Background
Streptococcus pneumoniae is a major cause of human disease. It is estimated that more than 1.6 million people, including more than 800,000 children under the age of 5, die every year from pneumococcal infections [
1]. In addition to its role as a leading cause of community-acquired pneumonia,
S. pneumoniae is a causative agent of a variety of other infections, including otitis media, blood stream infection, spontaneous peritonitis and meningitis [
2]. Pneumococcal meningitis is a form of pneumococcal disease associated with significant mortality and morbidity in children. In developed countries, pneumococcal meningitis has a mortality rate of 17–30 % [
3] and an associated risk of sequelae of 32 % [
4]. In developing countries, the mortality and morbidity rates are much higher [
5].
S. pneumoniae belongs to the mitis subgroup of alpha-haemolytic (viridans) streptococci (VGS). Mitis group streptococci other than
S. pneumoniae are also associated with bacteraemia which may be clinically non-significant but may also be associated with invasive disease, particularly in predisposed patients such as the immunocompromised and those with cardiac valve damage [
6]. The mitis group organisms,
S. mitis,
S. oralis and
S. pseudopneumoniae, possess >99 % 16S rRNA sequence homology with
S. pneumoniae [
7]. Furthermore, horizontal gene transfer between streptococci can give rise to atypical streptococci that are difficult to classify using phenotypic methods [
8]. Given the close genotypic and phenotypic relationship between mitis group streptococci, the differentiation of pneumococcus from other VGS is challenging [
9].
Culture based methods are the gold standard for diagnosing invasive pneumococcal disease (IPD). However culture based methods typically require at least several hours to a day or more incubation before an organism is detected. Furthermore, these methods often demonstrate limited diagnostic sensitivity, particularly post antibiotic treatment or in cases with low sample volume, as is often the case with children [
10,
11]. Molecular amplification methods such as PCR and Loop-mediated isothermal amplification (LAMP) have been used to diagnose IPD [
12,
13] . These methods are reported as sensitive, are not reliant on having viable organisms and have the potential to deliver more rapid results.
Recombinase polymerase amplification (RPA) is an isothermal
in vitro nucleic acid amplification technology that uses a combination of recombinase protein, oligonucleotide primers and a strand displacing polymerase to amplify DNA sequences [
14]. RPA is sensitive, rapid, specific and robust (less sensitive to inhibitors than PCR). RPA has been applied to the detection of a wide variety of bacterial, viral and eukaryotic molecular targets [
15‐
22]. The use of a fluorescent probe enables monitoring of reactions in real-time and multiplexing capabilities. Isothermal amplification strategies are of great interest in molecular diagnostics, as they negate the need for thermocycling, as is the case for PCR. The isothermal nature of these techniques makes them suitable for incorporation into devices capable of being deployed at the point-of-care.
Molecular targets that have been used to identify
S. pneumoniae include a variety of genes, including the Spn9802 fragment [
23], the
RecA gene [
24] the 16S rRNA gene [
25], and virulence factor genes, such as autolysin (
lytA) [
26] and pneumolysin (
ply) [
27,
28]. Whilst these targets have proven useful for the detection of
S. pneumoniae, their ability to unequivocally identify
S. pneumoniae remains problematic. For example, false positives can occur with the
lytA marker [
29] and both
ply [
30] and Spn9802 [
23] are associated with false negative results. Leader peptidase A (
LepA), also known as Elongation Factor 4 (EF4), is one of the most conserved bacterial proteins and is found in virtually all know genomes [
31]. It functions as a ribosome dependant GTPase, with the ability to back-translocate post-translocational ribosomes and increase the active fraction of newly translated proteins [
32‐
34]. Its utility as a diagnostic marker has been previously demonstrated in a multiplex assay for the detection of the
Mycobacterium tuberculosis complex (MTC) [
35,
36].
In this study, we have developed and performed a preliminary evaluation of a real-time RPA assay based on the LepA gene for the detection of S. pneumoniae. We also developed a LepA based S. pneumoniae real-time PCR assay to compare in terms of specificity and sensitivity.
Methods
Bacterial strains and growth conditions
S. pneumoniae bacterial reference strains (
n = 8), non-
S. pneumoniae reference strains (
n = 54) and invasive
S. pneumoniae clinical isolates (
n = 19) were evaluated in this study (Table
1). All strains were cultured overnight in brain heart infusion (BHI) medium (Oxoid, UK) at 37 °C. For enumeration, 100 μL of serially diluted bacterial suspensions were spread plated on Columbia blood agar and incubated for 24 hrs.
Table 1
Bacterial strains and reactivity in the RPA and PCR assays
S. pneumoniae
| DSM 20566 | + | + |
S. pneumoniae
| DSM 11865 | + | + |
S. pneumoniae
| DSM 11866 | + | + |
S. pneumoniae
| DSM 14377 | + | + |
S. pneumoniae
| DSM 24048 | + | + |
S. pneumoniae
| DSM 11868 | + | + |
S. pneumoniae
| DSM 25971 | + | + |
S. pneumoniae
| DSM 14378 | + | + |
Clinical Isolates |
S. pneumoniae
| Clinical Isolates (n = 19) | + | + |
S. agalactiae
| Clinical isolate (n = 1) | - | - |
N. meningitidis
| Clinical isolate (n = 1) | - | - |
Non-S. pneumonia reference strains |
S. agalactiae
| BCCM 15081 | - | - |
S. agalactiae
| BCCM 15082 | - | - |
S. agalactiae
| BCCM 15083 | - | - |
S. agalactiae
| BCCM 15084 | - | - |
S. agalactiae
| BCCM 15085 | - | - |
S. agalactiae
| BCCM 15086 | - | - |
S. agalactiae
| BCCM 15087 | - | - |
S. agalactiae
| BCCM 15094 | - | - |
S. agalactiae
| BCCM 15095 | - | - |
S. anginosus
| BCCM 20563 | - | - |
S. australis
| BCCM 15627 | - | - |
S. bovis
| BCCM 20480 | - | - |
S. canis
| BCCM 20715 | - | - |
S. constellatus
| BCCM 20575 | - | - |
S. cristatus
| DSM 8249 | - | - |
S. downei
| DSM 5365 | - | - |
S. dysgalactiae
| DSM 6176 | - | - |
S. equi
| DSM 20561 | - | - |
S. equinis
| DSM 20554 | - | - |
S. gordonii
| DSM 6777 | - | - |
S. infantis
| DSM 12492 | - | - |
S. intermedius
| DSM 20573 | - | - |
S. mitis
| DSM 12643 | - | - |
S. mutans
| DSM 20523 | - | - |
S. oralis
| DSM 20066 | - | - |
S. parasanguinis
| DSM 6778 | - | - |
S. perosis
| DSM 12493 | - | - |
S. porcinus
| DSM 20725 | - | - |
S. pseudopneumoniae
| DSM 18670 | - | - |
S. pyogenes
| DSM 2072 | - | - |
S. pyogenes
| DSM 20565 | - | - |
S. salivarius
| DSM 20560 | - | - |
S. salivarius
| DSM 20617 | - | - |
S. sanguinis
| DSM 20567 | - | - |
S. sinensis
| DSM 14990 | - | - |
S. suis
| DSM 9682 | - | - |
S. uberis
| DSM 20569 | - | - |
S. vestibularis
| DSM 5636 | - | - |
H. influenzae
| DSM 4690 | - | - |
H. influenzae
| DSM 11121 | - | - |
H. parainfluenzae
| DSM 8978 | - | - |
H. haemolyticus
| CCUG 15312 | - | - |
H. somnus
| CCUG 12839 | - | - |
N. meningitidis
| DSM 10036 | - | - |
K. pneumoniae
| DSM 30184 | - | - |
P. aeruginosa
| DSM 50071 | - | - |
E. coli
| DSM 30083 | - | - |
E. faecalis
| DSM 20317 | - | - |
C. albicans
| CBS 2700 | - | - |
B. fragilis
| DSM 2151 | - | - |
M. cattarhalis
| DSM 11994 | - | - |
S. aureus
| DSM 346 | - | - |
Following overnight culture, bacterial genomic DNA was extracted and purified using the DNeasy Blood and Tissue kit (Qiagen, Germany) according to the manufacturers’ instructions. Following purification, DNA was quantified by fluorescence (Qubit DNA BR Assay, Life technologies, UK). Genome equivalents (GE) were calculated based on an assumed genome size of 2.1 Mb [
37]. For whole blood spiking experiments, from an overnight culture, the culture medium was 10-fold serially diluted in BHI. 2 μL of the serially diluted bacterial suspensions, were spiked into 98 μL of fresh human whole blood. Subsequently, total genomic DNA was extracted and purified using the DNeasy Blood and Tissue kit (Qiagen, Germany) according to the manufacturers’ instructions, with the exception that DNA was eluted in 20 μL H
20 (rather than 200 μL buffer AE).
Primer and probe design
LepA sequences were obtained from GenBank (
http://www.ncbi.nlm.nih.gov/genbank), and the Functional Gene Pipeline and Repository (FunGene;
http://fungene.cme.msu.edu) website. Sequences were aligned using the multiple sequence alignment tool ClustalW [
38]. Following alignment,
S. pneumoniae specific PCR and RPA primers and probes were manually designed (Table
2). The sequences were finally screened for homology using the BLASTn algorithm (
http://blast.ncbi.nlm.nih.gov/Blast.cgi) to confirm their specificity. All oligonucleotide primers and probes were purchased from Integrated DNA Technologies (Leuven, Belgium), with the exception of the RPA probe, which was purchased from Biosearch Technologies (Petaluma, California, USA).
Table 2
Nucleic Acid sequences of primers and probes
RPA | | | 190 |
Forward | ACAGCTCCGTCTGTTATTTACAAAGTTAATTTGA*C | 1123–1157 | |
Reverse | AGTCCCCACGCTTACGCTGAGCTAGCTCCATTAC*T | 1278–1312 | |
Probe | CTTGACATAAGGCTCTTCAATGGTCGCAATCT[T(FAM)]A(dSpacer)[T(BHQ-1)]TGGGTCTGGAAAC*T | 1193–1242 | |
PCR | | | 107 |
Forward | CTCGTAAGCGTAAACTCCTTG | 1706–1727 | |
Reverse | CATACTCAAGACGCTGAGGA | 1793–1813 | |
Probe | FAM-ACGCATGAAATCCATCGGATCAGTT-TAMRA | 1749–1773 | |
Real-time recombinase polymerase amplification
RPA reactions were performed using the TwistAmp Exo® kit (TwistDx, Cambridge, UK) and contained: 1 x rehydration buffer, 4 μL forward and reverse primer (6 μM each), 4 μL probe (6 μM) and 1 μL genomic DNA as the amplification template. To initiate the reaction, 14 mM magnesium acetate (2.5 μL at a concentration of 280 mM) was added. Reactions were performed in a total volume of 50 μL at 40 °C in a portable real-time fluorometer (Twista®, TwistDx) for 20 minutes with a mixing and centrifugation step after the first 4 minutes. External negative and positive amplification controls were included in each run. The positive amplification control consisted of 100 GE of the S. pneumoniae type strain (DSM 20566) diluted in molecular grade water. The no-template control (NTC) consisted of molecular grade water.
Real-time PCR
All real-time PCR assays were performed using a LightCycler® 480 real-time PCR instrument (Roche Diagnostics, UK). PCR reactions were performed in 200 μL 12-well optical strips (BIOplastics BV, The Netherlands) in a total volume of 20 μL. Each reaction consisted of 1 x LightCycler Probes Master mix (Roche Diagnostics, UK), 10pmoles each primer and 5pmoles of probe and 1 μL genomic DNA as the amplification template. Negative and positive amplification controls were included in each run. The positive amplification control consisted of 100 GE of the S. pneumoniae type strain (DSM 20566) diluted in molecular grade water. The no template control (NTC) consisted of molecular grade water. The cycling parameters consisted of 1 cycle of 95 °C for 5mins followed by 45 cycles of 95 °C for 10s, 60 °C for 15 s and 72 °C for 1 s.
Specificity analysis/determination
The specificity of both the RPA and PCR assays were evaluated. Genomic DNA (5 × 10
4 GE) from a panel of
Streptococcus and non-
Streptococcus organisms (see Table
1) was tested in both RPA and PCR amplification assays.
Sensitivity analysis/determination
The analytical limit of detection (95 % confidence level) of the PCR and RPA assays were determined. S. pneumoniae (DSM 20566) genomic DNA was diluted in molecular grade water to 8, 7, 6, 5, 4, 3, 2, or 1 GE per microliter. PCR and RPA reactions were then performed using 1 μL of the diluted DNA as the amplification template. Reactions were performed in replicates of twelve and the subsequent data was analysed statistically (Probit, Minitab, Version 16).
Evaluation of inhibition of RPA by human DNA
In order to determine the limit of background human DNA tolerated by the RPA and PCR reactions, varying quantities of human genomic DNA (100, 200 and 400 ng) were added to reactions containing 50, 20 or 4 S. pneumoniae (DSM 20566) GE.
Blood spiking experiments
Human whole blood was collected from a healthy volunteer in EDTA vacutainers (Becton Dickinson and Company, Ireland). Two microliters of 10-fold serially diluted bacterial suspensions (over five orders of magnitude) were spiked into 98 μL of fresh (within 1 hr of sampling) human whole blood. Aliquots (100 μL) of the serially diluted bacterial suspensions were plated on blood agar for enumeration. The spiked blood samples were then processed immediately to extract DNA. From the eluted DNA (20 μL), 1 μL was then subjected to RPA or PCR amplification.
Clinical sample analysis using RPA and PCR
Whole blood was collected in EDTA blood tubes from patients attending Galway University Hospital, suspected of a bloodstream infection for routine full blood count and from healthy volunteers. Generally, within 24 hours of collection of patient blood, residual material was collected, anonymised and then stored at −80 °C. Blood collected from the healthy volunteers was also stored at −80 °C. Subsequently, the samples were thawed on ice and total genomic DNA was extracted from 100 μL of sample and eluted in 20 μL molecular grade water as described previously. For analysis, 1 μL or 5 μL of the eluted genomic DNA was subjected to amplification by RPA and PCR.
Ethical approval
Ethical approval for this study was granted by the Ethics Committee of the Galway University Hospital, Galway, Ireland. Participants were selected on the basis of having blood cultures submitted to the Department of Medical Microbiology for detection of blood stream infection. Following full blood count, patients for whom residual EDTA blood samples were available were recruited into the study based on the results of the blood culture (confirmed positive for the presence of S. pneumoniae). For controls, blood was collected from healthy individuals, following informed consent.
Discussion
Some 93 polysaccharide capsular types or serotypes of
S. pneumoniae have been identified [
39]. The introduction of a 7-, 13-, and more recently, a 23-valent conjugate vaccine has been associated with a dramatic reduction in the number of deaths, particularly amongst children and in adults (via a herd effect) due to pneumococcal infection [
40,
41]. However, pneumococcal disease remains a serious disease globally, particularly in children less than two years old, the elderly (>65 years) and in immunocompromised individuals. Thus, a robust diagnostic assay capable of the rapid, sensitive and specific detection of
S. pneumoniae in near-patient settings could play a significant role in the reduction of pneumococcal disease related morbidity and mortality, particularly in developing countries.
Isothermal
in vitro nucleic acid amplification strategies are of great interest in molecular diagnostics, as they negate the need for thermocycling, as is the case for PCR. In PCR, thermocycling is required to facilitate the separation of double-stranded DNA to enable amplification. The major isothermal amplification techniques currently utilised include: Nucleic Acid Sequence based Amplification (NASBA) [
42], Transcription Mediated Amplification (TMA) [
43], Loop-Mediated Isothermal Amplification (LAMP) [
44], Helicase Dependant Amplification (HDA) [
45], Rolling Circle Amplification (RCA) [
46] and Strand Displacement Amplification (SDA) [
47]. Of these, NASBA, TMA, RCA and SDA cannot be considered truly isothermal as they require an initial heating step to denature the target nucleic acid prior to amplification. RPA, HDA and LAMP can be considered truly isothermal, as there is no requirement for a denaturation step to initiate amplification. The operating temperature of LAMP is typically 60–65 °C, at which temperature the nucleic acid target is in dynamic equilibrium, enabling the binding of primers to their target sequence and subsequent amplification. Whilst LAMP is inexpensive to perform, primer design is complex and multiplex amplification is at present difficult. Both HDA and RPA use proteins to facilitate the binding of primers to their respective template and both technologies enable multiplex amplification. The major advantage of RPA over other competing isothermal amplification technologies is its speed, being capable of amplifying single-digit copy numbers of nucleic acids to detectable levels in 5–10 minutes.
In this study, we have developed real-time RPA and real-time PCR assays for the detection of S. pneumoniae using primers and probes targeting the LepA gene. We examined the ability of both assays to detect S. pneumoniae spiked into human whole blood. Finally, we applied both assays to the detection of S. pneumoniae directly in the blood of 11 patients confirmed positive for infection by blood culture.
Both RPA and PCR assays were highly specific, with all laboratory strains (
n = 8) and clinical isolates of
S. pneumoniae (
n = 19) positively identified. Both assays were negative for all non-
S. pneumoniae organisms (
n = 39) assayed. These data support the results of our
in silico analysis, demonstrating that the
LepA gene has sufficient sequence heterogeneity to enable the specific detection of
S. pneumoniae. Probit regression analysis was used to calculate (with 95 % confidence) the analytical LOD of both assays. The RPA assay had a marginally better LOD than the PCR assay (4.0 and 5.1 GE respectively). Assuming Poisson distribution, both assays demonstrated limits of detection approaching 3 molecules, the most sensitive LOD theoretically possible [
48]. It should also be noted that the RPA reactions were performed in volumes of 50 μL, 250 % greater than the 20 μL PCR reactions, suggesting that by reducing the reaction volume and thereby increasing the effective concentration of the initial template DNA, the assay sensitivity could be further improved.
RPA is a rapid isothermal in vitro nucleic acid amplification technology. When 10 S. pneumoniae GE were used as the template for amplification, our RPA assay produced a positive signal in as little as 5 mins. This is in contrast to 35 cycles (approximately 20mins), which was required to produce a positive signal in our PCR assay for the equivalent template quantity.
Prior to performing our spiking experiments we investigated what affect the presence of background human DNA had on the RPA assay performance. We found that in the presence of 400 ng background DNA (the highest quantity tested), although considerably inhibited, the RPA assay was capable of detecting 50, 20 and 4 GE, all giving signals above the no template control reaction. In the presence of 200 ng of background human DNA, the RPA assay was also inhibited, but to a much lesser degree than in the presence of 400 ng DNA. According to the DNA extraction kit manufacturer (Qiagen), 3–6 μg is the typical yield of genomic DNA obtained from 100 μL of mammalian blood. The DNA we used for the inhibition studies was extracted using the DNeasy blood and tissue kit and yields were in this range (data not shown). Assuming the average yield is 4.5 μg DNA /100 μL blood, and considering that we eluted our extracted DNA into 20 μL, of which 1 μL is subjected to RPA, the quantity of background human DNA in the RPA reaction is approximately 225 ng. We also tested the effect of background human DNA on the PCR assay and found that the reaction was not inhibited, even in the presence of 400 ng of background DNA.
When spiked into whole blood, both PCR and RPA assays were capable of detecting 0.925 CFU/reaction, which equals 18.5 CFU equivalents/100 μL blood. Reactions in the blood spiking experiment were performed in duplicate and subsequently repeated to verify this result. Peter
et al. (2009) developed a real-time PCR assay targeting the autolysin gene capable of detecting the equivalent of 125 CFU in 1 mL whole blood [
49]. It should be noted, that CFU is an estimate of the number of viable organisms present. CFU as a metric does not account for the presence of dead, non-viable cells or for organisms that tend to form clumps or grow as pairs or chains and may well substantially underestimate the number of living cells in a sample [
50].
To further evaluate our RPA assay, we tested a small number of S. pneumoniae culture positive (n = 11) and culture negative (obtained from consenting volunteers) blood samples (n = 4). All culture positive samples resulted in positive signals when analysed by RPA and PCR amplifications while the four culture negative samples were RPA and PCR negative. Eight of the 11 culture positive samples produced positive signals for RPA and PCR when tested with 1 μL of purified DNA. The remaining three that tested negative using 1 μL of purified DNA, were then tested using 5 μL of purified DNA in both assays, with both assays producing positive signals. This result hints at a reduced bacterial DNA load or the presence of RPA and PCR reaction inhibitors in the 3 of the 11 culture positive samples in question. This may have been the result of lower bacterial cell load in the samples, DNA degradation due to extended sample processing time during sample acquisition.
Competing interests
We declare the following competing interests; TwistDx supplied RPA reagents for the study. MSF and OP are employees of TwistDx. TB and TJS are named inventors on a patent application pertaining to the use of LepA as a diagnostics target. OP is a named inventor of Recombinase Polymerase Amplification technology.
Authors’ contributions
OH, EC, MSF, OP, TB and TJS designed the study. OH performed the experimental work. EC drafted the manuscript. TWB and MC had roles collection and analysis of clinical isolates and samples. All authors contributed to the critical review and revision of the manuscript. All authors have seen and approved the final version.