Introduction
Behçet's disease (BD) is an inflammatory disorder of unknown cause, characterized by recurrent oral aphthous ulcers, genital ulcers, uveitis, and skin lesions [
1]. A close association of the human leukocyte antigen (HLA)-B51 allele with the disease suggests that genetic predisposition contributes to susceptibility to BD [
2]. In addition, infections with agents such as herpes simplex virus [
3,
4] and
Streptococcus sanguis [
5] has been implicated in the development of BD, although no specific infectious agent has been identified as its cause [
6]. Rather, several reports have suggested that ubiquitous antigens presented by micro-organisms, such as heat shock proteins (HSPs), trigger crossreactive autoimmune responses through molecular mimicry machinery, which results in BD [
6].
Not just acquired but also innate immune systems are activated in BD, because hyperfunction of neutrophils is a hallmark of the disease [
7]. However, the immunopathological mechanisms remain uncertain. Toll-like receptors (TLRs), which are expressed on phagocytes and other cells, recognize 'pathogen-associated molecular patterns' in microbes and mediate inflammatory signal transduction [
8,
9]. TLR2 and TLR4 recognize lipoproteins and lipopolysaccharide (LPS), respectively. Furthermore, both receptors also bind to the endogenous 60 kDa HSP (HSP60), leading to cell activation [
10,
11]. It is becoming clear that TLRs are involved in systemic autoimmune disorders, because it was recently demonstrated TLR2 and TLR4 are involved in rheumatoid arthritis (RA) [
12‐
14] and TLR9 in systemic lupus erythematosus [
15,
16]. These findings have led to the hypothesis that microbial antigens not only trigger autoimmune responses through specific T-cell receptors but they also activate the innate immune system through the TLRs, leading to the inflammation that is characteristic of BD [
17].
Few studies have been conducted to investigate the role played by the regulatory systems in inflammatory diseases of humans, including BD. We are interested in heme oxygenase (HO)-1, because accumulating evidence suggests that HO-1 protects the host in a variety of pathologic conditions [
18,
19]. Our laboratory has demonstrated the beneficial role of HO-1 in inflammatory lung disease [
20] and lupus nephritis [
21]. On the other hand, a deficiency in HO-1 expression is associated with severe chronic inflammation, as demonstrated by studies conducted in HO-1 knockout mice [
22] and observations in a patient with HO-1 deficiency [
23]. These findings are consistent with the notion that HO-1 plays a physiologic role in protecting against inflammation. Furthermore, our recent studies [
24‐
26] have demonstrated substantial pathologic roles of HO-1 in rheumatic diseases. Abundant expression of HO-1 was identified in synovial tissues of patients with RA, in the absence of elevated serum HO-1 levels [
24,
25]. Further analysis using RA synovial cell lines suggests that HO-1 plays a regulatory role in RA inflammation [
25]. Our recent study [
26] showed that tumor necrosis factor (TNF) suppresses HO-1 expression in human monocytes, leading to augmentation of inflammatory responses, and that clinical efficacy of anti-TNF therapy is associated with restoration of HO-1 expression in circulating monocytes from patients with RA [
26]. In another study [
20], HO-1 gene therapy successfully ameliorated lung injury induced by LPS, which stimulates the innate immune system through TLR4. It is thus of interest to study the relationship between TLRs, as activating factors, and HO-1, as a regulatory factor of inflammatory responses in inflammatory disorders.
In the present study, mRNA expression levels of HO-1, TLR2, and TLR4 in circulating leukocytes from BD patients were determined. The data suggest that activation signals through essentially over-expressed TLR4 cause reduction in HO-1 expression in peripheral blood mononuclear cells (PBMC), resulting in an augmentation of inflammatory responses in BD.
Materials and methods
Patients and healthy donors
Thirty-three patients with BD, who met the International Study Group criteria for diagnosis of BD [
27], were enrolled in the study. Their mean age was 47.7 ± 15.0 years, and 13 were male and 20 were female.
All of the patients were under the care of the Yokohama City University Hospital. As previously described [
28], 13 patients with one or more lesions (including genital ulcers, uveitis, erythema nodosum, arthritis, gastrointestinal lesions, central nervous system lesions, and/or C-reactive protein >10 mg/l) were regarded to have active disease during the study.
The patients had been treated with a combination of the following agents: colchicines (17 patients), corticosteroids (13 patients), nonsteroidal anti-inflammatory drugs (14 patients), sulfasalazine (two patients), and cytotoxic drugs such as methotrexate (one patient), cyclosporine (four patients), tacrolimus (one patient) and cyclophosphamide (one patient). Thirty healthy age- and sex-matched individuals were also included as a control group. HLA-B type was determined by SRL Inc. (Tokyo, Japan) using lymphocyte cytotoxicity assay or a PCR reverse sequence specific oligonucleotides method. All experiments were conducted after written informed consent has been obtained, which was approved by the local institutional review board.
Reagents
Reagents were obtained from the following manufactures: recombinant human TNF-α (R&D; Minneapolis, MN, USA), polymyxin B and LPS Escherichia coli O111: B4 (Calbiochem; La Jolla, CA, USA), low endotoxin recombinant human HSP60 (Stressgen; Victoria, Canada), and IgG1κ (Serotech; Oxford, UK). Infliximab was kindly provided by Tanabe Seiyaku (Osaka, Japan).
Cell preparation and culture
PBMCs and polymorphonuclear leukocytes (PMNs) were isolated by centrifugation over two Ficoll-Hypaques gradients of specific gravities 1.077 (ICN; Aurora, OH, USA) and 1.119 (Nacalai; Kyoto, Japan). Purity of the separated neutrophils, which were determined by flow cytomeric scattergram, was typically above 97% [
7]. Monocytes were negatively selected by magnetic cell sorting (Miltenyi Biotec; Gladbach, Germany) using a monocyte isolation kit (Miltenyi Biotec). More than 95% of the obtained monocytes expressed CD14, based on flowcytomeric analysis [
26].
The cells were incubated in hepes modified RPMI1640 (Sigma-Aldrich; Saint Louis, MO, USA) containing 10% fetal calf serum (Equitech-bio; Kerrville, TX, USA), 2 mmol/l L-glutamine (Sigma-Aldrich), 100 U/ml penicillin plus 100 μg/ml streptomycin (Sigma-Aldrich) in a 5% carbon dioxide in an air incubator at 37°C. To determine HO-1 expression at mRNA and protein levels, cells were cultured in the presence or absence of LPS (10 ng/ml) or HSP60 (3 μg/ml) for 6 to 24 hours.
Transfection
Purified monocytes (1 × 10
6) were transfected with 3 μg of human HO-1 expression vector or control vector by using Nucleofector (Amaxa Biosystems; Gaithersburg, MD, USA) and human monocyte Nucleofector kit (Amaxa Biosystems) [
25,
26]. Twenty four hours later, the cells were used for further experiments.
Reverse transcription PCR and Real-time PCR
Total RNA was isolated from cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) [
21,
24‐
26]. One microgram of total RNA served as a template for single-stranded cDNA synthesis in a reaction using oligo (dT) primers and SuperScript II (Invitrogen). For the reverse transcription PCR, 1 μl cDNA was incubated with 9.375 μl de-ionized distilled water, 2 μl dNTP, 2.5 μl 10 × PCR buffer, 0.125 μl Taq polymerase (Takara, Ohtsu, Japan), and primer pairs for target genes. The primers used in the study are summarized in Table
1.
Table 1
Primers used in the study
HO-1 | Sense |
CAGGCAGAGAATGCTGAG
|
| Antisense |
GCTTCACATAGCGCTGCA
|
TLR2 | Sense |
TGACTGCTCGGAGTTCTCCC
|
| Antisense |
GTCAGCACCAGAGCCTGGAG
|
TLR4 | Sense |
GCGGCTCGAGGAAGAGAAGA
|
| Antisense |
AGGCTCTGATATGCCCCATC
|
GAPDH | Sense |
ACAGTCAGCCGCATC
|
| Antisense |
AGGTGCGGCTCCCTA
|
TNF-α | Sense |
ATGAGCACTGAAAGCATGATC
|
| Antisense |
GGCGATGCGGCTGATGGT
|
CD14 | Sense |
CGGCCGAAGAGTTCACAAGT
|
| Antisense |
AGTGCAGTCCTGTGGCTTC
|
MD-2 | Sense |
TAAATCTTTTCTGCTTACTGA
|
| Antisense |
TACTCAATTTATTCTAATTTGAAT
|
Cycling conditions included 35 cycles of amplification for 30 seconds at 94°C, 30 seconds at 55°C, 1 minute at 72°C, and a final extension phase consisting of one cycle of 10 minutes at 72°C. The primers and probes for human HO-1, TLR2, TLR4, CD14, TNF-α, MD-2 (Myeloid differentiation factor-2), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) used in the real-time PCR were purchased from PE Applied Biosystems (Foster City, CA, USA). Real-time PCR was performed using a BD Qtaq DNA polymerase (BD Bioscience), and the data were analyzed by the ABI prism 7700 sequence detection system (PE Applied Biosystems, Franklin Lakes, NJ, USA). Briefly, 1/50 of cDNA derived from 1 μg total RNA, 200 nmol/l probe, and 800 nmol/l primers were incubated in 25 μl at 50°C for 2 minutes and 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The analysis system determined the number of cycles at which the amplified DNA in the sample exceeded the threshold during the PCR. Gene expression levels of the individual samples were calculated on standard curves of each cDNA generated by serial dilutions of the PCR amplified products. The data on HO-1, TLR2, TLR4, and TNF-α were standardized to the expression of GAPDH in the same samples, using multiplex PCR technique. Expression level of HO-1 mRNA in a sample is indicated as arbitrary units.
Immunoblot analysis
The expression of HO-1 protein was determined by immunoblotting as described previously [
25]. Briefly, cells were treated with lysis buffer (137 mmol/l NaCl, 20 mmol/l Tris-HCl, 50 mmol/l NaF, 1 mmol/l EDTA, and Triton-X), supplemented with a protease inhibitor cocktail (Sigma-Aldrich) for 30 minutes on ice, and the supernatants were recovered by centrifugation at 15,000 rpm for 30 minutes. For TLR2 and TLR4 immunoblotting, after addition of lysis buffer, cells were homogenized for 15 minutes by ultrasonifier (Branson Japan, Kanagawa, Japan). The samples were resolved electrophoretically on a 4% to 20% gradient of polyacrylamide gel (Daiichi Kagaku, Tokyo, Japan) and transferred onto a polyvinyldene difluoride membrane (Millipore, Billerica, MA, USA). After blocking with 5% skimmed milk/Tris-buffered saline overnight at 4°C, the membrane was incubated with optimally diluted anti-HO-1 monoclonal antibody (Stressgen), anti-TLR2 and anti-TLR4 (Imgenex, San Diego, CA, USA) monoclonal antibody, or anti-actin goat polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 1 hour at room temperature or overnight at 4°C, and subsequently for 45 minutes with horseradish peroxidase-conjugated anti-mouse secondary antibody (Amersham Life Sciences, Piscataway, NJ, USA) or rabbit anti-goat IgG horseradish peroxidase conjugate (Zymed, South San Francisco, CA, USA). The signals were developed by using the enhanced chemiluminescence detection system (Amersham Life Sciences). The amount of blotted protein was measured densitometrically by using Scion image analysis and image processing software (NIH Image Engineering, Bethesda, MD, USA).
Statistical analysis
Mann-Whitney U-test, Kruskal-Wallis test with post-hoc Scheffe's test, paired t-test, and regression analysis were used to test for differences. P values less than 0.05 were considered statistically significant.
Discussion
In the present study we found endogenous HO-1 expression to be decreased in PBMCs from patients with active BD. Dysregulation of HO-1 expression is associated with some rheumatic diseases. Our previous studies [
24,
25] have demonstrated elevated serum HO-1 levels in patients with adult onset Still's disease and hemophagocytic syndrome, and aberrant expression of HO-1 in synoviocytes from patients with RA. However, reduced HO-1 levels in leukocytes have not been demonstrated in other rheumatic diseases. Evidence suggests that increased expression of HO-1 can benefit the host in a variety of pathologic conditions, including inflammatory changes, whereas a deficiency in HO-1 expression is associated with vigorous inflammation, as demonstrated by studies of HO-1 knockout mice and observed in a patient with HO-1 deficiency [
22,
23]. In RA, HO-1-expressing cells were located in the lining and sublining layers, but not in the cartilage-pannus junction, where bone and cartilage are actively destroyed [
25,
30,
31]. Furthermore, our previous report [
26] demonstrated that selective knockdown of HO-1 expression by using specific small interfering RNA resulted in upregulation of synthesis of proinflammatory cytokines, including interleukin-6, interleukin-8 and TNF, which have been shown to be elevated in sera from BD patients [
6]. This suggests that leukocyte function is regulated by HO-1 expressed in the cells [
26]. Thus, defective expression of HO-1 may be involved in the inflammation characteristic of BD, especially in patients with active disease.
Although a pathogenic role of anti-HSP60 specific autoimmune responses has been suggested in BD, abnormal activation of the innate immune system has also been identified in the disease [
1,
6]. Furthermore, involvement of TLRs has been shown in other systemic autoimmune diseases [
16]. In the present study, expression levels of TLR2 and TLR4 were examined because both TLRs recognize HSP60 as ligands [
10,
11]. Actually, HSP60 was reported to be expressed in PBMCs, and in intestinal and mucocutaneous lesions from BD patients [
32,
33]. Our findings demonstrated that levels of TLR4 mRNA, but not of TLR2 mRNA, are constitutively increased in PBMCs from patients with BD, regardless of disease activity. The data suggest possible involvement of TLR4 in BD, although TLR4 has been also implicated in other rheumatic diseases [
13,
34]. Abnormal expression of TLR4 can predispose to defective HO-1 expression in BD PBMCs, because TLR4 may be a putative HO-1 repressor in hepatic ischemia/reperfusion injury mouse model [
35]. Indeed, HO-1 expression was suppressed in PBMCs stimulated with LPS [
29]. Moreover, elevated soluble CD14 in plasma of BD patients may further facilitate LPS binding to TLR4 [
36]. Interestingly, LPS-induced lung injury in a mouse model was rescued by administration of an HO-1 adenovirus vector [
20]; this suggests that HO-1 supplementation may have utility as a strategy for countering TLR4-related inflammation. Such a strategy may also be applicable to BD.
TNF plays a critical role in the development of BD [
1,
37,
38]. Several studies, including ours, have demonstrated that TNF is excessively produced in patients with active BD [
28,
38]. Indeed, anti-TNF therapy is effective in the disease, especially for management of ocular lesions [
39]. In our previous study [
26] we showed that TNF suppresses HO-1 expression levels in human peripheral monocytes, thereby accelerating inflammatory responses; this suggests that excessive TNF levels contribute to defective HO-1 expression. However, no association was found between HO-1 and TNF mRNA levels in circulating PBMCs from patients with BD. In addition, the suppressive effect of LPS on HO-1 was not abrogated by anti-TNF antibody, at least
in vitro, although significant synthesis of TNF in response to LPS was confirmed in the experiments (Additional file
3). These data, rather, suggest that the effect of LPS is mainly mediated by a pathway distinct from TNF. However, TNF may also contribute to defective HO-1 expression
in vivo, because other types of cells also produce TNF in BD. Taken together, our findings suggest that highly expressed TLR4 might contribute to reduced HO-1 expression, leading to an activation of the innate immune system in BD, although other factors including TNF may be involved in the defective HO-1. Because TLRs other than TLR4 are also likely to be involved in the pathogenesis BD [
17], further investigation of molecular mechanisms, including interactions between TLRs and HO-1, are required, especially those that distinguish BD from other inflammatory diseases.
Acknowledgements
This work was supported in part by grants from The Yokohama City University Center of Excellence Program of the Ministry of Education, Culture, Sports, Science and Technology of Japan (Y Ishigatsubo), Research on Specific Disease of the Health Science Research Grants from the Ministry of Health, Labour, and Welfare (Y Ishigatsubo), and the 2006 Strategic Research Project No. K18006 from Yokohama City University (Y Ishigatsubo), and 2004–2005 grant-in-aid for scientific research (project No. 16590991) from the Ministry of Education, Culture, Sports, and Technology of Japan (M Takeno), and 2005 (Y Kirino) and 2006 (M Takeno) grants from the Yokohama Foundation for Advancement of Medical Science. This study was also supported in part by grants from the Kanagawa Nanbyo Foundation (Y Kirino). The source of funding had no role in the writing of the report or the decision to publish the results.
Competing interests
The authors have received no financial support or other benefits from commercial sources for the work reported here, and the authors have no other financial interests that could create a potential conflict of interest or the appearance of a conflict of interest with regard to the present study.
Authors' contributions
YI designed and organized the study. YK, MT, RW, SM, and MK conducted the laboratory work. YK, MT, RW, SM, MK, AI, HI, SO, AU, NM, and YI were involved in the analysis and interpretation of data. YK, MT, and YI were involved in writing the report. All authors read and approved the final manuscript. The authors thank Mr Tom Kiper for his review.