Skip to main content
Erschienen in: Journal of Experimental & Clinical Cancer Research 1/2011

Open Access 01.12.2011 | Research

RNAi-mediated knockdown of cyclooxygenase2 inhibits the growth, invasion and migration of SaOS2 human osteosarcoma cells: a case control study

verfasst von: Qinghua Zhao, Chuan Wang, Jiaxue Zhu, Lei Wang, Shuanghai Dong, Guoqiao Zhang, Jiwei Tian

Erschienen in: Journal of Experimental & Clinical Cancer Research | Ausgabe 1/2011

Abstract

Background

Cyclooxygenase2 (COX-2), one isoform of cyclooxygenase proinflammatory enzymes, is responsible for tumor development, invasion and metastasis. Due to its role and frequent overexpression in a variety of human malignancies, including osteosarcoma, COX-2 has received considerable attention. However, the function of COX-2 in the pathogenesis of cancer is not well understood. We examined the role of COX-2 in osteosarcoma.

Methods

We employed lentivirus mediated-RNA interference technology to knockdown endogenous gene COX-2 expression in human osteosarcoma cells (SaOS2) and analyzed the phenotypical changes. The effect of COX-2 treatment on the proliferation, cell cycle, invasion and migration of the SaOS2 cells were assessed using the MTT, flow cytometry, invasion and migration assays, respectively. COX-2, vascular endothelial growth factor (VEGF), epidermal growth factor (EGF), basic fibroblast growth factor (bFGF) mRNA and protein expression were detected by RT-PCR and western blotting.

Results

Our results indicate that a decrease of COX-2 expression in human osteosarcoma cells significantly inhibited the growth, decreased the invasion and migration ability of SaOS2 cells. In addition, it also reduced VEGF, EGF and bFGF mRNA and protein expression.

Conclusions

The COX-2 signaling pathway may provide a novel therapeutic target for the treatment of human osteosarcoma.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1756-9966-30-26) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

The authors contributed to this study as follows: QHZ and JWT designed the study;
QHZ, CW and JXZ performed experiments; LW analyzed data; SHD prepared the figures; JWT and GQZ drafted the manuscript. All authors have read and approved the final manuscript.

Background

Osteosarcoma is the most common primary malignant tumor arising in bone predominantly affecting children and adolescents [1]. It is also one of the most heterogeneous of human tumors [2]. The 5-year survival rate has increased up to 70% in patients with localized disease, however, the prognosis is very poor and the 5-year survival rate is only 20-30% in patients with metastatic disease at diagnosis [3]. Although an adjuvant treatment regimen after surgical resection seems to prolong survival, the precise treatment protocol of drug-of-choice is still debated because the exact mechanisms the development and progression of osteosarcoma are still largely unknown [4]. Effective systemic therapy capable of reversing the aggressive nature of this disease is currently not available [5]. Therefore, an understanding of the molecular mechanisms of osteosarcoma is one of the most important issues for treatment. New therapeutic strategies are necessary to increase survival rates in patients with osteosarcoma.
Cyclooxygenases are key enzymes in the conversion of arachidonic acid into prostaglandin (PG) and other eicosanoids including PGD2, PGE2, PGF2, PGI2 and thromboxane A2 [6]. There are two isoforms of cyclooxygenase, designated COX-1 and COX-2. COX-1 is constitutively expressed in most tissues, and seems to perform physiological functions [7]. However, COX-2 is an inducible enzyme associated with inflammatory disease and cancer. Many reports have indicated that COX-2 expression is increased in a variety of human malignancies, including osteosarcoma, and is responsible for producing large amounts of PGE2 in tumor tissues [811]. These molecules are thought to play a critical role in tumor growth, because they reduce apoptotic cell death, stimulate angiogenesis and invasiveness [12, 13]. COX-2 overexpression has been associated with poor prognosis in osteosarcoma [14]. Selective COX-2 inhibitors have been shown to significantly reduce the cell proliferation rates as well as invasiveness in U2OS cells [15]. Transgenic mice overexpressing human COX-2 in mammary glands developed focal mammary gland hyperplasia, dysplasia and metastatic tumors [16]. Epidemiological studies have revealed a decreased risk of colon cancer in people who regularly take COX-2 inhibitors [17, 18]. Specifically, COX-2 silencing mediated by RNA interference (RNAi) has been found to be associated with decreased invasion in laryngeal carcinoma [19] and human colon carcinoma. In this report, for the first time, we employed RNAi technology to explore the therapeutic potential of the DNA vector-based shRNA targeting COX-2 for the treatment of human osteosarcoma. Moreover, the mechanism underlying inhibition of angiogenesis and metastasis by targeting COX-2 is not fully understood. Another aim of this study was to establish whether there is a direct relationship between COX-2 expression and VEGF, EGF and bFGF production in osteosarcoma cells.

Methods

Cell culture and infection

The human osteosarcoma cell line, SaOS2 and 293T cells were purchased from the American Type Culture Collection. Cells were grown in 5% CO2 saturated humidity, at 37°C and cultured in DMEM (Gibco, USA) supplemented with penicillin/streptomycin, 2 mmol/L glutamine and 10% FBS. Cells were subcultured at 9 × 104 cells per well into 6-well tissue culture plates. After 24 h culture, cells were infected with recombinant lentivirus vectors at a multiplicity of infection (MOI) of 40.

Design of shRNA and plasmid preparation

We designed and cloned a shRNA template into a lentivirus vector previously used [5]. A third generation self-inactivating lentivirus vector pGCL-GFP containing a CMV-driven GFP reporter and a U6 promoter upstream of the cloning sites. Three coding regions corresponding to targeting human COX-2 (GenBank Accession: NM 000963.2) were selected as siRNA target sequences (Table 1) under the guide of siRNA designing software offered by Genscript. We constructed three shRNA-COX-2 lentivirus vectors, namely LV-COX-2siRNA-1, LV-COX-2siRNA-2 and LV-COX-2siRNA-3, respectively. To detect the interference effects of different target, COX-2 mRNA and protein levels were determined using RT-PCR and western blotting. Recombinant lentivirus vectors and control lentivirus vector were produced by co-transfecting with the lentivirus expression plasmid and packaging plasmids in 293T cells. Infectious lentiviruses were harvested 48 h post-transfection, centrifuged and filtered through 0.45 um cellulose acetate filters. The infectious titer was determined by hole-by-dilution titer assay. The virus titers produced were approximately 109 transducing u/ml medium.
Table 1
Interfering sequence specified for COX-2 gene
 
Sequence
LV-COX-2siRNA-1
Oligo1: 5'TaaACACAGTGCACTACATACTTAtcaagagTAAGTATGTAGTG
CACTGTGTTTTTTTTTC3'
 
Oligo2: 5'TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAA
GTATGTAGTGCACTGTGTTTA3'
LV- COX-2siRNA-2
Oligo1: 5'TaaTCACATTTGATTGACAGTCCAtcaagagTGGACTGTCAATC
AAATGTGA TTTTTTTTC3'
 
Oligo2: 5'TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGG
ACTGTCAATCAAATGTGATTA3'
LV- COX-2siRNA-3
Oligo1: 5'TaaCCTTCTCTAACCTCTCCTATTtcaagagAATAGGAGAGGTT
AGAGAAGGTTTTTTTTC3'
 
Oligo2: 5'TCGAGAAAAAAaaCCTTCTCTAACCTCTCCTATTctcttgaAAT
AGGAGAGGTTAGAGAAGGTTA3'
The three interfering sequence targeted for human COX-2 gene were named LV-COX-2siRNA-1, LV-COX-2siRNA-2 and LV-COX-2siRNA-3, whose coding regions were corresponding to directly at human COX-2 (NM 000963.2) starting at 352, 456 and 517, respectively.

Cell proliferation assay

Cell proliferation was determined by 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. SaOS2 cells were seeded in 96-well culture plates in culture medium at an optimal density (4 × 103 cells per well) in triplicate wells for the parental, LV-Control and LV-COX-2siRNA cells. After 1, 2, 3, 4 and 5 d, cells were stained with 20 ml MTT (5 mg/ml) (Sigma, St Louis, MO, USA) at 37°C for 4 h and subsequently made soluble in 150 ml of DMSO. Absorbance was measured at 490 nm using a microtiter plate reader. Cell growth curves were calculated as mean values of triplicates per group.

Flow cytometry

Cells were collected and washed with PBS, then centrifuged at 800 r/min and fixed with 70% cold ethanol kept at 4°C overnight. Cells were permeabilized in reagent consisting of 0.5% Triton X-100, 230 μg/ml RNase A and 50 μg/ml propidium iodide in PBS. Samples were kept at 37°C for 30 min, followed by flow cytometry analysis (Becton Dickinson FACScan).

Real-time PCR

Total RNA was extracted from cultured cells using Trizol reagent (Invitrogen, USA) for reverse transcription. RNA were synthesized to cDNA using Superscript First-Strand Synthesis Kit (Promega, USA) following the manufacturer's protocols. Quantitative real-time polymerase chain reaction (RT-PCR) assays were carried out using SYBR Green Real-Time PCR Master Mix (Toyobo, Osaka, Japan) and RT-PCR amplification equipment using specific primers: COX-2, sense strand 5'-CCCTTGGGTGTCAAAGGTAAA-3', antisense strand 5'-AAACTGATGCGTGAAGTGCTG-3', COX-1, sense strand 5'-ATGCCACGCTCTGGCTACGTG-3', antisense strand 5'-CTGGGAGCCCACCTTGAAGGAGT-3', β-actin, sense strand 5'-GCGAGCACAGAGCCTCGCCTTTG-3', antisense strand 5'-GATGCCGTGCTCGATGGGGTAC-3', VEGFA sense strand 5'-CGTGTACGTTGGTGCCCGCT-3', antisense strand 5'-TCCTTCCTCCTGCCCGGCTC-3', VEGFB sense strand 5'-CCCAGCTGCGTGACTGTGCA-3', antisense strand 5'-TCAGCTGGGGAGGGTGCTCC-3', VEGFC sense strand 5'-TGTTCTCTGCTCGCCGCTGC-3', antisense strand 5'-TGCATAAGCCGTGGCCTCGC-3', EGF sense strand 5'-TGCTCCTGTGGGATGCAGCA-3', antisense strand 5'-GGGGGTGGAGTAGAGTCAAGACAGT-3', bFGF sense strand 5'-CCCCAGAAAACCCGAGCGAGT-3', antisense strand 5'-GGGCACCGCGTCCGCTAATC-3', The expression of interest genes were determined by normalization of the threshold cycle (Ct) of these genes to that of the control β-actin.

Western blotting

Cells were lysed in RIPA buffer (150 mM NaCl, 100 mM Tris-HCl, 1% Tween-20, 1% sodium deoxycholate and 0.1% SDS) with 0.5 mM EDTA, 1 mM PMSF, 10 μg/ml aprotinin and 1 μg/ml pepstatin. Proteins were resolved in SDS-PAGE and transferred to PVDF membranes, which were probed with appropriate antibodies, The immunoreactive protein complexes were detected by enhanced chemiluminescence (Amersham Bioscience, Boston, MA). The specific antibody used: anti-COX-2 antibody (Cell Signaling, #4842, 1 μg/ml), anti-VEGFA antibody (Abcam, ab51745, 0.1 μg/ml), anti-VEGFB antibody (Cell Signaling, #2463, 1 μg/ml), anti-VEGFC antibody (Cell Signaling, #2445, 1 μg/ml), anti-EGF antibody (Cell Signaling, #2963, 1 μg/ml), anti-bFGF antibody (Cell Signaling, #8910, 1 μg/ml), anti-β-actin antibody (Cell Signaling, #4970, 1 μg/ml).

Invasion assay

Invasion by SaOS2 cells was assayed using 12-well cell culture chambers containing inserts with 8 μm pores coated with matrigel (Corning, USA). The cells were added to the upper chamber at a density of 4 × 104 cells/insert, After 24 h of incubation, cells on the upper surface were wiped off with a cotton swab. Cells that had invaded the lower surface were fixed with 70% ethanol, stained with 0.2% crystal violet, Invasiveness was quantitated by selecting ten different views (100 times) and calculating the number of invading cells.

Migration assay

Migration assays were performed using two-chamber-Transwell (Corning, USA) as described previously [20]. The lower surface of a polycarbonate filter with 8 μm pores was coated with 1 μg/ml bovine collagen IV. Cells were trypsinized and suspended in a serum-free medium containing 1% BSA at a concentration of 4 × 104 cells/insert. The cells were placed in the upper chamber and free DMEM was placed in the lower chamber. After 12 hr at 37°C, the cells in the upper chamber were wiped off with a cotton swab. The cells on the lower surface of the filter were fixed with 70% ethanol, stained with 0.2% crystal violet, migration was quantitated by selecting ten different views (100 times) and calculating the number of migrated cells.

Statistical analysis

All statistical analyses were performed using SPSS 10.0. Data were expressed as mean ± SD. The statistical correlation of data between groups was analyzed by one-way analysis of variance (ANOVA) and Student's t test, where P < 0.05 were considered significant.

Results

Selection of the most effective COX-2 specific shRNA expression vector

To exclude off-target silencing effects mediated by specific shRNA, we employed three different COX-2 shRNAs (shRNA1, shRNA2, shRNA3). Three specific plasmids and the control plasmid were cotransfected with packing plasmid into 293T cells, respectively. 48 h after transfection, GFP expression in 293T cells was observed under a fluorescent microscope (Figure 1a). The level of COX-2 expression was evaluated by RT-PCR and western blotting. Results indicated that all of the COX-2shRNA-1, shRNA-2 and shRNA-3 significantly decreased the COX-2 mRNA and protein levels in 293T cells. According to the results, LV-COX-2siRNA-1 was the most effective lentivirus vector, and was used in the following experiments (Figure 1b and 1c).

Downregulation of COX-2 expression by LV-COX-2siRNA-1 in SaOS2 cells

To explore the effect of LV-COX-2siRNA-1 on the expression of COX-2, GFP expression was observed under a fluorescent microscope in SaOS2 cells 72 h after infection with LV-COX-2siRNA-1 (Figure 2a). RT-PCR was employed to test the mRNA levels of COX-2 in parental, LV-Control and LV-COX-2siRNA-1 cells. The results indicated that LV-COX-2siRNA-1 significantly inhibited mRNA (P = 0.0001) and protein (data not shown) levels of COX-2 compared with the LV-Control and parental SaOS2 cells (Figure 2b). We also found that LV-COX-2siRNA-1 did not affect the COX1 mRNA level in SaOS2 cells compared with the LV-Control and parental SaOS2 cells (Figure 2c), which indicated the efficacy and specificity of LV-COX-2siRNA-1.

Effects of LV-COX-2siRNA-1 on cell growth of SaOS2 cells

To determine the effects of LV-COX-2siRNA-1 on cell proliferation, MTT assays were performed to examine the cell proliferation activity. Cell proliferation was monitored for five days after SaOS2 cells were infected with LV-COX-2siRNA-1 or LV-Control. As shown in Figure 3a, the growth of cells infected with LV-COX-2siRNA-1 was significantly inhibited compared with LV-Control and parental SaOS2 cells.

Effects of LV-COX-2siRNA-1 on cell cycle of SaOS2 cells

The effects of LV-COX-2siRNA-1 on the cell cycle of SaOS2 cells were examined and each experiment was performed in triplicate. SaOS2 cells were infected with LV-COX-2siRNA-1; 72 h after cell proliferation, G1, G2 and S phase of cells were detected by flow cytometric analysis. The percentage of SaOS2 cells infected with LV-COX-2siRNA-1 in the G1 phase significantly increased, while the percentage in the G2 phase notably decreased compared with LV-Control and parental SaOS2 cells. This indicates that RNAi-mediated downregulation of COX-2 expression in SaOS2 cells leads to cell cycle arrest in the G1 phase (Table 2).
Table 2
Cell cycle detected by flow cytometry (%)
Group
G1 fraction
G2 fraction
S fraction
SaOS-2
48.52 ± 1.38
36.40 ± 1.12
18.0 ± 2.08
LV-Control
46.46 ± 1.56
36.42 ± 1.51
17.12 ± 1.78
LV-siRNA-1
58.79 ± 1.54a
25.09 ± 1.16b
16.12 ± 2.16
Cell cycle was detected by flow cytometry. The G1 phase fraction of the LV-COX-2siRNAi-1 cells was markedly increased compared with the LV-control and parental SaOS2 cells. a P < 0.01 compared with LV-control cells. Conversly, The G2 phase fraction of the LV-COX-2siRNAi-1 cells was notably decreased compared with the LV-control and parental SaOS2 cells. b P < 0.001 compared with the LV-control and parental SaOS2 cells.

Effects of LV-COX-2siRNA-1 on invasion and migration ability of SaOS2 cells

Matrix invasion and migration abilities of cancer cells are associated closely with metastatic potential. The in vitro cell invasion and migration assay were performed and the number of invading and migrating cells were counted. Invasion and migration activity of SaOS2 cells were assessed in the various transfectants. As shown in Figure 4a, b and 4c, COX-2 cells infected with LV-COX-2siRNA-1 showed much lower invasion and migration activities compared with the LV-Control and parental SaOS2 cells, which suggested that the knockdown of COX-2 has a direct inhibitory effect on invasion and migration rates of SaOS2 cells.

Effects of LV-COX-2siRNA-1 on VEGF, EGF and bFGF expression in SaOS2 cells

To further elucidate the mechanism of LV-COX-2siRNA-1-mediated downregulation of invasion and migration, the expression of genes associated with angiogenesis were examined. The mRNA levels of vegf, egf and bfgf of SaOS2 cells infected with LV-COX-2siRNA-1 were analyzed by RT-PCR (Figure 5a). Results revealed that the vegfa, egf and bfgf levels were decreased in SaOS2 cells infected with LV-COX-2siRNA-1 compared with the LV-Control and parental SaOS2 cells. Protein expression was evaluated by western blotting (Figure 5b and 5c). Silencing of COX-2 expression by transfection of LV-COX-2siRNA-1 significantly decreased the expression of VEGFA (P = 0.0001), EGF (P < 0.0001) and bFGF (P = 0.02) compared with the LV-Control and SaOS2 cells, while levels of VEGFB and VEGFC had no significant changes.

Discussion

Many reports have indicated that COX-2 is overexpressed in a variety of human malignancies and is responsible for producing a large quantity of PGE2 in tumor tissues [2123]. PGE2 stimulates angiogenesis, promotes cell proliferation and invasiveness, and thus it plays a critical role in tumor growth [24, 25]. In addition, COX-2 expression has been found significantly higher in tumors of higher grade and in more aggressive malignancies [26]. Many policies have been employed to inhibit COX-2 expression and function. Dandekar et al pointed out that reduction of COX-2 suppresses tumor growth and improves efficacy of chemotherapeutic drugs in prostate cancer [2729]. Other groups reported that the COX-2 inhibitors attenuate migration and invasion of breast cancer cells [30]. These data indicate that, as a critical regulator of proliferation of tumor cells, COX-2 is a considerable target for inhibiting growth, triggering apoptosis, and reducing invasion activity.
To this day, there have been many strategies used to inhibit COX-2 expression and activity, including inhibitors and antisense oligonucleotides and RNAi [27, 29, 30]. Selective COX-2 inhibitors both inhibit tumor cell growth and boost chemosensitivity or radiosensitivity of malignancies [31, 32]. To ensure the efficacy and specificity of COX-2 as a therapeutic target, we employed RNAi technology. RNAi refers to the introduction of homologous double stranded RNA (dsRNA) to specifically target a gene's product, resulting in null or hypomorphic phenotypes [33, 34]. It has demonstrated great prospects for studying gene function, signal transduction research and gene therapy. We used RT-PCR and western blotting to proof the efficacy of LV-COX-2siRNA-1 on COX-2 expression in 293T and SaOS2 cells. LV-COX-2siRNA-1 was applied and the expression of COX-2 mRNA and protein were significantly inhibited.
Accumulating evidence has indicated that COX-2 promotes tumor growth, increases cancer cell invasiveness and metastasis through its catalytic activity [35, 36]. Not only COX-2 transfection but also PGE2 treatment enhances cell migration and invasion in various types of human cancers [3741]. In the present study, the invasion and migration ability of the SaOS2 cells were tested and found that COX-2 gene knockdown by RNAi resulted in a decreased level of invasion and migration. Therefore, there is a strong relationship between COX-2 and the invasion or migration ability of human osteosarcoma cells.
It is well known that the growth of tumor cells depends on nutrition supply, which largely relies on angiogenesis. VEGF plays a key role in normal and abnormal angiogenesis since it stimulates almost every step in the angiogenic process [42, 43]. Other factors that have been shown to stimulate angiogenesis include EGF, bFGF, hepatocyte growth factor, interleukin-8, and placental growth factor [44, 45]. Previous work indicated that COX-2 inhibitors blocked tumor growth via an antiangiogenic mechanism [46]. Moreover, studies demonstrated that there is a strong link between COX-2 expression and tumor angiogenesis [47]. Therefore, COX-2 overexpression may increase tumor blood supply and contribute to tumor growth. Our results suggest that knockdown of the COX-2 gene could suppress invasion and migration ability based on the down-regulation of vegfa, egf and bfgf expression in osteosarcoma cells.

Conclusions

Our experimental data demonstrate that RNAi-mediated downregulation of COX-2 effectively inhibited the cell proliferation, reduced invasion and migration ability of SaOS2 cells with the decreased expression of VEGFA, EGF and bFGF. Although the mechanism of this inhibition needs to be further investigated, our results suggest that COX-2 may have a role in angiogenesis and may be a potential therapeutic target for the treatment of human osteosarcoma.

Acknowledgements

This research was supported by grants from the Shanghai Health Bureau Science Fund for Young Scholars (2009Y037), the Technology Development Fundation of Shanghai Jiaotong University School of Medicine (09XJ21048).
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

The authors contributed to this study as follows: QHZ and JWT designed the study;
QHZ, CW and JXZ performed experiments; LW analyzed data; SHD prepared the figures; JWT and GQZ drafted the manuscript. All authors have read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Bacci G, Longhi A, Versari M, Mercuri M, Briccoli A, Picci P: Prognostic factors for osteosarcoma of the extremity treated with neoadjuvant chemotherapy: 15-year experience in 789 patients treated at a single institution. Cancer. 2006, 106: 1154-1161. 10.1002/cncr.21724.CrossRefPubMed Bacci G, Longhi A, Versari M, Mercuri M, Briccoli A, Picci P: Prognostic factors for osteosarcoma of the extremity treated with neoadjuvant chemotherapy: 15-year experience in 789 patients treated at a single institution. Cancer. 2006, 106: 1154-1161. 10.1002/cncr.21724.CrossRefPubMed
2.
Zurück zum Zitat Naruse T, Nishida Y, Hosono K, Ishiguro N: Meloxicam inhibits osteosarcoma growth, invasiveness and metastasis by COX-2-dependent and independent routes. Carcinogenesis. 2006, 27: 584-592. 10.1093/carcin/bgi240.CrossRefPubMed Naruse T, Nishida Y, Hosono K, Ishiguro N: Meloxicam inhibits osteosarcoma growth, invasiveness and metastasis by COX-2-dependent and independent routes. Carcinogenesis. 2006, 27: 584-592. 10.1093/carcin/bgi240.CrossRefPubMed
3.
Zurück zum Zitat Mirabello L, Troisi RJ, Savage SA: Osteosarcoma incidence and survival rates from 1973 to 2004: data from the Surveillance, Epidemiology, and End Results Program. Cancer. 2009, 115: 1531-1543. 10.1002/cncr.24121.PubMedCentralCrossRefPubMed Mirabello L, Troisi RJ, Savage SA: Osteosarcoma incidence and survival rates from 1973 to 2004: data from the Surveillance, Epidemiology, and End Results Program. Cancer. 2009, 115: 1531-1543. 10.1002/cncr.24121.PubMedCentralCrossRefPubMed
4.
Zurück zum Zitat Longhi A, Errani C, De Paolis M, Mercuri M, Bacci G: Primary bone osteosarcoma in the pediatric age: State of the art. Cancer Treatment Reviews. 2006, 32: 423-436. 10.1016/j.ctrv.2006.05.005.CrossRefPubMed Longhi A, Errani C, De Paolis M, Mercuri M, Bacci G: Primary bone osteosarcoma in the pediatric age: State of the art. Cancer Treatment Reviews. 2006, 32: 423-436. 10.1016/j.ctrv.2006.05.005.CrossRefPubMed
5.
Zurück zum Zitat Yang G, Huang C, Cao J, Huang KJ, Jiang T, Qiu ZJ: Lentivirus-mediated shRNA interference targeting STAT3 inhibits human pancreatic cancer cell invasion. World J Gastroenterol. 2009, 15: 3757-3766. 10.3748/wjg.15.3757.PubMedCentralCrossRefPubMed Yang G, Huang C, Cao J, Huang KJ, Jiang T, Qiu ZJ: Lentivirus-mediated shRNA interference targeting STAT3 inhibits human pancreatic cancer cell invasion. World J Gastroenterol. 2009, 15: 3757-3766. 10.3748/wjg.15.3757.PubMedCentralCrossRefPubMed
6.
Zurück zum Zitat Brown JR, DuBois RN: COX-2: a molecular target for colorectal cancer prevention. J Clin Oncol. 2005, 23: 2840-2855. 10.1200/JCO.2005.09.051.CrossRefPubMed Brown JR, DuBois RN: COX-2: a molecular target for colorectal cancer prevention. J Clin Oncol. 2005, 23: 2840-2855. 10.1200/JCO.2005.09.051.CrossRefPubMed
7.
Zurück zum Zitat Strillacci A, Griffoni C, Valerii MC, Lazzarini G, Tomasi V, Spisni E: RNAi-based strategies for cyclooxygenase-2 inhibition in cancer. J Biomed Biotechnol. 2010, 2010: 828045-PubMedCentralCrossRefPubMed Strillacci A, Griffoni C, Valerii MC, Lazzarini G, Tomasi V, Spisni E: RNAi-based strategies for cyclooxygenase-2 inhibition in cancer. J Biomed Biotechnol. 2010, 2010: 828045-PubMedCentralCrossRefPubMed
8.
Zurück zum Zitat Denkert C, Kobel M, Berger S, Siegert A, Leclere A, Trefzer U: Expression of cyclooxygenase 2 in human malignant melanoma. Cancer Research. 2001, 61: 303-308.PubMed Denkert C, Kobel M, Berger S, Siegert A, Leclere A, Trefzer U: Expression of cyclooxygenase 2 in human malignant melanoma. Cancer Research. 2001, 61: 303-308.PubMed
9.
Zurück zum Zitat Masferrer JL, Leahy KM, Koki AT, Zweifel BS, Settle SL, Woerner BM: Antiangiogenic and antitumor activities of cyclooxygenase-2 inhibitors. Cancer Res. 2000, 60: 1306-1311.PubMed Masferrer JL, Leahy KM, Koki AT, Zweifel BS, Settle SL, Woerner BM: Antiangiogenic and antitumor activities of cyclooxygenase-2 inhibitors. Cancer Res. 2000, 60: 1306-1311.PubMed
10.
Zurück zum Zitat Kulkarni S, Rader JS, Zhang F, Liapis H, Koki AT, Masferrer JL: Cyclooxygenase-2 is overexpressed in human cervical cancer. Clinical Cancer Research. 2001, 7: 429-434.PubMed Kulkarni S, Rader JS, Zhang F, Liapis H, Koki AT, Masferrer JL: Cyclooxygenase-2 is overexpressed in human cervical cancer. Clinical Cancer Research. 2001, 7: 429-434.PubMed
11.
Zurück zum Zitat Kokawa A, Kondo H, Gotoda T, Ono H, Saito D, Nakadaira S: Increased expression of cyclooxygenase-2 in human pancreatic neoplasms and potential for chemoprevention by cyclooxygenase inhibitors. Cancer. 2001, 91: 333-338. 10.1002/1097-0142(20010115)91:2<333::AID-CNCR1006>3.0.CO;2-N.CrossRefPubMed Kokawa A, Kondo H, Gotoda T, Ono H, Saito D, Nakadaira S: Increased expression of cyclooxygenase-2 in human pancreatic neoplasms and potential for chemoprevention by cyclooxygenase inhibitors. Cancer. 2001, 91: 333-338. 10.1002/1097-0142(20010115)91:2<333::AID-CNCR1006>3.0.CO;2-N.CrossRefPubMed
12.
Zurück zum Zitat Tsujii M, Kawano S, Tsuji S, Sawaoka H, Hori M, DuBois RN: Cyclooxygenase regulates angiogenesis induced by colon cancer cells. Cell. 1998, 93: 705-716. 10.1016/S0092-8674(00)81433-6.CrossRefPubMed Tsujii M, Kawano S, Tsuji S, Sawaoka H, Hori M, DuBois RN: Cyclooxygenase regulates angiogenesis induced by colon cancer cells. Cell. 1998, 93: 705-716. 10.1016/S0092-8674(00)81433-6.CrossRefPubMed
13.
Zurück zum Zitat Sawaoka H, Kawano S, Tsuji S, Tsujii M, Gunawan ES, Takei Y: Cyclooxygenase-2 inhibitors suppress the growth of gastric cancer xenografts via induction of apoptosis in nude mice. Am J Physiol. 1998, 274: G1061-1067.PubMed Sawaoka H, Kawano S, Tsuji S, Tsujii M, Gunawan ES, Takei Y: Cyclooxygenase-2 inhibitors suppress the growth of gastric cancer xenografts via induction of apoptosis in nude mice. Am J Physiol. 1998, 274: G1061-1067.PubMed
14.
Zurück zum Zitat Khuri FR, Wu H, Lee JJ, Kemp BL, Lotan R, Lippman SM: Cyclooxygenase-2 overexpression is a marker of poor prognosis in stage I non-small cell lung cancer. Clinical Cancer Research. 2001, 7: 861-867.PubMed Khuri FR, Wu H, Lee JJ, Kemp BL, Lotan R, Lippman SM: Cyclooxygenase-2 overexpression is a marker of poor prognosis in stage I non-small cell lung cancer. Clinical Cancer Research. 2001, 7: 861-867.PubMed
15.
Zurück zum Zitat Xu Z, Choudhary S, Voznesensky O, Mehrotra M, Woodard M, Hansen M: Overexpression of COX-2 in human osteosarcoma cells decreases proliferation and increases apoptosis. Cancer Res. 2006, 66: 6657-6664. 10.1158/0008-5472.CAN-05-3624.CrossRefPubMed Xu Z, Choudhary S, Voznesensky O, Mehrotra M, Woodard M, Hansen M: Overexpression of COX-2 in human osteosarcoma cells decreases proliferation and increases apoptosis. Cancer Res. 2006, 66: 6657-6664. 10.1158/0008-5472.CAN-05-3624.CrossRefPubMed
16.
Zurück zum Zitat Klein RD, Van Pelt CS, Sabichi AL, Dela Cerda J, Fischer SM, Furstenberger G: Transitional cell hyperplasia and carcinomas in urinary bladders of transgenic mice with keratin 5 promoter-driven cyclooxygenase-2 overexpression. Cancer Res. 2005, 65: 1808-1813. 10.1158/0008-5472.CAN-04-3567.CrossRefPubMed Klein RD, Van Pelt CS, Sabichi AL, Dela Cerda J, Fischer SM, Furstenberger G: Transitional cell hyperplasia and carcinomas in urinary bladders of transgenic mice with keratin 5 promoter-driven cyclooxygenase-2 overexpression. Cancer Res. 2005, 65: 1808-1813. 10.1158/0008-5472.CAN-04-3567.CrossRefPubMed
17.
Zurück zum Zitat Thun MJ, Henley SJ, Patrono C: Nonsteroidal anti-inflammatory drugs as anticancer agents: mechanistic, pharmacologic, and clinical issues. J Natl Cancer Inst. 2002, 94: 252-266.CrossRefPubMed Thun MJ, Henley SJ, Patrono C: Nonsteroidal anti-inflammatory drugs as anticancer agents: mechanistic, pharmacologic, and clinical issues. J Natl Cancer Inst. 2002, 94: 252-266.CrossRefPubMed
18.
Zurück zum Zitat Fosslien E: Biochemistry of cyclooxygenase (COX)-2 inhibitors and molecular pathology of COX-2 in neoplasia. Crit Rev Clin Lab Sci. 2000, 37: 431-502. 10.1080/10408360091174286.CrossRefPubMed Fosslien E: Biochemistry of cyclooxygenase (COX)-2 inhibitors and molecular pathology of COX-2 in neoplasia. Crit Rev Clin Lab Sci. 2000, 37: 431-502. 10.1080/10408360091174286.CrossRefPubMed
19.
Zurück zum Zitat Wang R, Wang X, Lin F, Gao P, Dong K, Zhang HZ: shRNA-targeted cyclooxygenase (COX)-2 inhibits proliferation, reduces invasion and enhances chemosensitivity in laryngeal carcinoma cells. Mol Cell Biochem. 2008, 317: 179-188. 10.1007/s11010-008-9847-9.CrossRefPubMed Wang R, Wang X, Lin F, Gao P, Dong K, Zhang HZ: shRNA-targeted cyclooxygenase (COX)-2 inhibits proliferation, reduces invasion and enhances chemosensitivity in laryngeal carcinoma cells. Mol Cell Biochem. 2008, 317: 179-188. 10.1007/s11010-008-9847-9.CrossRefPubMed
20.
Zurück zum Zitat Fujita H, Koshida K, Keller ET, Takahashi Y, Yoshimito T, Namiki M: Cyclooxygenase-2 promotes prostate cancer progression. Prostate. 2002, 53: 232-240. 10.1002/pros.10152.CrossRefPubMed Fujita H, Koshida K, Keller ET, Takahashi Y, Yoshimito T, Namiki M: Cyclooxygenase-2 promotes prostate cancer progression. Prostate. 2002, 53: 232-240. 10.1002/pros.10152.CrossRefPubMed
21.
Zurück zum Zitat Klimp AH, Hollema H, Kempinga C, van der Zee AG, de Vries EG, Daemen T: Expression of cyclooxygenase-2 and inducible nitric oxide synthase in human ovarian tumors and tumor-associated macrophages. Cancer Res. 2001, 61: 7305-7309.PubMed Klimp AH, Hollema H, Kempinga C, van der Zee AG, de Vries EG, Daemen T: Expression of cyclooxygenase-2 and inducible nitric oxide synthase in human ovarian tumors and tumor-associated macrophages. Cancer Res. 2001, 61: 7305-7309.PubMed
22.
Zurück zum Zitat Hida T, Yatabe Y, Achiwa H, Muramatsu H, Kozaki K, Nakamura S: Increased expression of cyclooxygenase 2 occurs frequently in human lung cancers, specifically in adenocarcinomas. Cancer Res. 1998, 58: 3761-3764.PubMed Hida T, Yatabe Y, Achiwa H, Muramatsu H, Kozaki K, Nakamura S: Increased expression of cyclooxygenase 2 occurs frequently in human lung cancers, specifically in adenocarcinomas. Cancer Res. 1998, 58: 3761-3764.PubMed
23.
Zurück zum Zitat Hwang D, Scollard D, Byrne J, Levine E: Expression of cyclooxygenase-1 and cyclooxygenase-2 in human breast cancer. J Natl Cancer Inst. 1998, 90: 455-460. 10.1093/jnci/90.6.455.CrossRefPubMed Hwang D, Scollard D, Byrne J, Levine E: Expression of cyclooxygenase-1 and cyclooxygenase-2 in human breast cancer. J Natl Cancer Inst. 1998, 90: 455-460. 10.1093/jnci/90.6.455.CrossRefPubMed
24.
Zurück zum Zitat Attiga FA, Fernandez PM, Weeraratna AT, Manyak MJ, Patierno SR: Inhibitors of prostaglandin synthesis inhibit human prostate tumor cell invasiveness and reduce the release of matrix metalloproteinases. Cancer Res. 2000, 4629-4637. 2000/09/02 ed Attiga FA, Fernandez PM, Weeraratna AT, Manyak MJ, Patierno SR: Inhibitors of prostaglandin synthesis inhibit human prostate tumor cell invasiveness and reduce the release of matrix metalloproteinases. Cancer Res. 2000, 4629-4637. 2000/09/02 ed
25.
Zurück zum Zitat Tsujii M, DuBois RN: Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing prostaglandin endoperoxide synthase 2. Cell. 1995, 83: 493-501. 10.1016/0092-8674(95)90127-2.CrossRefPubMed Tsujii M, DuBois RN: Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing prostaglandin endoperoxide synthase 2. Cell. 1995, 83: 493-501. 10.1016/0092-8674(95)90127-2.CrossRefPubMed
26.
Zurück zum Zitat Fujita T, Matsui M, Takaku K, Uetake H, Ichikawa W, Taketo MM: Size- and invasion-dependent increase in cyclooxygenase 2 levels in human colorectal carcinomas. Cancer Res. 1998, 58: 4823-4826.PubMed Fujita T, Matsui M, Takaku K, Uetake H, Ichikawa W, Taketo MM: Size- and invasion-dependent increase in cyclooxygenase 2 levels in human colorectal carcinomas. Cancer Res. 1998, 58: 4823-4826.PubMed
27.
Zurück zum Zitat Dandekar DS, Lokeshwar BL: Inhibition of cyclooxygenase (COX)-2 expression by Tet-inducible COX-2 antisense cDNA in hormone-refractory prostate cancer significantly slows tumor growth and improves efficacy of chemotherapeutic drugs. Clin Cancer Res. 2004, 10: 8037-8047. 10.1158/1078-0432.CCR-04-1208.CrossRefPubMed Dandekar DS, Lokeshwar BL: Inhibition of cyclooxygenase (COX)-2 expression by Tet-inducible COX-2 antisense cDNA in hormone-refractory prostate cancer significantly slows tumor growth and improves efficacy of chemotherapeutic drugs. Clin Cancer Res. 2004, 10: 8037-8047. 10.1158/1078-0432.CCR-04-1208.CrossRefPubMed
28.
Zurück zum Zitat Saikawa Y, Sugiura T, Toriumi F, Kubota T, Suganuma K, Isshiki S: Cyclooxygenase-2 gene induction causes CDDP resistance in colon cancer cell line, HCT-15. Anticancer Res. 2004, 24: 2723-2728.PubMed Saikawa Y, Sugiura T, Toriumi F, Kubota T, Suganuma K, Isshiki S: Cyclooxygenase-2 gene induction causes CDDP resistance in colon cancer cell line, HCT-15. Anticancer Res. 2004, 24: 2723-2728.PubMed
29.
Zurück zum Zitat Chan MW, Wong CY, Cheng AS, Chan VY, Chan KK, To KF: Targeted inhibition of COX-2 expression by RNA interference suppresses tumor growth and potentiates chemosensitivity to cisplatin in human gastric cancer cells. Oncol Rep. 2007, 18: 1557-1562.PubMed Chan MW, Wong CY, Cheng AS, Chan VY, Chan KK, To KF: Targeted inhibition of COX-2 expression by RNA interference suppresses tumor growth and potentiates chemosensitivity to cisplatin in human gastric cancer cells. Oncol Rep. 2007, 18: 1557-1562.PubMed
30.
Zurück zum Zitat Larkins TL, Nowell M, Singh S, Sanford GL: Inhibition of cyclooxygenase-2 decreases breast cancer cell motility, invasion and matrix metalloproteinase expression. BMC Cancer. 2006, 6: 181-10.1186/1471-2407-6-181.PubMedCentralCrossRefPubMed Larkins TL, Nowell M, Singh S, Sanford GL: Inhibition of cyclooxygenase-2 decreases breast cancer cell motility, invasion and matrix metalloproteinase expression. BMC Cancer. 2006, 6: 181-10.1186/1471-2407-6-181.PubMedCentralCrossRefPubMed
31.
Zurück zum Zitat van Wijngaarden J, van Beek E, van Rossum G, van der Bent C, Hoekman K, van der Pluijm G: Celecoxib enhances doxorubicin-induced cytotoxicity in MDA-MB231 cells by NF-kappaB-mediated increase of intracellular doxorubicin accumulation. Eur J Cancer. 2007, 43: 433-442. 10.1016/j.ejca.2006.09.010.CrossRefPubMed van Wijngaarden J, van Beek E, van Rossum G, van der Bent C, Hoekman K, van der Pluijm G: Celecoxib enhances doxorubicin-induced cytotoxicity in MDA-MB231 cells by NF-kappaB-mediated increase of intracellular doxorubicin accumulation. Eur J Cancer. 2007, 43: 433-442. 10.1016/j.ejca.2006.09.010.CrossRefPubMed
32.
Zurück zum Zitat Banu N, Buda A, Chell S, Elder D, Moorghen M, Paraskeva C: Inhibition of COX-2 with NS-398 decreases colon cancer cell motility through blocking epidermal growth factor receptor transactivation: possibilities for combination therapy. Cell Proliferation. 2007, 40: 768-779. 10.1111/j.1365-2184.2007.00459.x.CrossRefPubMed Banu N, Buda A, Chell S, Elder D, Moorghen M, Paraskeva C: Inhibition of COX-2 with NS-398 decreases colon cancer cell motility through blocking epidermal growth factor receptor transactivation: possibilities for combination therapy. Cell Proliferation. 2007, 40: 768-779. 10.1111/j.1365-2184.2007.00459.x.CrossRefPubMed
33.
Zurück zum Zitat Zamore PD: RNA interference: listening to the sound of silence. Nat Struct Biol. 2001, 8: 746-750. 10.1038/nsb0901-746.CrossRefPubMed Zamore PD: RNA interference: listening to the sound of silence. Nat Struct Biol. 2001, 8: 746-750. 10.1038/nsb0901-746.CrossRefPubMed
34.
Zurück zum Zitat Gomase VS, Tagore S: RNAi--a tool for target finding in new drug development. Curr Drug Metab. 2008, 9: 241-244. 10.2174/138920008783884777.CrossRefPubMed Gomase VS, Tagore S: RNAi--a tool for target finding in new drug development. Curr Drug Metab. 2008, 9: 241-244. 10.2174/138920008783884777.CrossRefPubMed
35.
Zurück zum Zitat Lee EJ, Choi EM, Kim SR, Park JH, Kim H, Ha KS: Cyclooxygenase-2 promotes cell proliferation, migration and invasion in U2OS human osteosarcoma cells. Exp Mol Med. 2007, 39: 469-476.CrossRefPubMed Lee EJ, Choi EM, Kim SR, Park JH, Kim H, Ha KS: Cyclooxygenase-2 promotes cell proliferation, migration and invasion in U2OS human osteosarcoma cells. Exp Mol Med. 2007, 39: 469-476.CrossRefPubMed
36.
Zurück zum Zitat Minter HA, Eveson JW, Huntley S, Elder DJ, Hague A: The cyclooxygenase 2-selective inhibitor NS398 inhibits proliferation of oral carcinoma cell lines by mechanisms dependent and independent of reduced prostaglandin E2 synthesis. Clin Cancer Res. 2003, 9: 1885-1897.PubMed Minter HA, Eveson JW, Huntley S, Elder DJ, Hague A: The cyclooxygenase 2-selective inhibitor NS398 inhibits proliferation of oral carcinoma cell lines by mechanisms dependent and independent of reduced prostaglandin E2 synthesis. Clin Cancer Res. 2003, 9: 1885-1897.PubMed
37.
Zurück zum Zitat Tsujii M, Kawano S, DuBois RN: Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential. Proc Natl Acad Sci USA. 1997, 94: 3336-3340. 10.1073/pnas.94.7.3336.PubMedCentralCrossRefPubMed Tsujii M, Kawano S, DuBois RN: Cyclooxygenase-2 expression in human colon cancer cells increases metastatic potential. Proc Natl Acad Sci USA. 1997, 94: 3336-3340. 10.1073/pnas.94.7.3336.PubMedCentralCrossRefPubMed
38.
Zurück zum Zitat Sheng H, Shao J, Washington MK, DuBois RN: Prostaglandin E2 increases growth and motility of colorectal carcinoma cells. J Biol Chem. 2001, 276: 18075-18081. 10.1074/jbc.M009689200.CrossRefPubMed Sheng H, Shao J, Washington MK, DuBois RN: Prostaglandin E2 increases growth and motility of colorectal carcinoma cells. J Biol Chem. 2001, 276: 18075-18081. 10.1074/jbc.M009689200.CrossRefPubMed
39.
Zurück zum Zitat Li G, Yang T, Yan J: Cyclooxygenase-2 increased the angiogenic and metastatic potential of tumor cells. Biochem Biophys Res Commun. 2002, 299: 886-890. 10.1016/S0006-291X(02)02707-9.CrossRefPubMed Li G, Yang T, Yan J: Cyclooxygenase-2 increased the angiogenic and metastatic potential of tumor cells. Biochem Biophys Res Commun. 2002, 299: 886-890. 10.1016/S0006-291X(02)02707-9.CrossRefPubMed
40.
Zurück zum Zitat Han C, Wu T: Cyclooxygenase-2-derived prostaglandin E2 promotes human cholangiocarcinoma cell growth and invasion through EP1 receptor-mediated activation of the epidermal growth factor receptor and Akt. J Biol Chem. 2005, 280: 24053-24063. 10.1074/jbc.M500562200.CrossRefPubMed Han C, Wu T: Cyclooxygenase-2-derived prostaglandin E2 promotes human cholangiocarcinoma cell growth and invasion through EP1 receptor-mediated activation of the epidermal growth factor receptor and Akt. J Biol Chem. 2005, 280: 24053-24063. 10.1074/jbc.M500562200.CrossRefPubMed
41.
Zurück zum Zitat Singh B, Berry JA, Shoher A, Ramakrishnan V, Lucci A: COX-2 overexpression increases motility and invasion of breast cancer cells. Int J Oncol. 2005, 26: 1393-1399.PubMed Singh B, Berry JA, Shoher A, Ramakrishnan V, Lucci A: COX-2 overexpression increases motility and invasion of breast cancer cells. Int J Oncol. 2005, 26: 1393-1399.PubMed
42.
Zurück zum Zitat Folkman J: Angiogenesis-dependent diseases. Semin Oncol. 2001, 28: 536-542. 10.1016/S0093-7754(01)90021-1.CrossRefPubMed Folkman J: Angiogenesis-dependent diseases. Semin Oncol. 2001, 28: 536-542. 10.1016/S0093-7754(01)90021-1.CrossRefPubMed
43.
Zurück zum Zitat Liekens S, De Clercq E, Neyts J: Angiogenesis: regulators and clinical applications. Biochem Pharmacol. 2001, 61: 253-270. 10.1016/S0006-2952(00)00529-3.CrossRefPubMed Liekens S, De Clercq E, Neyts J: Angiogenesis: regulators and clinical applications. Biochem Pharmacol. 2001, 61: 253-270. 10.1016/S0006-2952(00)00529-3.CrossRefPubMed
44.
Zurück zum Zitat Bellamy WT, Richter L, Sirjani D, Roxas C, Glinsmann-Gibson B, Frutiger Y: Vascular endothelial cell growth factor is an autocrine promoter of abnormal localized immature myeloid precursors and leukemia progenitor formation in myelodysplastic syndromes. Blood. 2001, 97: 1427-1434. 10.1182/blood.V97.5.1427.CrossRefPubMed Bellamy WT, Richter L, Sirjani D, Roxas C, Glinsmann-Gibson B, Frutiger Y: Vascular endothelial cell growth factor is an autocrine promoter of abnormal localized immature myeloid precursors and leukemia progenitor formation in myelodysplastic syndromes. Blood. 2001, 97: 1427-1434. 10.1182/blood.V97.5.1427.CrossRefPubMed
45.
Zurück zum Zitat Yoshida S, Ono M, Shono T, Izumi H, Ishibashi T, Suzuki H: Involvement of interleukin-8, vascular endothelial growth factor, and basic fibroblast growth factor in tumor necrosis factor alpha-dependent angiogenesis. Mol Cell Biol. 1997, 17: 4015-4023.PubMedCentralCrossRefPubMed Yoshida S, Ono M, Shono T, Izumi H, Ishibashi T, Suzuki H: Involvement of interleukin-8, vascular endothelial growth factor, and basic fibroblast growth factor in tumor necrosis factor alpha-dependent angiogenesis. Mol Cell Biol. 1997, 17: 4015-4023.PubMedCentralCrossRefPubMed
46.
Zurück zum Zitat Leahy KM, Ornberg RL, Wang Y, Zweifel BS, Koki AT, Masferrer JL: Cyclooxygenase-2 inhibition by celecoxib reduces proliferation and induces apoptosis in angiogenic endothelial cells in vivo. Cancer Res. 2002, 62: 625-631.PubMed Leahy KM, Ornberg RL, Wang Y, Zweifel BS, Koki AT, Masferrer JL: Cyclooxygenase-2 inhibition by celecoxib reduces proliferation and induces apoptosis in angiogenic endothelial cells in vivo. Cancer Res. 2002, 62: 625-631.PubMed
47.
Zurück zum Zitat Macpherson GR, Ng SSW, Lakhani NJ, Price DK, Venitz J, Figg WD: Antiangiogenesis therapeutic strategies in prostate cancer. Cancer and Metastasis Reviews. 2002, 21: 93-106. 10.1023/A:1020128708223.CrossRefPubMed Macpherson GR, Ng SSW, Lakhani NJ, Price DK, Venitz J, Figg WD: Antiangiogenesis therapeutic strategies in prostate cancer. Cancer and Metastasis Reviews. 2002, 21: 93-106. 10.1023/A:1020128708223.CrossRefPubMed
Metadaten
Titel
RNAi-mediated knockdown of cyclooxygenase2 inhibits the growth, invasion and migration of SaOS2 human osteosarcoma cells: a case control study
verfasst von
Qinghua Zhao
Chuan Wang
Jiaxue Zhu
Lei Wang
Shuanghai Dong
Guoqiao Zhang
Jiwei Tian
Publikationsdatum
01.12.2011
Verlag
BioMed Central
Erschienen in
Journal of Experimental & Clinical Cancer Research / Ausgabe 1/2011
Elektronische ISSN: 1756-9966
DOI
https://doi.org/10.1186/1756-9966-30-26

Weitere Artikel der Ausgabe 1/2011

Journal of Experimental & Clinical Cancer Research 1/2011 Zur Ausgabe

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.