Background
Hypoxia, a frequent effect of solid tumor growth in head and neck cancer and other cancers, serves to generate a cascade of molecular pathways which include angiogenesis, glycolysis, and various cell-cycle control proteins. These cell-salvaging mechanisms can be carried out rapidly by a transcription factor that reacts to hypoxic conditions, the hypoxia-inducible factor-1 (HIF-1) [
1]. HIF-1 is a heterodimer consisting of an α subunit and a β subunit, both of which are members of the basic helix-loop-helix Per/Arnt/Sim (PAS) family [
2]. Stability of this dimer is dependent to a large extent on oxygen [
3,
4]. Thus, in the presence of oxygen HIFα family members are hydroxylated on one of two conserved prolyl residues. This is achieved by members of the egg-laying-defective nine (EGLN) family or prolyl hydroxylases (PHD1, PHD2, and PHD3) that achieve hydroxylation, using Fe
2+ and ascorbate as cofactors [
5,
6]. In so doing, prolyl hydroxylation creates a binding site for a ubiquitin ligase complex containing the von Hippel-Lindau (VHL) tumor suppressor protein, which results in HIFα destruction [
7‐
10]. Most recently, OS-9, a ubiquitous cellular protein was shown to be a common partner for HIF-α and the PHDs, as well as to enhance prolyl hydroxylation and degradation of HIF-1α [
11]. Conversely, in cells where OS-9 mRNA was targeted for degradation, increased HIF-1α levels and accordingly increased HIF-mediated transcription were observed [
11].
HIFα transcriptional activation function is also modulated further by asparagine 803 hydroxylation by the asparagine hydroxylase, factor-inhibiting HIF (FIH), which affects recruitment of the coactivators p300/CBP [
12‐
17]. Interestingly, VHL itself has also been implicated in the direct regulation of HIF-1α transcriptional activity, either by recruiting histone deacetylases or by recruiting other transcriptional repressors such as pVHL-associated KRAB-A domain-containing protein (VHLaK) [
18]. Thus, in VHL disease, loss of VHL function results in HIF-1α stabilization and increased expression of HIF-1α target genes as noted above. However, more recently it has become apparent that HIF-1α may be expressed and transcriptionally active during normoxia and high levels of HIF-1α have been observed in some normal tissues and in many tumors in the absence of apparent hypoxia or loss of VHL function [
19‐
21]. In fact, increased levels of HIF-1α have been reported in colon, breast, stomach, pancreas, prostate, kidney, esophagus and head and neck cancers [
22‐
24]. Accordingly, there is accumulating evidence that hypoxic-independent mechanisms are attributable for HIF-1α expression.
Despite the observed importance of HIF-1α stabilization by way of VHL loss of function in human malignancies [
25], polymorphisms or mutations in HIF-1α that increase its activity under normoxia have recently been identified. These HIF-1α variants exhibit significantly higher transcription activity than wild-type (WT) HIF-1α, under normoxic conditions (P < 0.02). Furthermore, tumors from HNSCC patients with heterozygous alleles were shown to have significantly increased numbers of microvessels. Thus, the elevated transactivation capacity of variant forms of HIF-1alpha has implied a role of HIF-1α polymorphisms in generating individually different tumor progression profiles [
26].
TSC1 and TSC2 constitute the tuberous sclerosis complex and hamartin and tuberin constitute their respective protein products. Hamartin and tuberin have been considered to act as tumor suppressors [
27]. The proteins interact with each other and non-truncating mutations that disrupt this complex have been shown to cause tuberous sclerosis [
28]. Functionally, hamartin stabilizes tuberin by preventing its ubiquitination. This TSC1/TSC2 complex regulates activity of p70S6 kinase by inhibiting mTOR by way of the PI3K/Akt/mTOR pathway [
29]. In so doing TSC1/TSC2 exert translational control of protein synthesis and cell growth. Hamartin and tuberin deficient cells also manifest increased proliferation and reduced expression of the cyclin dependent kinase (CDK) inhibitor p27 [
30]. Furthermore, TSC1/TSC2 participate more directly in cell adhesion [
31]. Hamartin interacts with the ezrin-radixin-moesin family of cytoskeletal proteins and activates the small GTPase Rho that directs cell adhesion by controlling activation of focal adhesion complexes; at the same time, tuberin appears to mediate E-cadherin directed cell adhesion through the β-catenin signaling pathway [
30,
32,
33].
The suppressor roles of hamaratin and tuberin have been extensively investigated in organs that are affected by the tuberous sclerosis phenotype. More recently, it has been shown that aberrant expression of TSC1 and TSC2 may be present in breast cancers, renal carcinoma, transitional cell carcinoma, basal cell carcinoma, squamous cell carcinoma and shagreen patches and may serve as a prognostic marker in breast cancer [
34‐
37].
Here, we investigate the novel polymorphisms in exon 12, that approximate the oxygen-dependent degradation domain of HIF-1α in 28 patients with oral squamous carcinomas. Moreover, we explore the presence of polymorphisms and mutations in TSC1 and TSC2, downstream suppressors of Akt signaling, to ascertain if dysregulation of such elements might complement HIF-1α expression.
Discussion
This study identified 6 cases of tongue SCCs from among 28 cases that manifest HIF-1α heteroduplexes within exon 12 of HIF-1α. Five of the cases were polymorphisms while one case was shown to be a mutation. The two polymorphic variants, P582S and A588T, and the single case presenting as a mutation were the same as those previous described by Tamimoto et al. in a survey of 55 cases of head and neck carcinomas [
26]. Interestingly, the same variants have also been described in renal carcinomas, colorectal carcinoma and more recently among prostate cancers [
19,
38,
39]. The cases studied here showed significantly higher levels of HIF-1α by immunohistochemistry, however, there was no correlation between HIF-1α levels with tumor stage or grade according to TNM system. Although previous studies have suggested that the polymorphic variants were always associated with tumors that were greater than T2, the tumors in this study were not part of a progressive series and tumor grading at a single time point was not felt to provide any useful information, albeit all HIF-1α variants were identified in tumors that were graded as T2 or greater [
26].
In that the substituted amino acids in the HIF-1α variants identified here are located within or near the N-TAD, interacting with E3 ubiquitin ligase pvHL, it has been suggested that the protein expression levels observed in these tumors and their observed greater transactivation capacity may be due to alteration of the HIF-1α stability. Although previous investigations using COS7 cells found no differences in protein degradation between wild-type HIF-1α and the variant forms [
26], more recently it has been demonstrated that P582S HIF-1α stability in CV1 cells was less responsive to iron chelators, which normally promotes HIF-1α accumulation, than were cells possessing wild type HIF-1α. Moreover, these investigators showed that wild-type containing cells rapidly degraded HIF-1 in normoxia while HIF-1α variants maintained protein levels comparable to those observed during hypoxia [
19]. Interestingly, proline 582 is not considered as a site for HIF-1α hydroxylation and this site is not been known to promote vHL binding. In fact, site directed substitution of serine for proline at this position has been shown to have no effect on vHL binding after hydroxylation at proline 564 [
40]. Although, some have considered that hydroxylation of proline 582 may influence similar post-translational modifications of the full-length HIF-1α molecule or successive steps in the dependent degradation pathway, a more methodological approach will be necessary to settle this point [
19].
Recently, we have shown that persistent activation of the Akt pathway was a common event among head and neck squamous carcinomas [
41]. Consequently, we explored downstream of Akt to ascertain whether polymorphisms or mutations might explain the elevated levels of HIF-1α. In so doing, nine cases from among the 28 tongue cancers were identified that manifest TSC1 or TSC2 herteoduplexes upon DHPLC analysis. Among these, 8 of the cases contained a polymorphism in exon 41 of the TSC2 gene. This polymorphism, G5346C, has been previously shown to be silent and have no effect on the gene product [
42]. One of the cases, patient 18, also had frame-shift deletion in exon 36 and exon 40 of TSC2 as well as being associated with an HIF-1α variant. This case showed extremely high levels of HIF-1α expression suggesting that the two events might complement each other. Interestingly, of the three cells lines that possessed stable high levels of HIF-1α during normoxia, two were shown to contain TSC2 deletion mutations in exon 40 and one of them also contained a frame-shift deletion in exon 17 in TSC1. In that TSC1/TSC2 inhibit mTOR downstream from Akt signaling we sought to substantiate that HIF-1α protein expression was dependent on integrity of the TSC complex. The use of siRNA strategies revealed that targeted degradation of the TSC2 enhanced the levels of HIF-1α in cells containing wild-type TSC2 whereas, the mutant cell line was refractive to such targeted degradation. These findings are in consort with an earlier demonstration that TSC2 regulates VEGF, a HIF-1 target through an mTOR pathway [
43].
In solid head and neck squamous carcinomas Rapamycin exhibits a potent anti-tumor effect
in vivo, inhibiting DNA-synthesis and inducing the apoptotic death of HNSCC cells, which ultimately results in tumor regression. Similar results are not observed for cells grown
in vitro where the drug appears only to be cytostatic and only reduced cell cycle progression, particularly by delaying their entry into S phase, and by arresting cell lines in G
1 phase at high doses. Those studies suggested that mTOR may occupy a position at the crossroad of a network of molecular pathways sensing the energy supply, growth promoting or inhibitory factors, the metabolic status of the cells, and the availability of nutrients, and integrates this complex array of incoming information to regulate the synthesis of proteins that are required for cell growth [
44]. The studies here showed that treatment with Rapamycin had no effect on HIF-1α levels either during serum-rich or serum deprived condition in cells possessing wild-type TSC1/TSC2, however, in the two cell lines possessing a deletion mutation in TSC2 Rapamycin diminished the levels of HIF-1α. Thus, implying that mutations in the TSC1/TSC2 complex could
in vitro tip this scale towards an mTOR regulation of HIF-1 mediated cell growth.
There is strong evidence that up regulation of HIF by mTOR is a frequent mechanism regulating tumor growth. Although the oncogenic events that have been associated with mTOR upregulation of HIF have included persistent activation of Akt, overexpression of HER2 and the BCR-ABL, and inactivation of PTEN, similar effects may also be achieved by dysregulation of the TSC1/TSC2 complex by mutation, promoter hypermethylation [
45], or by binding with HPV16 E6, which results in the proteasome-mediated degradation of TSC2 [
46]. The demonstration here using established cell lines transfected with HIF-1α and the P582S mutant indicates that alterations in HIF-1α and TSC1/TSC2 compliment each other expressing elevated levels of HIF-1α in the face of normal vHL and normoxia. Whether such alterations in the TSC1/TSC2 complex coupled with HIF-1α polymorphisms influence the progression to SCC of the head and neck needs to be further assessed in a larger number of cases and may provide biomarkers to predict responses to specific therapies and overall disease prognosis.
Materials and methods
Archival tissue material
Twenty eight primary squamous cell carcinomas (16 males and 12 females) of the tongue tumor were retrieved from the Tumor Bank of the Greenebaum Cancer Center, University of Maryland Baltimore. In that the identity of the subjects was not identifiable by the parameters provided the investigation was judged as exempt by Institutional Review Board.
Cell lines
Established cell lines of human oral squamous carcinoma cells (SCCs) SCC-4a, -9, -15 and -25 b were obtained or developed (SCC-4a reestablished from SCC-4 xenograph and SCC-25b reestablished from SCC-25 xenograph) from American Type Culture Collection (ATCC) (Manassas, VA) UMBSCC11 was developed at the University of Maryland Baltimore. For these studies, cells were cultured in a 1:1 mixture of Ham's F12 and DMEM containing 10% FBS, 100 U of penicillin, 100 μg/ml streptomycin and 0.4 μg/ml hydrocortisone (Sigma Chemical Co., St. Louis, MO) at 37°C in a 5% CO2 air atmosphere (normoxia). Cells were subcultured by disaggregation with trypsin (0.1%)-EDTA (0.01%) in PBS at pH 7.5.
Protein lysate preparation and western blotting
Cells were plated in 6-well plates using a density of 5 × 104 cells/well and were allowed to grow to 80% confluence. The cells were washed twice with cold PBS, lysed in RIPA buffer (50 mM Tris [pH 7.4], 150 mM NaCl, 1% Triton X-100, 1% deoxycholic acid, sodium salt, 0.1% sodium dodecyl sulfate [SDS], 100 μg/ml phenylmethylsulfonyl fluoride, 1 μg/ml aprotinin, 1 mM dithiothreitol and 1 mM sodium orthovanadate) for 10 min and scraped. The extracts were centrifuged at 40,000 g for 15 min at 4°C. Protein concentrations were measured and equalized using Bio-Rad protein assay (Bio-Rad Laboratories, Richmond, CA) according to the manufacturer's instructions.
Equivalent amounts of protein (50 μg) were then separated by SDS-PAGE and then transferred to polyvinylidene difluoride membranes. Equivalent loading was confirmed by staining membranes with Ponceau-S. The membranes were blocked for 1 h in blocking buffer (1× Tris-buffered saline, 5% nonfat dry milk, and 0.1% Tween 20), which was subsequently replaced by the primary antibody in blocking buffer, overnight at 4°C. After incubation, the membranes were washed three times in washing buffer (1× Tris-buffered saline and 0.1% Tween 20). Primary antibody was detected using horseradish peroxidase-linked goat antimouse (Santa Cruz Biotechnology, Santa Cruz, CA) or goat antirabbit IgG antibody (Santa Cruz Biotechnology) and visualized with SuperSignal West Pico chemiluminescent substrate (Pierce, Rockford, IL). The bands were scanned and quantified using NIH image software.
Plasmids, HIF-1α protein levels
The P582S HIF-1α mutant was produced by
in vitro site directed mutagenesis from HA-tagged wild-type HIF-1α in pcDNA3 using Stratagene QuickChange Site-Directed mutagenesis kit, as previously described [
19]. To demonstrate the levels of HIF-1α and mutant protein SCC-4a and SCC-9 cells were transfected using the appropriate plasmid with Lipofectamine 2000 (Invitrogene) and the levels assessed by Western blot using anti-HA epitope tag antibodies and visualized with SuperSignal West Pico chemiluminescent substrate (Pierce, Rockford, IL) as described above.
Immunostaining
Tumor tissue immunostaining for HIF-1α (SC10790), (Santa Cruz Biotech., Inc. Santa Cruz, CA, USA) was performed on 5 μM sections made from the above samples. Staining was analyzed with horseradish peroxidase-linked goat antimouse (Santa Cruz Biotechnology, Santa Cruz, CA) or goat antirabbit IgG antibody (Santa Cruz Biotechnology). The samples were graded either as strongly positive (++++, where more than 70% of tumor cells expressed staining), moderately positive (+++, 50% to 70% positive), Positive (++, 10% to 50% positive staining) or weakly positive (+ < 10% positive staining) Negative and positive controls were included in each batch.
Real-time RT-PCR assays
Total RNA was extracted from cells by using the RNAqueous kit #1912 (Ambion, Austin, TX, USA) and were treated with DNase. Five μg total RNA was used for first-strand synthesis. cDNA was used for PCR analysis of HIF-1α (forward 5'-CCACAGGACAGTACAGGATG-3' and reverse 5'-TCAAGTCGTGCTGAATAATACC-3'), OS-9 (forward 5'-GGATGATGAAACAGCCAAGG-3' and reverse 5'-GCACATAAGAGCAGGACAAG-3') and 18S rRNA (the 340 base pair fragment of 18s rRNA was used as the housekeeping gene using 5'-AATTGACGGAAGGGCACCAC-3' and 5'-CGGACATCTAAGGGCATCACAG-3' as forward and reverse primers, respectively) [
11]. Real-time PCR was performed by using SYBR Green PCR Master Mix and the Applied Biosystems 7000 Real-time PCR Detection System (ABI, Foster, Ca). Expression of HIF-1α mRNA and OS-9 RNA relative to 18S rRNA was calculated based on the threshold cycle (C
T) for amplification as 2
(ΔCT). Melting-curve data for all the samples were obtained to ensure specific amplification.
Statistical analysis
Data are presented as mean ± SEM. Differences between experiments were analyzed for statistical significance (p < 0.05) by ANOVA or two-sample t tests as appropriate.
DNA extraction and polymerase chain reaction
Genomic DNA was isolated from peripheral blood mononuclear cells and patient tumor samples to assess polymorphisms versus mutations using GenomicPrep. Cell and Tissue DNA Isolation Kit (Amersham Biosci.; Piscaraway, NJ). as described previously [
47]. Genomic polymerase chain reaction (PCR) was carried out in 50- μl reaction volumes containing 100 ng genomic DNA, 0.5 mM primers, 0.2 mM dNTP, 5 ml reaction buffer (100 mM TRIS pH8.3, 500 mM KCl, 15 mM MgCl2, 0.01% gelatin) and 1 U TaqPro Complete DNA polymerase (Danville Scientific; Metuchen, NJ).
To assess HIF-1α we focused on the polymporphisms found in human HIF-1α that resulted in an amino acid substitution within exon 12. Consequently, PCR was performed to amplify the 178-bp fragment of human HIF-1α gene (CATGTATTTGCTGTTTTAAAGGACACAGATTTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCTTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCACAGTTACAGTATTCCAGCAGACTC) using a primer set, HIF-1α (forward 5'-CAT GTA TTT GCT GTT TTA AAG-3') and HIF-1α (reverse 5'-GAG TCT GCT GGA ATA CTG TAA CTG-3') under the following conditions: 30 cycles of denaturing at 95°C for 30 s, annealing at 61°C for 30 s and extension at 72°C for 30 s. [
19,
26].
PCR primers for the amplification of
TSC1 and
TSC2 exons were as previously described [
47]. 28 patient tumor samples and negative (no DNA) control for each amplimer were amplified. Cycling parameters were 95°C for 12 min followed by 33 cycles at 53°C (
TSC2 exons 2, 4, 5, 8, 11, 14, 15, 16, 17, 19 and 20), 55°C (
TSC1 exons 3–14;
TSC1 exons 15–23;
TSC2 exons 3, 6, 7, 13, 21, 22, 25, 27, 28, 29, 30 and 33 fragment b
TSC2 exons 1, 9, 10, 12, 23, 24, 31, 33 fragment c, 37, 39, 40 and 41) or 57°C (
TSC2 exons 18, 26, 32, 33 fragment a, 34, 35, 36 and 38) for 1 min, 72°C for 1 min and 94°C for 1 min, with a final step of 72°C for 10 min.
To assess vHL primer sets for all 3 exons were employed. The primer sequences were as follows: for exon 1 (forward 5'-CGCGAAGACTACGGAGGTCG-3') (reverse 5'GGATGTGTCCTGCCTCAAGGG-3'); exon 2 (forward 5'-ACCGGTGTGGCTCTTAACA-3'0 (reverse 5'-CTTACCACAACAACCTTATCTT-3') and exon 3 (forward 5'-GCCTCTTGTTCGTTCCTTGTACT-3') (reverse 5'-GATCAAGACTCATCAGTACCATC-3').
Denaturing HPLC
DHPLC was performed utilizing a WAVE DNA fragment analysis system (Transgenomic, Omaha, NE). For these studies five microliters of heteroduplexed PCR fragments was injected onto the DNASep cartridge. Products were eluted at a constant flow rate of 0.9 ml/min with a linear acetonitrile gradient determined by WAVEMaker software (Transgenomic, Omaha, NE) based on the size and GC content of the amplicon. The gradient was achieved by combining 0.1 M triethylammonium acetate (TEAA) buffer (pH 7) (Transgenomic) and Buffer B (0.1 M TEAA with 25% acetonitrile) (Transgenomic). Eluted DNA fragments were detected by the system's UV detector and analyzed as chromatograms. Homo- and heteroduplex peaks were detected between the initial injection peak, produced by residual nucleotides and primers in the reaction, and the wash peak, produced by the acetonitrile flush at the end of each analysis. Melt profiles were constructed using the WAVEMaker software (Transgenomic). A range of partial denaturation temperatures was predicted by this software. PCR products were initially analyzed under nondenaturing conditions, 50°C, to assess the quality of the peak representing both hetero- and homoduplex DNA fragments in a mutant sample. All temperatures within the predicted range for partial denaturation were then assessed for their ability to resolve homo- and heteroduplexes. A single temperature was chosen where all mutants could be resolved.
For HIF-1α DHPLC analyses heteroduplexes were detected at 58.4°C. For
TSC1 and
TSC2 a list of the PCR DHPLC run temperatures, run times and ACN gradients used were those indicated by Jones
et al. [
47]. VHL heteroduplexes were detected at 61.5°C.
DNA sequencing
PCR products displaying an abnormal elution profile or variant DHPLC melt profiles were directly sequenced by using the Sequenase PCR Product Sequencing Kit according to the manufacturer's instructions (Amersham).
Authors' contributions
CH- Performed transfection and gene expression data.
KN-Performed Western blotting and Real-time PCR
PP- Extracted DNA, and performed DHPLC analyses
RAO-Contributed tissue samples and analyzed clinical data
NGN- Performed gene sequencing and DHPLC studies
JJS- Provided over-all study design, designed probes, transfection vectors, and gene mutations.