HPV16 E2 could act as down-regulator in cellular genes implicated in apoptosis, proliferation and cell differentiation

The HEK293 and C-33A cell lines were obtained from ATCC. HEK293 cells were cultured in Dulbecco's modified Eagle's medium (DMEM), supplemented with 10% fetal bovine serum (FBS), penicillin (100 units/ml) and streptomycin (100 μg/ml). The C-33A cell line was cultured in Dulbecco's modified Eagle's medium: Nutrient Mixture F12 (DMEM-F12) supplemented with 10% Newborn Bovine Serum. Both cell lines were maintained in an humidified atmosphere at 37°C and 5% CO₂.

The construction of the replication deficient recombinant Adenovirus containing the E2 gene from HPV16 controlled by the cytomegalovirus promoter (CMV) was carried out with the Adeno-X Expression System (Clontech, Inc). The gene E2 was amplified by PCR using the primer forward 5'-TTCGGGATCCATGGAGACTCTTTGCCAACG-3' and the primer reverse 5'-ATCCGAATTCTCATATAGACATAAATCCAGTAG-3' using as a template the plasmid pcDNA3-E2. The corresponding amplicon was cloned in the pShuttle plasmid (Clontech, Inc) using the EcoRI and KpnI restriction sites. The generated pShuttle-E2 was digested with the restriction enzymes PI-SceI and I-CeuI to obtain the expression unit, and then clone it in the correspondent restriction sites of the pAdenoX plasmid (Clontech, Inc) generating the vector pAdenoX-E2. A pAdenoX-empty vector was also built, incorporating the PI-SceI-I-CeuI fragment from the pShuttle plasmid. This vector allowed us to generate an Adenovirus that does not contain expression cassette, denominated empty Adeno (Ad-empty). The recombinant viruses were generated by transfection into HEK293 cells with Lipofectamine Transfection Reagent (Invitrogen). The viral particles were propagated in HEK293 cells and purified using the system Adeno-X Mini Purification Kit (Clontech, Inc), following the instructions of the provider. The Adenovirus titer was obtained by immunocytochemistry following the protocol reported by Bewig [19]. For the infection of C-33A with the recombinant Adenoviruses, 800,000 cells were seeded in DMEM-F12 with 10% Newborn Bovine Serum and maintained at 37°C and 5% of CO₂ during 24 hrs. The cell cultures were then incubated with 500 moi (multiplicity of infection) of either AdE2 HPV16 or Ad-Empty during 1.5 hrs in serum free DMEM-F12, in order to allow the virus adsorption. The viral stock was then removed away and the infection continued during 48 hrs in DMEM-F12 with 1.5% newborn bovine serum. To evaluate the infection efficiency, viral DNA was extracted using the Hirt method [20] and this material used as a template to amplify by PCR a 287 bp fragment of the Adenovirus 5 genome, using as a primer forward: 5'-TAAGCGACGGATGTGGCAAAAGTGA-3' and as a reverse 5'-CGTTATAGTTACGATGCTAGAGATT-3'.

Total RNA from the recombinant Adenovirus infected cells was obtained using the Trizol reagent (Invitrogen) following the indications of the provider. One μg of RNA was used to synthesize cDNA using M-MLV reverse transcriptase (Promega). This cDNA was used as a template to perform a PCR reaction using as primer forward 5'-TTCGGGATCCATGGAGACTCTTTGCCAACG-3' and as reverse 5'-ATCCGAATTCTCATATAGACATAAATCCAGTAG-3' amplifying a 1098 bp fragment corresponding to the full length HPV16 E2 gene. We used also a primer forward 5'-CTGTGGACCGTGAGGATA-3 and a reverse 5'-CTGTTGGGCATAGATTGTT-3' to amplify by PCR a 750 bp fragment of the Ad-5 Hexon gene.

10 μg of total RNA were used for cDNA synthesis and labeling with SuperScript II kit (Invitrogen), using in a first array dUTP-Cy3 incorporation for Non-infected cells (N.I.) and dUTP-Cy5 for Ad-empty; and in a second array dUTP-Cy3 for Ad-empty and dUTP-Cy5 for AdE2; Fluorophorus incorporation efficiency was analyzed measuring absorbance at 555 nm for Cy3 and 655 nm for Cy5. Similar quantities of fluorophorus labeled cDNA were hybridized on the oligonucleotides collection 50-mer Human10K from MWGBiotech Oligo Bio Sets (Germany). Images of the microarrays were acquired and quantified in the scanner ScanArray 4000 using the QuantArray software from Packard BioChips (USA). A first analysis of the images and their data were performed using the Array-Pro Analyzer software from Media Cybernetics (USA). Data were then normalized and analyzed with genArise software (Institute of Cellular Physiology, UNAM) and genes with a Z score ≥ 1.8 or ≤ -1.8 were considered with altered expression. An ontological analysis was performed with selected data using PANTHER classification system (Protein ANalysis THrough Evolutionary Relationships).

Total RNA from recombinant Adenovirus infected cells was obtained using Trizol reagent (Invitrogen) following the indications of the provider; 1 μg of RNA was used to synthesize cDNA with M-MLV reverse transcriptase (Promega) and this material used for relative quantification of the selected genes obtained from the microarrays analyses, by qPCR using the commercial kit ABSOLUTE qPCR SYBR Green Mix (Abgene) following the recommendations of the provider. The evaluation of the mRNA levels of the gene of constitutive expression GAPDH was used to normalize. Amplicons quantification was performed by double delta Ct (ΔΔCt) method. The primer sequences used were: for GAPDH as forward 5'-CATCTCTGCCCCCTCTGCTGA-3' and as reverse 5'-GGATGACCTTGCCCACAGCCT-3'; for N-MYC as forward 5'-TACCTCCGGAGAGGACACC-3' and as reverse 5'-CTTGGTGTTGGAGGAGGAAC-3'; for JAG1 as forward 5'-CTTCAACCTCAAGGCCAGC-3' and as reverse 5'-CTGTCAGGTTGAACGGTGTC-3'; and for MAPK13 as forward 5'-ATGTCTTCACCCCAGCCTC-3' and as reverse 5'TCCTCACTGAACTCCATCCC3'.

In order to obtain reliable data on the modifications induced by HPV16 E2 on the cellular gene expression profile, a recombinant adenoviral vector was used, since these vectors are able to efficiently infect cells from epithelial origin and the presence of a very strong promoter (MLP from HCMV) on its expression unit, guarantees a high efficiency of transgene expression. The infection of C-33A cells with the recombinant Adenovirus AdE2 was observed in almost 90% of the treated cell population (not shown). The evaluation of the E2 expression level in cells was carried out by RT-PCR 48 hours after infection, observing a very high amount of E2 mRNA in the infected cells (Figure 1).

In order to identify the modifications induced on the cellular gene expression profile by HPV16 E2 gene, the expression profiles of AdE2 C-33A infected cells versus the expression profile of Ad-empty infected cells were obtained. To discriminate the effect that the adenoviral vector by itself had on the cellular gene expression, we also compared the expression profile of Ad-empty infected cells against that one from non-infected cells (mock). Data analysis obtained indicates that HPV16 E2 up-regulates 581 genes and down-regulates 1048 genes (Additional file 1, Table S1 and Additional file 2, Table S2). Table 1 shows a list of the 50 genes with higher induction (with a Z score >2.1) and Table 2 those 50 genes highly down-regulated (with a Z score <2.9) for the expression of E2. These results indicate that HPV16 E2 has preferably a negative effect on cellular gene expression.

Gene Ontology analysis performed in PANTHER classification system (Protein ANalysis Through Evolutionary Relationships) [21] indicates that WNT pathway is the most severely affected by the expression of E2, since we found 28 genes down-regulated and 15 up-regulated. Interestingly, this pathway is a convergence point of genes involved in the regulation of several cellular processes, including apoptosis, cell proliferation and differentiation. We found modifications in the expression of genes that play an important role in regulating these processes, like the down-regulation of EGR2 and CASP9, both involved in apoptosis; the up-regulation of CCNA and down-regulation of RHOA, both involved in cell proliferation; and the down-regulation of some of the type I keratins, markers of epithelial cell differentiation such as keratin 14, 24 and 34. Moreover, we found that a large number of genes from pathways such as PDGF, angiogenesis and cytokines and chemokines mediated inflammation, are also altered for expression of HPV16 E2 (Tables 3 and 4).

The validation of the results obtained with the microarrays analysis was performed by Real Time RT-qPCR, evaluating the mRNA levels of some of the genes negatively regulated by E2: MYCN, JAG1 and MAPK13. This approach was taking as basis recent results about validation of microarray experiments [22]. These genes were selected because they have a key role in some of pathways altered by HPV16 E2, such as apoptosis, cell cycle and keratinocyte differentiation [23‐25]. Figure 2 shows the results of RT-qPCR for the selected genes among the AdE2 infected C-33A cells and those Ad-empty infected. The results of RT-qPCR from the selected genes correlate with the observations obtained with the microarrays analysis, indicating a very trusty landscape of the modifications on cellular gene expression induced by HPV16 E2.