SKOV3, effects of either miR-128 or miR-152 are more prominent on CSF-1 protein level than on the CSF-1 mRNA level (Figure
5A-C). In contrast, in Bix3, both miRNAs have either a similar or slightly more influence on the CSF-1 mRNA level than CSF-1 protein level (Figure
5D-F). Different cell lines, as expected, show some differential responses to miRNAs, in part due to additional 3’UTR factors which may regulate miRNA activity. Identifications of these other regulatory factors are in progress in our laboratory.
In CSF-1 mRNA 3’UTR, we identified three potential miRNA target sequences for miR-128 and/or miR-152 (Figure
3). Target-A appears to be a miRNA ‘hot-spot’ as our bioinformatics analysis predicted at least fourteen miRNAs, including miR-128 and miR-152, targeting a region of 2573–2577 (Target-A) in CSF-1 mRNA 3’UTR (Figure
3). This Target-A sequence is highly conserved both in human and mouse[
41]. Mutation of Target-A resulted in a dramatic increase in reporter RNA and activity when compared to the wild-type construct (Figure
3). Target-A mutation also abrogated response of reporter RNA and activity to miR-128 and miR-152 over-expression (Figure
4). This suggests that Target-A is a critical
cis-acting regulatory sequence, and we have validated that it serves as a direct target for at least miR-128 and miR-152 (Figure
4).
Methods
Cell culture
Human ovarian cancer cells, Bix3, SKOV3 and Hey[
10,
11], were grown in 10% fetal bovine serum-enriched Dulbecco's Modified Eagle/F12 Ham’s medium (Invitrogen) supplemented with 1% penicillin-streptomycin (HyClone). Immortalized ovarian epithelial cells NOSE.1[
32] were grown in M199/MCDB1051 supplemented with 15% FBS and 1% penicillin-streptomycin (HyClone). All cells were incubated at 37°C and 5% CO
2.
Quantitative real-time RT-PCR for miRNAs
Total RNA was extracted with Trizol (Invitrogen). miRNA expression was determined by the stem-loop qRT-PCR to increase the specificity of miRNA amplification[
48]. miRNA and tRNA specific cDNA synthesis was followed by real-time PCR on an Eppendorf Realplex2 with tRNA as internal loading control. Reactions were incubated during initial denaturation for 10 min at 95°C, then for 40 cycles of 15 sec at 95°C and 1 min 60°C. Final miRNA expression values were calculated with the ΔΔC
T method[
49]. Primer sequences used are shown in Table
2.
Table 2
List of primers for qRT-PCR
miR-128-F | TCCGATCACAGTGAACCGGT |
miR-128-RT | GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGAC AAAGAG |
miR-152-F | TCCGA TCAGTGCATGACAGA |
miR-152-RT | GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGAC CCAAGT |
miR-27a-F | TCCGA TTCACAGTGGCTAA |
miR-27a-RT | GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGAC GCGGAAC |
miR-214-F | TCCGA ACAGCAGGCACAGAC |
miR-214-RT | GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGAC ACTGCCT |
miR-454-F | TCCGA TAGTGCAATATTGCTTA |
miR-454-RT | GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGAC ACCCTA |
CSF-1-F | CATCTCAGCCCCACCTGCATGGTA |
CSF-1-R | TCCTGGGCAGGAAGGGAAAGTC |
GAPDH-F | GCAGGCGTCGGAGGGCCCCCTC |
GAPDH-R | GGGACTGAGTGTGGCAGGGACTCC |
G-418-F | TCAGGATGATCTGGACGAAGAGC |
G-418-R | CAGCAATATCACGGGTAGCCAAC |
LucE-F | AACAATCCGGAAGCGACCAACG |
LucE-R | AACACAACTCCTCCGCGCAAC |
Similarly, CSF-1 and Luciferase transcripts were quantified with real-time PCR using the following primer set shown in Table
2. Calculations were based on the GAPDH mRNA or G-418 RNA internal controls.
Splinted ligation
miRNA expression was confirmed by splinted ligation as described by Maroney
et al.[
21]. In short, bridge and ligation oligonucleotides were designed for the miRNAs of interest. The ligation oligo was labeled with [γ-
32P]-ATP (Perkin Elmer, cat. no. BLU002A) using T4 polynucleotide kinase (Fermentas). Separation of ligation mixture was performed on a 10% urea gel and radioisotope emission was detected by phosphor imager.
Transient transfection
Cells were plated on a 6 well plate one day prior to transfection with 4 μg of plasmid DNA/well using 2.5:1 v/w ratio of Fugene HD (Promega). miRNA expression vectors and miRNA target reporter vectors were purchased from Origene.
Immunoblotting
Fifty μg of total protein lysates were subjected to SDS-PAGE and electroblotted onto PVDF membrane. The membranes were probed with mouse monoclonal anti-CSF-1 (ab66236, Abcam) and anti-Pan Actin (ACTN05, NeoMarkers, Fremont, CA) antibodies. After TBS-T washes and incubation with anti-mouse (HRP)-conjugated secondary antibody, the proteins were detected with a SuperSignal chemiluminescence (Pierce).
Mutation of CSF-1 mRNA 3’UTR targets
Each target was replaced by Asc I endonuclease site which converts ‘TGCACTGA’ to ‘GGCGCGCC’ by PCR cloning and fused to the 3’end of luciferase RNA in pMir-Target (Origene).
Luciferase assay
Forty eight hours after transfection with the reporter plasmid, cells were lysed and luciferase activity was determined using the Dual Luciferase Assay System according to the manufacturer’s protocol (Promega). Transfection efficiency was determined (where needed) by cotransfection with a GFP plasmid and microscopy.
Transwell motility assay and adhesion assay
For the directed motility assay, 24 hours post transfection, 4 x 104 cells were seeded in 1% Nu serum in the top chamber of 24-well inserts with uncoated 8 μm pore membranes (BD biosciences). The bottom chamber contained 20% FBS and 12.5 μg/ml fibronectin as chemo-attractants. Six hours after seeding, the top chamber cells were wiped off with Q-tips and the top and bottom chambers were washed with cold PBS, then dried and frozen at -80°C for 30 minutes. Bottom chamber cells were quantified by the lysis method using CyQuant Cell Proliferation Assay Kit (Invitrogen) as per the manufacturer’s protocol.
For the adhesion assay, 24-well inserts with human matrix-coated membranes (BD biosciences) were used. The human matrix consisted of type IV collagen, laminin, and gelatin. 24 hours post transfection, 5 x 10
4 Hey cells were implanted and incubated for 2 hours prior to crystal violet staining according to the previous report[
11].
The WST-1 assay (Clontech) was used to assess degree of cell proliferation among the conditions 24 after transfection.
Statistical analysis
Data is depicted as mean ± SD from at least three independent experiments. The one-way ANOVA test was performed using SigmaStat (Jandel Scientific Corp.). P < 0.05 was considered statistically significant. The Pearson product moment correlation test was performed using SigmaStat (Jandel Scientific Corp.) for correlation analysis between miRNA and CSF-1 mRNA or protein expression levels.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
HHW and CFL carried out most of the experiments including the quantitative real-time qRT-PCR for CSF-1 mRNA, miR-128 and miR-152 as well as the overexpression and suppression of miRNAs and wrote the manuscript. SG performed the WST-1 cell proliferation assay. HHW and SKC discussed the design of the experiments, the results, the analysis, and wrote the manuscript. All authors read and approved the final manuscript.