Background
Staphylococcus aureus, a commensal of human skin and nares, is also a human pathogen with dual intracellular and extracellular lifestyle [
1,
2].
S. aureus infection causes a broad range of diseases, from skin infections to life-threatening diseases, including pneumonia, endocarditis, and sepsis et al. [
1,
3]. The recent emergence of multidrug-resistant
S. aureus strains, such as methicillin-resistant
S. aureus (MRSA), exerts a huge clinical burden and makes the infections much more difficult to treat [
4‐
6]. However, a prophylactic vaccine against
S. aureus is not available. Many active and passive immunization vaccines, such as StaphVAX, V710, Pagibaximab, tefibazumab, Veronate, Aurograb and AltaStaph, ended in failure in clinical trials [
7‐
13], which might be attributed to several reasons. Firstly, cell-surface antigens were targeted by all the seven vaccines, and the elicited antibodies against surface components might promote bacterial aggregation, causing possible tissue damage, ischaemia, multi-organ failure and death [
7,
14]. Secondly, failures of the five passive immunization strategies might be ascribed to an overemphasis on humoral immunity, rather than the cooperation of humoral and cellular immunity [
7,
15].
Secreted virulent factors are also targeted for vaccine development and exhibit effective protection against
S. aureus infection diseases [
16‐
18]. Among them, SaEsxA and SaEsxB are two ESAT-6-like virulence factors required for persistence and spread of
S. aureus in the infected host [
19]. SaEsxA and SaEsxB were first identified in the culture filtrates of
Mycobacteria tuberculosis (M. tuberculosis) and found to be able to stimulate T-cell immune responses [
20,
21]. In 2005, SaEsxA and SaEsxB were experimentally verified to be secreted from
S. aureus and involved in abscess formation.
S. aureus mutant lacking EsxA or EsxB showed defects during
S. aureus infection in murine model [
19]. SaEsxA and SaEsxB also regulate the apoptosis and release of intracellular
S. aureus from the infected epithelial cells [
2].
During recent years, protein subunit vaccines targeting SaEsxA and SaEsxB were shown to prevent invasive
S. aureus infection through induction of Th1- and Th17-biased immunity [
22]. Administration of a four-component vaccine 4C-Staph/alum including SaEsxA/B chimera was demonstrated to protect mice from
S. aureus infection in four murine models, including kidney abscess, peritonitis, skin and pneumonia models [
23,
24]. In addition, a novel adjuvant T7-alum targeting TLR7 was formulated with the four component vaccine 4C-Staph (4C-Staph/T7-alum), which showed outperformance over the previous 4C-Staph/alum [
25]. The immunologic protection was attributed to the cooperation of vaccine-specific antibodies, CD4+ T cells and IL-17 [
25]. This study emphasizes on the cooperation of humoral and cellular immunity for protection against
S. aureus infection.
Live attenuated
S. Typhimurium strains have been employed to deliver recombinant foreign antigens with various approaches [
26]. Among these, SPI-1 T3SS has been engineered for the cytosolic delivery of foreign antigens to induce efficient immune responses against cancer and infectious diseases [
27,
28]. SPI-1 T3SS-mediated cytosolic delivery of antigens could significantly enhance the accessibility of antigens to MHC class-I antigen presenting pathway, and effectively activate CD8+ T cell-mediated immunity, which is important to remove intracellular pathogens such as
S. aureus [
27,
29‐
31]. In addition, utilization of
Salmonella T3SS for protein expression can prevent formation of inclusive bodies and cellular degradation of target proteins, which happened during protein expression by other gram-negative expression systems [
32].
SPI-1 T3SS is a needle-like apparatus to directly translocate effectors into mammalian host cells, which facilitates bacteria invasion and pathogenesis [
33‐
35]. This process is mediated by different chaperones targeting the N-terminal tags of the cognate effectors [
36]. In this study, N-terminal domain of SipA (1-169aa) was fused with staphylococcal antigens to achieve the translocation. SipA is a bi-functional SPI-1 T3SS effector. On one hand, SipA functions extracellularly to mediate trans-epithelial migration of polymorphonuclear neutrophils [
37], via engaging certain host surface receptors to activate protein kinase C (PKC) and subsequently induce the apical release of pathogen-elicited epithelial chemoattractant (PEEC) [
37‐
39]. On the other hand, SipA could also be translocated into the cytosol of host cells by T3SS, inducing actin cytoskeleton rearrangement and membrane ruffle, which are required for bacterial uptake [
40,
41].
In this study, SPI-1 T3SS was utilized to deliver Staphylococcal antigens SaEsxA and SaEsxB into the cytosol of host cells. Our results showed that oral immunization with these strains could elicit multifaceted immune responses in mice, which conferred protection against S. aureus. To the best of our knowledge, this is the first development of live attenuated S. Typhimurium based vaccine against S. aureus infection. Besides, this study also provides information that N-terminal signal peptide of SipA (1-169aa) could be utilized as molecular carrier for the cytosolic delivery of foreign proteins via SPI-1 T3SS, with the support of the cognate chaperon invB.
Methods
Bacterial strains and growth conditions
Bacteria strains and plasmids used in this study were listed in Table
1.
Table 1
Bacterial strains and plasmids used in this study
SL7207 | ΔaroA | Lab stock |
ML21 | ΔaroA ΔpyrF | Lab stock |
ML86 | ML21 ΔsipB | Lab stock |
ML88 | ML21 ΔinvA | Lab stock |
N19 | ML21 carrying PagC-invB-sipA-SaEsxA (ColE1 ori) | This study |
N20 | ML21 carrying PagC-invB-sipA-SaEsxB (ColE1 ori) | This study |
N106 | ML21 carrying empty plamsid (ColE1 ori) | This study |
N80 | ML86 (ΔsipB) carrying PagC-invB-sipA-SaEsxA (ColE1 ori) | This study |
N158 | ML88 (ΔinvA) carrying PagC-invB-sipA-SaEsxA (ColE1 ori) | This study |
N160 | ML86 (ΔsipB) carrying PagC-invB-sipA-SaEsxB (ColE1 ori) | This study |
N161 | ML88 (ΔinvA) carrying PagC-invB-sipA-SaEsxB (ColE1 ori) | This study |
Salmonella enterica serovar Typhimurium aroA-deleted (ΔaroA) strain SL7207 was kindly provided by Dr. B.A.D Stocker [
42], which was utilised as the parent for genomic knockouts. ML21 is an isogenic double knockout (ΔaroA, ΔpryF), derived from SL7207. ML88 is a triple knockout (ΔaroA, ΔpryF, ΔinvA), derived from ML21. The isogenic knockouts were constructed using λ Red-recombineering method [
43].
S. Typhimurium and
E. coli strains were cultured in Luria-Bertani (LB) broth or LB agar supplemented with appropriate antibiotics. For secretion assay,
S. Typhimurium was cultured in SPI-1 Inducing LB (0.3 M NaCl) [
36].
S. aureus strains were grown in Brain Heart Infusion Broth (BHI, Sigma-Aldrich) and BHI agar.
Antibiotics were used at the final concentrations: streptomycin (50 μg/mL), chloramphenicol (25 μg/mL), ampicillin (100 μg/mL) and kanamycin (50 μg/mL).
Mammalian cell culture
Murine RAW264.7 macrophages were purchased from ATCC and cultured in RPMI 1640 medium (Gibco) with 10% Fetal Bovine Serum (FBS, Gibco). Cell cultures were maintained at 37 °C in a humidified atmosphere containing 5% CO2.
Construction of plasmids
Plasmid pCASP (-sicP-sptP) (Genbank: #EF179157), which is based on pPROTet.133 backbone (Cm
R, ColE1) (BD Clonetech), was generously provided by Prof. Christopher Voigt [
36]. Plasmids with alternative secretion tag/chaperone pairs, including pCASP-invB-sipA, pCASP-invB-sopE2, pCASP-invB-sopA, and pCASP-sigE-sopB were constructed by overlap extension PCR, as previously described [
36]. Briefly, secretion tags, chaperones and PsicA were amplified from
S. Typhimurium genomic DNA with the primers listed in Table
2. The pcr products were fused by overlap extension PCR, followed by double enzyme digestion (HindIII and XhoI) and ligation into the plasmid pCASP to replace PsicA-sicP-sptP. For the simplicity of further genetic modification, PacI restriction enzyme site was introduced between PsicA and chaperones.
Table 2
Primers used in this study
BamHI-SaEsxA-F | CGGGATCCATGGCAATGATTAAGATG | amplify SaEsxA-his |
NotI-SaEsxA-his-taa-R | ATAAGAATGCGGCCGCTTAATGATGATGATGATGATGTTGCAAACCGAAATTATTAGAAAGTTGTTG | amplify SaEsxA-his |
HindIII-SaEsXB-F | CCCAAGCTTGGTGGATATAAAGGTATTAAAGCAGATG | amplify SaEsxB-his |
NotI-SaEsxB-his-taa-R | ATAAGAATGCGGCCGCTTAATGATGATGATGATGATGTGGGTTCACCCTATCAAGCC | amplify SaEsxB-his |
XhoI-PagC-F | CCGCTCGAGGTTAACCACTCTTAATAATAATGGGTTTTATAGC | amplify PpagC |
PacI-PagC-R | CCTTAATTAATACTACTTATTATTTACGGTGTGTTTAAACAC | amplify PpagC |
check-pCASP-R | CCGCCTTTGAGTGAGCTGATAC | check sequence from the down stream of heterologous genes |
check-PsicA-F | CGATCAACGTCTCATTTTCGCC | check sequence from the upstream of PsicA |
XhoI-PsicA-F | CTCGAGCCACAAGAAAACGAGG | amplify PsicA |
PsicA-R (no sicA rbs) | CACCGACTTTGTAGAACTTAACG | amplify PsicA |
(PsicA)invB-F | CGGTGACAGATAACAGGAGTAAGTATTAATTAAGGAAAAGATCTATGCAACATTTGG | amplify (PsicA)-invB |
invB-R (sipA) | CACTTGTAACCATTATTAATATCCTCTTCTGTTATCTCATTAGCGACCGACTAAAAAC | amplify (PsicA)-invB-(sipA) |
invB-R(sopE2) | CATTTTCTCCTCTTTAATTTATCTCATTAGCGACCGACTAAAAAC | amplify (PsicA)-invB-(sopE2) |
invB-R | ATCTCATTAGCGACCGACTAAAAAC | amplify (PsicA)-invB |
(invB)-sipA-F | GTTTTTAGTCGGTCGCTAATGAGATAACAGAAGAGGATATTAATAATGGTTACAAGTG | amplify (invB)-sipA |
HindIII-sipA-R | CCCAAGCTTTCCTGACTGAAAATACAAATTCTCTCCACCGCCAGTGTTATTTTTGATAATATCTAAC | amplify (invB)-sipA |
(invB)-sopE2-F | GATAAATTAAAGAGGAGAAAATGACTAACATAACACTATCCACCCAG | amplify (invB)-sopE2 |
HindIII-sopE2-R | AAGCTTTCCTGACTGAAAATACAAATTCTCTCCGGCCGGATCTTTACTCGC | amplify (invB)-sopE2 |
(invB)-sopA-F | GTTTTTAGTCGGTCGCTAATGAGATaaTTGATAAGGAATTGTAATGAAGATATCATCAGG | amplify (invB)-sopA |
HindIII-sopA-R | AAGCTTTCCTGACTGAAAATACAAATTCTCTCCCTTGCCTGCATTATTTGTATCTTTAATATTTTTAAC | amplify (invB)-sopA |
(sicA)-sipC-F | GTGAACAAGAAAAGGAATAATAAAGGGAGAAAAATATGTTAATTAGT | amplify (sicA)-sipC |
HindIII-sipC-R | AAGCTTTCCTGACTGAAAATACAAATTCTCTCCTCCGCTAATATCAAAAAACTTTCCGAC | amplify (sicA)-sipC |
(PsicA)sigE-F | CGTTAAGTTCTACAAAGTCGGTG GAGTCTTGAGGTAACTATATGGAAAGTC | amplify (PsicA)-sigE-(sopB) |
sigE-R-(sopB) | CCTGATTATGCATAATGCTCTTTCAATTGCTTC | amplify (PsicA)-sigE-(sopB) |
(sigE)sopB-F | GAGCATTATGCATAATCAGGAATATTAAAAACGCTATGCAAATAC | amplify (sigE)-sopB |
HindIII-sopB-R | AAGCTTTCCTGACTGAAAATACAAATTCTCTCCGTTATTAAGCTGCTTGACCTGAGC | amplify (sigE)-sopB |
pyrF-5’ | ATCCAATTTGCGCCACTTCCGGTGCCCATCATCAAGAAGGTCTGGTCATGCCGATCATATTCAATAACCCT | knockout pyrF gene |
pyrF-3’ | CCCCGTCTGCGTTGAATAAACCAGACGACTATTGGAATCGCTCATTATGCGACTAGTGAACCTCTTCGAGGG | knockout pyrF gene |
check-pyrF-R | CGGTATCGTTGTCAGAAATGCGGT | check pyrF deletion |
check-pyrF-R | CGTGATTGGTCACCAGGTTGGAAA | check pyrF deletion |
invA-5’ | GCAGAACAGCGTCGTACTATTGAAAAGCTGTCTTAATTTAATATTAACAGGATACCTATAGCCGATCATATTCAATAACCCT | knockout invA gene |
invA-3’ | CGGAACGAACTAATTCAGCGATATCCAAATGTTGCATAGATCTTTTCCTTAATTAAGCCCGACTAGTGAACCTCTTCGAGGG | knockout invA gene |
check-invA-F | TTACCAAAGCGTTTAATGCG | check invA deletion |
check-invA-R | CATCCTTCCATTATGGTCAT | check invA deletion |
SaEsxA and SaEsxB were PCR amplified from the genomic DNA of S.aureus ATCC 25923 with primers including 6 × his tag. After double enzyme digestion (BamHI and NotI), DNA fragments SaEsxA-his and SaEsxB-his were ligated into the BamHI and NotI restriction sites of pCASPs in frame with different signal peptides.
The pagC promoter (PpagC) was PCR amplified from the genomic of S. Typhimurium genomic DNA. After digested with restriction enzyme XhoI and PagC, PpagC was inserted into plasmids PsicA-invB-sipA-SaEsxA and PsicA-invB-sipA-SaEsxB to replace PsicA.
Secretion assays
Secretion assay was performed according to the method described previously with modifications [
36]. Briefly, bacteria strains were streaked on LB agar plates supplemented with appropriate antibiotics and cultured at 37 °C overnight. Single colonies were inoculated in 4 mL Luria-Bertani (LB) broth media, supplemented with chloramphenicol and streptomycin and grown overnight at 220 rpm. The next morning, bacteria cultures were diluted to an OD600 of 0.01 in 4 mL fresh LB broth, supplemented with chloramphenicol and streptomycin and grown for 2 h at 220 rpm. Then the bacteria cultures were diluted at the ratio of 1:10, into 4 mL inducing LB (0.3 M NaCl) supplemented with chloramphenicol and streptomycin, and were grown for 8 h at 160 rpm. Media and bacteria were separated by centrifugation at 4700 g for 10 min. Supernatants were filtered with 0.22 μm syringe filters (Sartorius). The supernatant samples were concentrated 20X by trichloroacetic acid (TCA) precipitation. Briefly, 100% (
w/
v) TCA was added to the supernatants to a final concentration of 20%, and incubated at 4 °C overnight. The mixture was centrifuged at 17,000 g for 5 min at 4 °C. And the pellet was washed with 500 μL cold acetone. Pellets were dried at room temperature for about 5 min and loaded onto sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) after re-suspended in 1× SDS-PAGE loading buffer. On the other hand, the bacteria pellets were washed with cold PBS once and re-suspended in PBS containing proteinase inhibitors, which is a mixture of Aprotinin from bovine lung (Sigma), Leupeptin hydrochloride (Sigma) and Pepstatin A (Sigma). The bacterial cells were sonicated for 2 min in 4 s pulses with 35% amplitude, followed by centrifugation at 19,000 g for 20 min. The supernatants were collected, and mixed with 6× SDS-PAGE loading buffer for SDS-PAGE.
Bacterial infection of RAW264.7 macrophages and translocation assays
The detection of translocated heterologous antigens was carried out as described previously with modifications [
44]. Briefly, bacteria were cultured overnight at 37 °C in LB broth supplemented with appropriate antibiotics, and subcultured at 1:30 dilution for 2 h until OD600 reached 1.5. Then bacteria were harvested by centrifugation at 17,000 g for 2 min, washed once with sterile PBS, and re-suspended in RPMI 1640 medium with 10% FBS. When Raw264.7 macrophages reached to 70–80% confluency in 60 mm tissue culture dishes, bacteria were added at a MOI of 100 and infected the cells at 37 °C for 3 h in 3 mL RPMI 1640 medium with 10% FBS. After infection, cells were washed thrice with PBS, and cultured in RPMI 1640 medium with 10% FBS containing 100 μg/mL gentamicin for another hour. After washed with cold PBS once, cells were lysed by lysis buffer which is PBS containing 0.1% Triton X-100 and proteinase inhibitors, and detached with a rubber cell scraper. Cell soluble fraction (containing bacteria-free cytosol) and insoluble fraction (containing insoluble cell components and intracellular bacteria) were separated by centrifugation at 19,000 g for 20 min. The soluble fraction samples were further filtered by 0.22 μm filter (Sartorius) to get rid of bacteria, and then concentrated by TCA precipitation, as described above. Both soluble and insoluble fractions were used for western blot analysis.
SDS-PAGE and western blot
SDS-PAGE and western blot was conducted following standard methods. Protein samples were mixed with SDS-loading dye, boiled for 10 min and analyzed by 12% SDS-PAGE. Separated proteins were transferred to PVDF membrane and blocked by 5% w/v skim milk/TBST (Tris Buffered Saline containing 0.1% Tween 20) for 1 h at room temperature. Membranes were incubated with mouse anti-6 × His tag monoclonal antibody (HIS.H8, MA1–21315) at 1:2000 v/v dilution at 4 °C overnight. After washed with TBST, membranes were incubated with Horseradish peroxidase (HRP)-conjugated sheep anti-mouse IgG (GE Healthcare Life Sciences, NA931-1ML) at room temperature for 1 h. After washed with TBST, the membranes were developed with Immobilon Western Chemiluminescent HRP Substrate (MERCK Millipore) and the signal was analyzed by Bio-Rad ChemiDocTM MP Imaging system.
Animal immunization and lethal challenge experiments
All animal experiments were approved by the Committee on the Use of Live Animals in Teaching and Research at the Laboratory Animal Unit of the University of Hong Kong (CULATR 3569–15).
5- to 6- week-old male BALB/c mice were purchased from the Laboratory Animal Unit of the University of Hong Kong, and were kept under specific-pathogen-free conditions. The immunization procedure was similar to that described previously [
26]. Briefly, BALB/c mice received three doses of S. Typhimurium vaccine by oral gavage on Day 1, Day 8 and Day 22. 4 h after mice were deprived of food and water, 100 μL 3% NaHCO3 was provided orally to neutralize the gastric acid. Then each mouse was vaccinated by 5 + E10 colony form unit (CFU) of freshly cultured and PBS-washed bacterial cells. The vaccination was conducted with a feeding needle with round bottom.
Ten days after the secondary booster, immunized mice were challenged through intravenously injecting 5E + 07 CFU of S. aureus USA 300 strain (community-associated MRSA [CA-MRSA]) or 5E + 07 CFU of Newman strains (methicillin-susceptible S. aureus [MSSA]). Mortality and clinical signs of mice were monitored for 14 days.
Animal experiments were repeated at least twice with similar results.
Enzyme-linked immunosorbent assay (ELISA)
Seven days after the second booster, ~ 100 μL blood was collected from the tail vein using Microvette® CB 300 LH (Sarstedt), and stored at room temperature for 1 h, followed by centrifugation at 2000 g for 10 min at room temperature. Sera were collected for ELISA and could be stored at − 80 °C until use. Meanwhile, ~ 70 mg of feces were collected and suspended in 400 μL PBS. Then the mixture was vortexed and centrifuged at 10000 g for 15 min and the supernatants were collected for ELISA or stored at − 80 °C.
ELISA was performed as previously described [
22]. Briefly, ELISA plates (Nuc, Roskilde, Denmark) were coated with recombinant SaEsxA (rSaEsxA) or rSaEsxB at the concentration of 1 μg/mL in coating buffer (carbonate-bicarbonate, pH = 9.6) overnight at 4 °C. Then ELISA plates were blocked with 5%
w/
v skim milk/TBST at 37 °C for 2 h. Mouse sera were serially diluted with 5% w/v skim milk/TBST at threefold and were added into the wells. While fecal extracts were serially diluted at twofold. After incubating for 1 h at 37 °C, the plates were washed five times with TBST. HRP-rabbit anti-mouse IgG2a secondary antibody (Invitrogen, 610,220), HRP-rabbit anti-mouse IgG1 secondary antibody (Thermo Scientific, PA1–86329) and HRP-goat anti-mouse IgA secondary antibody (Invitrogen, 62–6720) were used according to the manufacturer’s instructions. After incubating for 1 h at 37 °C, the plates were washed six times with TBST. For color development, plates were incubated with tetramethylbenzidine (TMB) substrate solution for 15 min at room temperature, followed by adding stop solution (2 M H
2SO4). Absorbance at 450 nm was recorded by ELISA plate reader. The antibody titre was expressed as the inverse of the greatest dilution of sera which showing over twofold OD450 readout than that of the control sample at the same dilution. The assays were conducted in duplicate and the experiment were repeated twice.
Enzyme-linked immunospot (ELISPOT) assay
Eight or nine days after the second booster, mice (3–4 mice/group) were euthanized with Pentobarbitone sodium (100–150 mg/kg, i.p.) and spleens were harvested, homogenised and forced through 70 μm cell strainer (BD) with the ends of sterile syringe plungers [
45]. The splenocytes were obtained by centrifugation at 250 g. Erythrocytes were lysed with ACK buffer for 5 min at room temperature. After washing once with PBS, splenocytes were resuspended in RPMI 1640 medium with 10% FBS, and filtered with 70 μm cell strainer (BD) to get rid of cell aggregates.
Interferon-gamma (IFN-γ) and Interleukine-17A (IL-17A) ELISPOT assays were conducted with Mouse IFN-γ ELISPOT kit (R&D Systems) and Mouse IL-17 ELISpot Kit (R&D Systems) respectively, according to the manufacturer’s instructions. Briefly, splenocytes, stimulated by antigen rSaEsxA or rSaEsxB at the concentration of 2 μg/mL, were plated at the concentration of 5E + 05 cells/well in duplicate for 20 h at 37 °C. Then plates were washed and incubated with biotinylated anti-IFN-γ or anti-IL-17A antibody overnight at 4 °C. After washing the plates, streptavidin-Alkaline phosphatase was added and incubated for 2 h at room temperature. At last, the plates were incubated with substrate BCIP/NBT Chromogen for 0.5-1 h at room temperature for color development. The spots were counted using an immunospot reader system.
Statistical analysis
Data were presented as the means ± SEM. For ELISPOT assays, the statistical significance was determined by Student’s t test. For survival rates in the lethal challenge experiments, statistical significance was determined by Log rank (Mantel-Cox) analysis. GraphPad Prism 6 was used to conduct these analyses. And a P value of < 0.05 was considered statistically significant.
Discussion
In this study, live attenuated S. Typhimurium vaccine against S. aureus was developed, in which staphylococcal antigens SaEsxA and SaEsxB were delivered into the cytosol of host cells via SPI-1 T3SS. Oral administration of these vaccines elicited multi-faceted immune responses, including both humoral and cell-mediated immune responses, which confer protection against two clinical S. aureus strains.
Specific antibodies including SaEsxA- and SaEsxB-specific IgG in serum, as well as SaEsxA-specific sIgA in fecal extract were detected in vaccinated mice. During earlier stage of
S. aureus infection, initial elimination of extracellular
S. aureus was largely dependent on opsonophagocytosis facilitated by specific antibodies and complement components in serum [
52]. Those SaEsxA- and SaEsxB-specific IgG antibodies might be crucial for binding and neutralizing
S. aureus while it is in the extracellular stage. However, previous study on protein subunit vaccines demonstrated that antibodies generated against SaEsxA and SaEsxB were not effective against
S. aureus infection, suggesting that cellular immune responses may be important to achieve good efficacy [
22].
Antigen-specific stimulation of IFN-γ secretion was detected in vaccinated mice, indicating the activation of Th1-type immune response. This data is consistent with previous reports that oral administration of
S. Typhimurium vaccine elicited Th1-biased immune responses [
1,
27,
53,
54], which effectively fight against intracellular pathogens [
55,
56]. As accumulated evidence suggested,
S. aureus is not exclusively extracellular bacterium, but is also capable of invading host cells. Upon invasion, the intracellular
S. aureus can persist and replicate in the phagosomes, while some can escape from the phagosomes and enter the cytoplasm [
57,
58]. The intracellular fate of
S. aureus in professional phagocytes was postulated to form a dissemination route of infection [
59]. Cytotoxic T cells, natural killer cells and cytokine IFN-γ are required to eliminate the intracellular bacteria [
60,
61]. Therefore, the stimulated IFN-γ secretion could play important role in the clearance of intracellular
S. aureus.
Th17 responses were also induced by
S. Typhimurium delivering SaEsxA and SaEsxB, as suggested by the detection of IL-17A
+ splenocytes. Many studies indicated the importance of Th17 responses in the protection against a wide range of bacterial and fungal pathogens [
62]. Th17 cells could mediate serotype-independent protection, through several mechanisms, such as recruiting neutrophils and macrophages to mucosal sites, activating B cell antibody responses [
63,
64]. Besides, long-life Th17 effector memory cells were detected in mucosal tissues, indicating their potential role against pathogens [
65].
Previous researchers have shown that numerous viral and bacterial antigens were delivered into the cytosol of host cells via SPI-1 T3SS, presented to MHC class I-restricted antigen processing pathway, and subsequently activated CD8+ T cell-mediated immune responses [
27,
29‐
31]. Our data showed the secretion and translocation of SipA-SaEsxA and SipA-SaEsxB fusion proteins into cytosol of Raw264.7 macrophages in vitro and stimulation of IFN-γ-dependent cellular immunity in vivo. Therefore, we hypothesized that the staphylococcal antigens delivered by
S. Typhimurium carrying plasmids pCASP-invB-sipA-SaEsxA/B were presented by MHC class I molecules to CD8+ T cells, which could fight against
S. aureus at intracellular stage.
Several limitations in the current study should be mentioned. Firstly, even though the two S. Typhimurium vaccines targeting either SaEsxA or SaEsxB could elicit significant antigen-specific immunity, neither of them conferred effective protection against the challenge with both S. aureus USA 300 and Newman strains. As suggested by previous articles that, in comparison with single-antigen vaccine, multivalent vaccines could evoke broad immune responses, and confer protection against different serotypes of S. aureus. Thus, to improve S. Typhimurium vaccine, a multivalent vaccine should be designed to facilitate the simultaneous delivery of SaEsxA, SaEsxB and other antigens. Secondly, antigen expression level in the recombinant attenuated Salmonella is one of the most fundamental determinants of vaccine efficacy. It’s observed that the expression level of SaEsxB in S. Typhimurium is comparatively low, thus codon optimization of SaEsxB should be conducted to ensure optimal amount of SaEsxB expressed and delivered into host cells to achieve more potent immunogenicity.