Introduction
Breast cancer affects one in ten women in developed nations. The prognosis is favorable for women with clinically confined tumors at the time of diagnosis, but mortality rates are greater than 80% in cases where the tumor has metastasized to distant sites [
1]. Metastasis to bone occurs frequently in advanced breast cancer and is accompanied by debilitating skeletal complications [
2]. Current treatments are largely palliative and new therapies that specifically prevent the spread of breast cancer to bone are urgently required. Little is known, however, about the molecular determinants that regulate homing of breast cancer cells to bone.
Integrins are dimeric adhesion receptors that mediate cellular attachment to the extracellular matrix (ECM) or to adjacent cells. Interaction of integrins with their substrates regulates various cellular functions associated with tumor development and metastatic progression, including cell adhesion, migration, invasion, proliferation and survival/anoikis [
3]. The changes in the integrin activation state and the alteration in the level of expression of integrins or their ECM ligands have therefore been extensively documented and are thought to contribute to neoplastic progression [
4‐
6].
Studies examining the expression of αvβ3 integrin in various tumor tissues have been strongly suggestive of a potential role for this receptor in tumor progression, particularly for invasive tumors that preferentially metastasize to bone, such as breast and prostate carcinomas [
7,
8]. β3-type integrins (αvβ3 and α
IIbβ3) are expressed in multiple cell types including invasive tumor cells, osteoclasts, activated endothelial and smooth muscle cells, platelets, megakaryocytes and macrophages [
9]. Accordingly, the contribution of several of these β3-expressing cell populations to tumor growth and metastatic progression has been demonstrated in studies using specific inhibitors and/or genetic ablation of β3 receptors in animal models [
10‐
15].
Consistent with enhanced endothelial expression of αvβ3 integrin in the tumor vasculature [
10,
11,
16,
17] and its role in promoting primary tumor growth, small molecule antagonists or function-blocking antibodies targeting β3 integrins exert anti-tumor effects concomitant with decreased tumor vascularization in melanoma, prostate cancer and breast cancer xenograft models [
11,
12,
18‐
20]. Interestingly, studies examining tumor growth in mice null for β3 integrin have yielded results apparently at odds with the inhibitor data. In contrast to the decreased tumor growth and angiogenesis observed upon treatment with β3 inhibitors, these responses are enhanced in β3-null mice [
13,
21]. To reconcile these studies, it was proposed that αvβ3 may function as an angiogenic switch, promoting vessel growth when ligated but triggering an apoptotic response in αvβ3-expressing endothelial cells in the absence of appropriate ligand. In β3-null mice the absence of endothelial αvβ3 may remove apoptotic signals, allowing excessive endothelial growth [
21,
22].
Some of the discrepancies between studies using β3 antagonists and genetic ablation of β3 may be attributed also in part to the lack of receptor specificity for some of the inhibitors used
in vivo or to their direct effect on tumor cells, as previously suggested [
22]. β3 inhibitors would presumably inhibit both host populations and tumor cell populations expressing these receptors, whereas β3 ablation would target only host populations, including cells of the innate immune system, which may exert either pro-tumor or anti-tumor effects and produce a net stimulatory effect on primary tumor growth [
13].
While there is strong correlative evidence supporting the role of tumor-specific αvβ3 expression in breast cancer progression [
7,
23,
24], its precise contribution to primary tumor growth and metastasis is still unclear. Human breast tumor lines expressing αvβ3 are typically more metastatic in xenograft models than those that do not express this receptor [
25]. From
in vitro studies, a variety of functions likely to contribute to tumor progression have been ascribed to αvβ3 expressed on tumor cells. In particular, αvβ3 mediates breast tumor cell adhesion to vitronectin and other bone ECMs and promotes their survival, migration and invasion on bone matrix
in vitro [
25‐
29]. These processes can be inhibited by anti-αvβ3 antibodies or antagonists [
25,
27,
28,
30]. In addition, activated αvβ3 regulates protease maturation, is required for breast tumor cell interaction with platelets [
5,
14,
31] and contributes to breast tumor cell adhesion to the subendothelial matrix under dynamic blood flow conditions [
32].
In vivo studies addressing specifically the role of tumor cell αvβ3 on primary tumor growth are conflicting, however. Exogenous expression of wildtype or constitutively active αvβ3 in transformed human astrocytes exerts suppressive effects on intracranial growth of gliomas, giving rise to fewer and smaller tumors [
33]. Expression of αvβ3 in 21NT human mammary carcinoma cells is insufficient alone to enhance their growth in the mammary fat pad of nude mice [
34], whereas the same approach reduces subcutaneous growth of MCF-7 cells in nude mice [
35]. It is also probable that tumor αvβ3 may have different roles at various stages of metastatic progression. In fact, expression of activated αvβ3 in melanoma and breast cancer cells enhances experimental metastasis to the lung following intravenous injection of tumor cells (which bypasses the formation of a primary tumor) in immune-compromised mice [
14,
36]. Enhanced metastasis of breast tumor cells was postulated to be mediated through tumor-induced platelet aggregation and arrest in capillaries as these processes are inhibited by antibodies targeting specifically platelet α
IIbβ3 or human αvβ3 on tumor cells [
14]. Whether these interactions are required for spontaneous metastasis of breast tumors from orthotopic sites remains unclear, however.
Vascular or oral administration of selective inhibitors of αvβ3 S247 and S137, respectively, was reported to significantly reduce spontaneous metastasis of 435/HAL breast tumor cells to the lung from the mammary gland in severe combined immunodeficient mice [
37]. Neither drug inhibited primary tumor growth or platelet aggregation at the concentration used, and thus the antimetastatic effects are unlikely to be mediated through these processes. Similar evidence supporting the role of tumor-specific αvβ3 in bone metastasis has been reported. Chinese hamster ovary cells or MDA-MB-231 variants overexpressing αvβ3 are more metastatic to bone than their respective parental line when inoculated intravenously [
38]. Conversely, treatment of mice with the selective αvβ3 inhibitor S247 dramatically reduces the incidence and size of MDA-MB-435 osteolytic lesions whereas the specific platelet aggregation inhibitor ML464 prevents B16 melanoma metastases to bone in the intracardiac experimental model [
15,
39].
While informative, the lack of a primary tumor in experimental models of bone metastasis makes it difficult to assess whether tumor αvβ3 is required at the primary site, the metastatic site or both sites for spontaneous metastasis from the mammary gland to bone. Conversely, current xenograft models of breast cancer metastasis are poorly metastatic to bone from the orthotopic site and thus have not been used to investigate the role of tumor αvβ3 in spontaneous breast cancer metastasis to bone. To circumvent these problems, we have used a syngeneic orthotopic model of spontaneous breast cancer metastasis developed in our laboratory [
40,
41] and asked whether exogenous expression of αvβ3 integrin in 66cl4 mammary carcinoma cells that metastasize to the lung but not bone is sufficient to promote their spontaneous metastasis from the mammary gland to bone. The model allows the simultaneous measurement of the impact of αvβ3 expression on primary tumor growth and on the metastatic burden in bone in immunocompetent Balb/c mice. Our results indicate that tumor expression of αvβ3 does not alter the proliferation of 66cl4 cells
in vitro or in the mammary gland, and nor is it required for their growth in bone. The expression of αvβ3 in these cells, however, is sufficient to promote their spontaneous metastasis to bone. Assays mimicking various steps of the metastatic process suggest a critical role for this receptor in regulating the chemotactic response of mammary carcinoma cells to bone-derived factors, in regulating adhesion and migration towards bone matrix proteins and in the recruitment of osteoclasts to bone metastatic sites.
Materials and methods
Cell and cell culture
The mouse mammary epithelial cell lines 4T1, 66cl4 and 67NR were derived by Dr F Miller (Michigan Cancer Foundation, Detroit, MI, USA) [
42]. 4T1.2 and 4T1.13 are clonal cell lines derived from 4T1 by our laboratory [
40,
41]. These cell lines were cultured in alpha minimal essential medium (α-MEM) supplemented with 5% FCS and 1% penicillin-streptomycin, at 37°C, 5% CO
2. The ecotropic packaging cell line Phoenix was a gift from Dr G Nolan (Stanford University, CA, USA) and was cultured in DMEM supplemented with 10% FCS and antibiotics at 37°C, 5% CO
2.
The murine microvascular endothelial cell line bEnd.3 was kindly provided by Dr R Hallman (Jubileum Institute, Sweden) and was maintained in DMEM supplemented with 10% FCS, glutamine (2 mM), glucose (4.5 mg/ml) and 1% penicillin-streptomycin.
Generation and analysis of 66cl4beta3 cells
cDNA encoding full-length mouse β3 integrin (a generous gift from Dr S Teitelbaum, Washington University, St Louis, MO, USA) was subcloned into pBabe-puro retroviral vector [
43]. Phoenix cells were transiently transfected with target cDNA and culture supernatant was used to infect 66cl4 cells. Stably infected cell lines were selected by treatment with 9 μg/ml puromycin over 7 days. Detection of cell-surface integrin expression was performed by standard flow cytometry. Briefly, the cells (1 × 10
6) were resuspended in blocking buffer (α-MEM supplemented with 2% BSA and 2% FCS) for 30 minutes on ice. The cells were then incubated with 2 μg/ml hamster anti-mouse-αv, anti-β3 or isotype control primary antibody (BD Pharmingen, North Ryde, NSW, Australia) diluted in labeling buffer (α-MEM supplemented with 2% FCS) for 1 hour on ice. Unbound antibodies were removed by washing twice with PBS, 2% FCS, and the cells were treated with a fluorescein isothiocyanate-conjugated mouse anti-hamster secondary antibody cocktail (Pharmingen) in labeling buffer for 45 minutes on ice, washed as already described and analyzed on a Calibur fluorescence-activated cell sorter (Becton Dickinson, North Ryde, NSW, Australia). The brightest 30% of β3-expressing cells were sorted, expanded in culture and frozen for all subsequent experiments (66cl4beta3). Fluorescence-activated cell sorting experiments were completed a minimum of two times.
Proliferation and adhesion assays
In vitro proliferation assays were performed as described previously using a sulphorhodamine B colorimetric assay [
40]. Proliferation of 66cl4pBabe and 66cl4beta3 cells was measured over 5 days in complete α-MEM medium with an initial cell density of 1 × 10
3/well and five replicate wells/time point. Adhesion assays were performed in 96-well culture plates as described previously [
44]. Briefly, triplicate wells were precoated overnight at 4°C with BSA (2% w/v), collagen I (20 μg/ml), collagen IV (20 μg/ml), fibronectin (10 μg/ml), or vitronectin (10 μg/ml). Osteopontin was a gift from Dr L Fisher (John Hopkins School of Medicine, MD, UAS) and was used at a concentration of 10 μg/ml. Other extracellular matrix proteins were obtained from Sigma (St-Louis, MO, USA). The cells were labeled with calcein (Molecular Probes, Eugene, OR, USA) and seeded at 2 × 10
4/100 μl in serum-free α-MEM supplemented with 0.1% BSA, and the plates were spun at 400 ×
g for 5 minutes at 4°C. The cells were allowed to adhere for 30 minutes at 37°C. Nonadherent cells were removed by gentle washing with PBS and adherent cells were lysed with 1% Triton X-100. Where indicated, function-blocking hamster anti-mouse β3 integrin or control antibodies (10 μg/ml; Pharmingen) were used for pretreatment of the cells for 15 minutes on ice and added together with the cells to the culture wells. Adhesion was expressed as the percentage of total cell input by comparing the specific fluorescence in each well with that of 100 μl initial cell suspension in a Molecular FX fluorescence reader (Bio-Rad Laboratories, Regents Park, NSW, Australia).
For endothelial adhesion assays, bEnd.3 cells were seeded in complete DMEM medium and incubated overnight to form a confluent monolayer. Excess cells and medium were removed with PBS and calcein-labeled tumor cells (2 × 104/100 μl) were added in serum-free α-MEM medium supplemented with 0.01% BSA. Culture plates were incubated for 30 minutes at 4°C and for a further 30 minutes at 37°C. Nonadherent tumor cells were removed and adhesion was measured as described earlier.
Both the proliferation and adhesion assays were completed a minimum of three times and the data are presented as the means ± standard deviation of a representative experiment performed in three (adhesion) or five (proliferation) replicate wells. The statistical differences were analyzed using the Students' t test; P < 0.01 was considered significant.
Migration and invasion assays
Haptotactic cell migration and invasion were assayed in Transwell migration chambers (8 μm pore size; Corning, Lindfield, NSW, Australia). For haptotactic migration assays, inserts were coated on the underside with extracellular matrix molecules overnight at 4°C as described for the adhesion assay. Cells (2 × 105/100 μl) were seeded into duplicate chambers and allowed to migrate for 4 hours at 37°C in the absence of serum. For invasion assays, cells were embedded in 50% Matrigel/PBS into the upper chamber and were allowed to invade and migrate toward a serum gradient (5% FCS) in the bottom well for 24 hours at 37°C. Cells were fixed in 10% buffered formalin, permeabilized in 0.1% Triton-X 100 and stained with 0.5 μg/ml 4'-6-Diamodino-2-phenylindole (Sigma). Cells remaining on the upper side of the insert were removed by wiping with cotton wool and the membrane was mounted on a glass slide. Cells that had migrated to the underside of the membrane were counted under fluorescence with 40× magnification and the average number of cells in three microscope fields/membrane was determined. Function-blocking hamster anti-mouse β3 integrin or control antibodies were used for pretreatment of the cells as described for the adhesion assay. The matrix metalloproteinase (MMP) inhibitor AG3340 (10 μM; Agouron Pharmaceuticals, San Diego, CA, USA) or vehicle alone (dimethyl sulfoxide) were used to pretreat the cells for 48 hours in standard cultures prior to the assay and were added at the same concentration to the cells in the chamber wells.
For chemotactic migration, the tibias and femurs were harvested from Balb/c mice, crushed and digested for 60 minutes with a solution of PBS, collagenase type II (6 mg/ml; Gibco, Mount Waverley, VIC, Australia) and dispase II (8 mg/ml; Roche Diagnostics, Mannheim, Germany). The cell suspension was filtered through a 70 μm nylon filter and was washed three times by centrifugation in PBS. The cell pellet was resuspended in α-MEM, 10% FCS and the cells were allowed to form a confluent monolayer in the bottom well of Transwell migration chambers. The cells were washed extensively with PBS, and then 600 μl serum-free α-MEM was added and the cells were incubated at 37°C for a further 2 hours at 37°C. Calcein-labeled tumor cells (2 × 105 in serum-free α-MEM) were pretreated or not with blocking antibodies, added to the upper well and placed above the bone cell-containing lower wells. Migration to the underside of the porous membrane was measured after four hours as described earlier.
All migration and invasion assays were completed at least three times in duplicate wells. For each duplicate, the number of migrated cells was counted in three fields of view/membrane for a total of six cell counts/condition. The results from a representative experiment are shown and expressed as the mean number of migrated cells/field ± standard deviation of six fields of view/condition. The statistical differences were analyzed using the Students' t test; P < 0.01 was considered significant.
Animal studies
Mice were maintained in a specific pathogen-free environment with food and water freely available. All procedures involving mice accorded with National Health and Medical Research Council animal ethics guidelines. All mice used were female Balb/c (Animal Resources Centre, Perth, Australia). For intratibial injections, mice 3–4 weeks old were anesthetized by intraperitoneal injection of 40 μg ketamine/g mouse and 16 μg xylazine/g mouse. Cells (1 × 103) in 20 μl PBS were injected through the proximal tibial metaphysis using a 26 G needle. Mice received the analgesic carprofen (4 μg/g mouse) at the time of injection, on the next day, and daily doses from day 10 to day 14. Mice were culled by anesthetic overdose after 14 days. For intramammary fatpad injections, mice 6–8 weeks old were anesthetized with methoxyfluorane. Cells (1 × 104) in 10 μl PBS + 10 μl Matrigel were injected transdermally into the fourth (inguinal) mammary fat pad. Mice were culled by anesthetic overdose after 39 days. Primary tumors were dissected and weighed. Lungs and spines were dissected and snap frozen in liquid nitrogen. Femurs were processed for histology as described in the following.
Real-time quantitative PCR (RTQPCR) using Taqman chemistry (PE Biosystems, Foster City, CA, USA) was used to determine the relative metastatic tumor burden in mouse organs after injection of tumor cells into the fat pad [
40]. Genomic DNA was extracted from organs and a multiplex reaction was performed on genomic DNA from each organ to determine the ratio of the vimentin signal (present in all cells) to the LXSN signal (retroviral LTR sequence present in stably integrated pBabe vector in tumor cells only). Primers and probes were designed using Primer Express (Applied Biosystems, Foster City, CA, USA), and were as follows (shown 5' to 3' with the corresponding Genbank accession number and the nucleotide positions of the amplicon): LXSN (GenBank accession number M28248; nucleotides 1,051–1,162 base pairs): forward, TGGCCCGACCTGAGGAA; reverse, CAGACGGAGGCGGGAACT; probe, 6FAM-CCCGTCAGGATATGTGGTTCTGGTAGGA-TAMRA; Vimentin (GenBank accession number NM_011701; nucleotides 1,146–1,226 base pairs): forward, AGCTGCTAACTACCAGGACACTATTG; reverse, CGAAGGTGACGAGCCATCTC; probe, VIC-CCTTCATGTTTTGGATCTCATCCTGCAGG-TAMRA.
Multiplex PCR reactions (1 × Taqman Universal PCR Master Mix, 50 nM vimentin forward and reverse primers, 50 nM vimentin probe, 150 nM LXSN forward and reverse primers and 50 nM LXSN probe, approximately 1 ng DNA) were cycled according to the standard protocol in an ABI PRISM 7000 Sequence Detection System (Applied Biosystems). At the end of the reaction, a fluorescence threshold was set just above baseline fluorescence levels, within the range of linear amplification. The cycle number at which fluorescence for vimentin and LXSN signals passed the threshold (CT value) was determined for each sample. The ΔCT value was determined by subtracting CT(Vim) from CT(LXSN). ΔCT was then used to calculate the relative tumor burden (RTB) according to the equation RTB = 2CorrρCt × 1000, where CorrρCt is the ρ Ct value that includes a correction for the difference in LXSN copy number between tumor lines as determined by multiplex RTQPCR on tissue culture cells.
Histology and tartrate-resistant acid phosphatase staining
Tissues were dissected and fixed in 10% buffered formalin, bones were decalcified in ethylenediamine tetraacetic acid and tissues were embedded in paraffin wax. Tissue sections (4 μm) were stained with H & E for morphology or were assayed for tartrate-resistant acid phosphatase activity using the Leukocyte Acid Phosphatase kit (Sigma) according to the manufacturer's instructions.
Statistical analysis of in vivodata
All data for the measurement of the tumor volume and the tumor weight and for the RTQPCR analysis of relative tumor burden were derived from 15 mice/group or 10 mice/group for intratibial tumor injection. A Kolmogorov–Smirnov normality test was performed on each group to determine whether the data within groups show a normal distribution. For data that passed the normality test, the statistical differences between groups were analyzed using a Students' t test. Data that failed the normality test were analyzed for differences between groups using the Mann–Whitney rank sum test; P ≤ 0.01 was considered significant.
Discussion
Numerous
in vitro and
in vivo studies have documented the correlation between tumor expression of αvβ3 integrin and the bone metastatic potential of breast tumors and other human tumors [
7,
25,
26,
48‐
50]. Our observation that only aggressive and bone metastatic mammary carcinoma cell lines of our murine model express this receptor is consistent with these studies. The precise role of tumor-specific αvβ3 integrin and its relative contribution to primary tumor growth and bone metastasis remains unclear. This is due in part to the lack of clinically relevant syngeneic models of spontaneous breast cancer metastasis that recapitulate the entire metastatic cascade from the mammary gland to bone. We report in the present article that exogenous expression of αvβ3 integrin in mammary carcinoma cells that do not normally metastasize to bone is sufficient to promote their spontaneous metastasis to this organ. To our knowledge, these data provide the first direct
in vivo evidence that tumor αvβ3 integrin contributes to the spontaneous metastasis of breast tumors from the mammary gland to bone.
Increased bone metastasis occurred without apparent effect on 66cl4beta3 primary tumor growth
in vivo or proliferation
in vitro. These observations contrast with some [
11,
20], but not all [
37], studies in xenograft models showing inhibition of mammary tumor growth by αvβ3 antagonists. Reduced angiogenesis observed in these tumors suggests that αvβ3 inhibitors impair tumor growth primarily by targeting the tumor neovasculature rather than the tumor cells. Unlike these studies, our approach addressed specifically the role of tumor αvβ3. Comparable growth of 66cl4pBabe and 66cl4beta3 tumors indicates that tumor αvβ3 is unlikely to promote spontaneous bone metastasis through stimulation of tumor cell proliferation at the primary site. Instead, results from
in vitro assays suggest that tumor αvβ3 may have multiple roles downstream of primary tumor growth that contribute to enhanced metastasis to bone. This conclusion is supported by the observation that the selective αvβ3 antagonist S247 inhibits the metastasis of αvβ3-expressing MDA-MB-435 to bone in the experimental metastasis model that bypasses the formation of a primary tumor [
39].
While our results show increased spontaneous metastasis predominantly to bone and are consistent with data from experimental models, they do not preclude that tumor αvβ3 may enhance metastasis to several organs in part through its effect on earlier stages of metastasis, such as escape from the primary tumor and intravasation. For instance, we found that 66cl4beta3 cell migration towards collagen IV and invasion through Matrigel were substantially increased compared with that of 66cl4pBabe cells (see Figure
5a). Both these responses are likely to be important in early dissemination of metastatic cells from the mammary gland and may explain also the trend towards increased spontaneous metastasis to lung observed in our model (Figure
2e). This would be consistent also with the inhibitory effect of S247 reported on the spontaneous metastasis of MDA-MB-435 cells to the lung despite its lack of effect on primary tumor growth in the mammary gland [
37].
The mechanisms leading to increased collagen-IV-mediated migration of 66cl4beta3 cells are unclear but could involve MT1-MMP-dependent regulation of cross-talk between αvβ3 integrin and the α2β1 collagen receptor, as reported previously in human breast carcinoma cells [
51]. In particular, these authors noted that MCF-7 cells expressing both MT1-MMP and αvβ3 integrin were more migratory towards collagen I than MCF-7 cells expressing only MT1-MMP. By analogy, 66cl4beta3 cells express both αvβ3 and MT1-MMP whereas 66cl4pBabe express only MT1-MMP ([
47] and this study).
In agreement with previous reports [
25‐
27,
30,
38], we found that expression of αvβ3 integrin in 66cl4beta3 cells dramatically enhanced their αvβ3-dependent adhesion and haptotactic migration towards bone matrix proteins. It is probable that these interactions are critical for homing of breast tumor cells to bone. Migration towards vitronectin was partially inhibited by the MMP inhibitor AG3340, suggesting cooperation between αvβ3 and MMPs to promote haptotactic migration. Functional cooperation between αvβ3 integrin and several MMPs, including MMP-2, MMP-9 and MT1-MMP, has been demonstrated previously [
5,
29,
31,
52]. 66cl4 cells express similar levels of MT1-MMP but significantly less MMP-9 than the bone metastatic 4T1.2 cells [
47]. Neither line expresses detectable levels of MMP-2. Since we did not detect any significant changes in the levels of MMP-2 or MMP-9 activity between 66cl4beta3 and 66cl4pBabe cells by gelatin zymography, cooperation between αvβ3 and MMP-2/9 is unlikely to account for the enhanced haptotactic response observed in 66cl4beta3 cells.
Interestingly, Deryugina and colleagues reported that expression of αvβ3 in MCF-7 cells is insufficient alone to promote their migration towards vitronectin and requires the proteolytic processing of the αvβ3 receptor by MT1-MMP to migrate [
29,
53]. Short-term treatment of MCF-7 cells coexpressing MT1-MMP and αvβ3 with AG3340 blocked direct proteolysis of vitronectin by MT1-MMP and enhanced migration. In contrast, due to the slow turnover of αvβ3, long-term treatment was required to replace existing pools of αvβ3 proteolytically activated by MT1-MMP at the cell surface and to inhibit migration. Similarly, long-term treatment (48 hours) with AG3340 was required to block 4T1.2 and 66cl4beta3 cell migration (see Figure
5b). Although we cannot completely rule out a potential interaction between αvβ3 and MMP-9 in 66cl4beta3 cells, these observations suggest that functional activation of αvβ3 by MT1-MMP may be more relevant to the haptotactic response of 66cl4beta3 cells to vitronectin.
While our results clearly implicate tumor αvβ3 in breast cancer metastasis to bone, it should be noted that the metastatic burden observed with 66cl4beta3 was not as high as that typically seen using the more aggressive 4T1.2 and 4T1.3 lines [
40]. There therefore does not appear to be a direct correlation between the level of αvβ3 expression and the extent of metastasis to bone. Presumably, the level of αvβ3 integrin found in 4T1.2/4T1.13 cells is sufficient to promote metastasis to bone, and expression above this level (as seen in 66cl4beta3) does not offer additional benefits. Moreover, unlike 4T1.2/4T1.13 lines, we failed to detect any spontaneous 66cl4beta3 metastases in the lymph nodes, kidney or liver. A probable explanation for these differences is that other factors not present in 66cl4beta3 cells cooperate with αvβ3 integrin and contribute to the high metastatic phenotype of 4T1.2/4T1.13 lines. Although we found no evidence implicating MMP-9 in the 66cl4beta3 migratory response to vitronectin, it is tempting to speculate that enhancing the level of MMP-9 expression (as seen in 4T1.2 and 4T1.13 cells) together with expression of αvβ3 in 66cl4beta3 cells may be sufficient to achieve the high metastatic burden observed with 4T1.2 and 4T1.13 tumors. Alternatively, coexpression of αvβ3 and its ECM ligand may be required to further enhance the 66cl4beta3 metastatic potential as demonstrated in 21NT human xenografts [
34]. Consistent with this, cDNA microarray analysis of primary tumors of our model revealed that several ECM-related genes are more highly expressed in bone metastatic lines (4T1.2, 4T1.13) compared with weakly metastatic (66cl4) and nonmetastatic (67NR) lines [
40]. The cooperative role of some of these ECMs and αvβ3 integrin is under investigation.
Tumor αvβ3 has been proposed to enhance metastasis by facilitating tumor cell arrest in the vasculature through interaction with platelets and adhesion to the subendothelial matrix [
14,
32]. 66cl4pBabe and 66cl4beta3 cells adhered equally well to endothelial cells, indicating that receptors other than αvβ3 integrin mediate their attachment to the endothelium under our assay conditions. It should be noted, however, that the assays were conducted in the absence of serum and thus a role for αvβ3-mediated tumor–platelet interaction under blood flow conditions cannot be ruled out. Further work will be required to address this possibility.
Exogenous expression of αvβ3 integrin dramatically enhanced the chemotactic migration of 66cl4beta3 cells towards soluble factors secreted by bone stromal cells. Almost complete inhibition of chemotaxis by β3-blocking antibodies indicates that the antibody either prevents binding of αvβ3 receptor to a soluble ECM ligand and/or interferes with the association of αvβ3 and a chemotactic receptor. Several factors produced in the bone stromal microenvironment have been shown to promote chemotactic migration, including insulin-like growth factors, platelet-derived growth factor (PDGF) and stromal cell derived factor 1 (sdf-1/CXCL12) [
45,
54‐
56]. While we have yet to determine the specific bone stromal factor stimulating the 66cl4beta3 cell chemotactic response, PDGF may be of particular interest as αvβ3 integrin has been shown to associate with the PDGF receptor β and to enhance chemotactic migration in response to PDGF stimulation [
57‐
59]. Moreover, PDGF is a potent mitogen for breast tumor cells and blocking PDGF receptor signaling in these cells inhibits their growth in bone and associated osteolysis [
60].
The observations that 66cl4pBabe tumors were able to grow when injected directly into the tibia clearly demonstrate that tumor αvβ3 is not required for proliferation of breast tumor cells in bone. Moreover, the fact that they proliferated to the same extent as 66cl4beta3 tumors despite evidence of osteoclast recruitment or large lytic lesions indicates that extensive bone degradation is not required for metastatic growth to occur in bone. The increased recruitment of osteoclasts in the proximity of 66cl4beta3 tumor nodules and evidence of osteolysis at the tumor–bone interface, however, are consistent with the vicious cycle theory, and suggesting that tumor αvβ3 may play an indirect role in promoting the growth of breast cancer cells that spontaneously metastasize to bone through enhanced osteoclast-mediated bone resorption and release of mitogenic factors from the bone matrix [
46]. Engagement of αvβ3 integrin with bone ECM proteins may induce production of an osteoclast-stimulating factor, such as RANKL or colony stimulating factor 1, by tumor cells or by bone marrow cells. Alternatively, tumor αvβ3 may promote osteoclastogenesis through interaction with activated platelets in the bone microenvironment [
61]. While Boucharaba and colleagues did not specifically investigate the role of tumor αvβ3, they showed that interaction of human MDA-MB-231/B02 breast tumor cells with platelets promotes osteoclast-mediated bone resorption through the release of cytokines (IL-6 and IL-8) in response to platelet-derived lysophosphatidic acid. Further work will be required to elucidate the mechanism by which tumor αvβ3 enhances osteoclastogenesis. Assays that measure the production of such factors in cocultures of breast cancer cells and bone marrow stromal cells may help to elucidate the mechanism by which tumor αvβ3 integrin promotes the formation of osteolytic lesions.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
The authors' contributions to this research work are reflected in the order shown, with the exception of EKS and NP who contributed equally to the majority of the in vitro and in vivo experimental work and preparation of the manuscript. KLS assisted with the monitoring of the mice, measurement of tumors and processing of tissues for real-time PCR. JC performed the endothelial adhesion assay. DKH performed the histological analysis. JMM contributed to the experimental design of the project. RLA conceived the study and participated in its design and coordination. All authors have read and approved the final manuscript.