Background
Hepatocellular carcinoma (HCC) is the sixth most common malignancy and the third most common cause of cancer-related deaths [
1]. Uncontrolled tumor growth, metastasis and the absence of effective therapeutics account for the poor overall survival (OS) of HCC patients. Although surgical resection improves survival, the prognosis for HCC remains unsatisfactory, mainly because of intrahepatic dissemination and extrahepatic metastasis [
2]. Angiogenesis is required for metastasis [
3,
4], and several mechanisms of tumor vessel formation have been proposed, including vasculogenesis, angiogenesis, intussusceptions, vascular cooption and vasculogenic mimicry (VM). VM describes the
de novo formation of perfusable, matrix-rich and vasculogenic-like networks by aggressive tumor cells in 3-dimensional (3D) matrices in vitro, which parallels matrix-rich networks in aggressive tumors in patients [
5]. Studies have described VM as an alternative circulatory system to blood vessels in multiple malignant tumor types, including HCC [
6].
VM, which recapitulates embryonic vasculogenesis [
7], was reported to be associated with high tumor grade, short survival, and invasion and metastasis in clinical trials [
8‐
10]. The initial morphologic and molecular characterization of tumor VM cells revealed co-expression of endothelial and tumor markers and formation of functional tubular structures containing plasma and red blood cells, indicating a perfusion pathway for rapidly growing tumors [
11]. In addition, the direct exposure of tumor cells lining the inner surface of VM channels to blood flow indicates an escape route for the metastasis process. Considering the diverse nature of vascular perfusion pathways in tumors, it may be prudent to test the efficacy of currently available angiogenesis inhibitors on tumor cell VM in addition to angiogenesis driven by endothelial cells [
12].
Rho small GTPase and its serine/threonine kinase downstream effector ROCK play a crucial role in diverse cellular events, including the acquisition of unlimited proliferation potential, survival and evasion from apoptosis, tissue invasion differentiation, gene expression, regulation of cell detachment, cell movement and establishment of metastasis [
13,
14]. Recently, growing attention has been paid to the emerging role of the cytoskeleton in the modulation of cell cycle and apoptosis. In some cell types, ROCK is involved in the intracellular signaling that initiates apoptosis, such as Caspase8, Caspase10, and Caspase3 activation [
15], or the transcription of proapoptotic proteins, such as Bax [
16]. Interestingly, our previous study showed that ROCK was involved in VM formation in an HCC cell line [
17], and we hypothesized that unlimited proliferation triggered by ROCK activation may be the key point of regulating tumor cell VM and endothelial cell-driven angiogenesis simultaneously.
Incarvine C (IVC), an ester alkaloid isolated from the traditional Chinese medicinal plant
Incarvillea sinensis (Bignoniaceae), also known as “Jiaohao (Kakko)” or “Tougucao” [
18], has long been used for treating rheumatism and relieving pain in traditional Chinese medicine. However, most alkaloids, originally identified as having anti-inflammatory and anti-viral activities, now are also known to have anti-tumor activities by targeting the apoptosis pathways in cancer [
19]. IVC, originally identified as a precursor compound of incarvillateine, has similar activities to morphine [
20]. However, the potential effect of IVC on VM and proliferation of highly metastatic HCC cells through ROCK has not been fully studied.
In the current study, with the aim of developing novel and more efficient treatment strategies by targeting VM, we explored the underlying mechanisms of IVC on VM in HCC cells. Our results showed that IVC had a profound inhibitory effect against MHCC97H cell proliferation and migration by promoting MHCC97H cell cycle arrest and apoptotic death. Our findings may serve as strong evidence to suggest that IVC executes a significant inhibitory effect against VM and migration of MHCC97H cells by regulating ROCK, and therefore IVC may prove to be a promising anti-HCC agent.
Methods
Chemical and antibodies
Chemicals and antibodies used in this study include Matrigel (BD Biosciences); cell culture media (RPMI 1640, DMEM and MEM), fetal bovine serum (FBS) and antibiotics (Gibco); Y27632 and other chemicals (Sigma-Aldrich); anti-VE-cadherin, MYPT-1 and p-MYPT-1(Thr853) antibodies (Cell Signaling); PE Annexin V Apoptosis Detection Kit and PI/RNase Staining Buffer (BD PharmingenTM). The other reagents were purchased from Abcam Inc. (Cambridge).
IVC preparation
IVC was extracted as previously described with some modifications [
18]. The air-dried powered aerial part (15 kg) of
I. sinensis was refluxed with 80 % EtOH (30 L). The aq. brownish syrup (6 L) obtained after removing EtOH under reduced pressure was dissolved in 2 % HCl solution and filtered. The filtrate was adjusted to pH 9–10, mixed with NH
4OH, and extracted with CHCl
3. The CHCl
3 extract (68 g) was subjected to column chromatography on silica gel (SiO
2, 200–300 mesh) with a petroleum ether/AcOEt gradient elution system (100:1 → 5:1) to yield five fractions (1–5). Fraction 5 was purified repeatedly by eluting with CHCl
3/MeOH (1:2) to afford IVC (6 mg). The IVC solution at a concentration of 20 mg/ml was prepared by dissolving in dimethyl sulfoxide (DMSO). The final DMSO concentration did not exceed 0.5 % throughout the study.
Cell lines
The HCC cell line MHCC97H was obtained from the Liver Cancer Institute, Zhongshan Hospital of Fudan University (Shanghai, China). HCC cell lines SMMC7703, SMMC7721, HepG2 and Hep3B; prostate carcinoma cells PC3 and LNCap; lung cancer A549 cells; colon cancer HCT116 cells; and cervical cancer Hela cells were from the cell bank of the Chinese Academy of Sciences (Shanghai, China). All cell lines were cultured separately in RPMI 1640 (HUVECs, SMMC7703, SMMC7721, PC3, LNCap, A549), MEM (HepG2 and Hep3B) and DMEM (MHCC97H, HCT116 and Hela), supplemented with 10 % FBS and antibiotics. All cultures were maintained at 37 °C in a humidified atmosphere of 5 % CO2.
Tumor cell formation of the capillary structure in vitro was tested as previously described [
17], except that the effect of IVC on tube formation was studied by adding culture medium containing IVC into the wells immediately after cell seeding to a final concentration of 7.5, 15 or 30 μM for 24 h.
MHCC97H cells treated with IVC for 48 h were harvested. A total of 1 × 103 cells per well suspended in 150 μl Mix agar with 1.5 ml DMEM/10 % FBS were plated in a 6-well plate overlying a 1 % agar-DMEM/10 % FBS (1:1) bottom layer. After 3 weeks, colonies were photographed at 4×. The remaining survival large colonies were manually counted.
Western blot analysis
Cells were treated with different concentrations of IVC or Y27632 for 24 h. Total protein was extracted and electrophoresed using SDS-PAGE. Proteins on the gel were transferred onto PVDF membranes (Merck-Millipore), followed by blocking with 5 % skimmed milk dissolved in TBS containing 1 % Tween-20 (TBST) for 1 h at room temperature. The membrane was incubated with primary antibody at 4 °C overnight, washed with 1 % TBST three times, and incubated with alkaline phosphatase-conjugated secondary antibody for 1 h at room temperature. After washing, the chemiluminescence signal was imaged using ChemiDoc XRS (Bio-Rad) and quantitated using Image J.
cDNA generation and real-time qPCR
Cells were treated with 7.5, 15, 30 or 60 μM IVC for 16 h. Total RNA was extracted from cells using Trizol (Invitrogen) and verified by electrophoresis. The mRNA was reverse transcribed into cDNA with a reverse transcription kit (Thermo Fisher Scientific). Human GAPDH Endogenous Reference Genes Primers (Order NO.: PHS04) and primer sequences listed in Tables
1 and
2 used for PCR were from Sangon Biotech. SYBR Green I (Amersco) was added into the reaction mixture. Real-time qPCR was performed on an MJ Opticon 2 thermal cycler (MJ Research Inc.) following the manufacturer’s instruction.
Table 1
Sequences of primers
CDK-2 | TACTTCTATGCCTGATTACA | TGGGGTACTGGCTTGGTCAC | 199 |
CDK-4 | GCTACCAGATGGCACTTACACC | GCAAAGATACAGCCAACACTCC | 118 |
CDK-6 | GCCCACTGAAACCATAAAGGA | TACCACAGCGTGACGACCA | 204 |
Cynlin-A1 | TGTCACCGTTCCTCCTTGG | GGGCATCTTCACGCTCTATTT | 125 |
Cynlin-B1 | GCTCTTGGGGACATTGGTAAC | CAAAATAGGCTCAGGCGAAA | 234 |
Cynlin-C1 | TTGATTGCTGCTGCTACTTCTG | CGTTCTGTAGGTATCATTCACT | 237 |
Cynlin-D1 | GGAACAGAAGTGCGAGGAGG | GGATGGAGTTGTCGGTGTAGAT | 191 |
Cynlin-E1 | CCTGGATGTTGACTGCCTTGA | TGTCGCACCACTGATACCCT | 113 |
p21 | GACACCACTGGAGGGTGACT | CACATGGTCTTCCTCTGCTG | 166 |
p27 | TAGAGGGCAAGTACGAGTGG | CAGGTCGCTTCCTTATTCC | 258 |
P53 | GTTCCGAGAGCTGAATGAGG | TGAGTCAGGCCCTTCTGTCT | 157 |
Table 2
Sequences of primers
VE-cadherin | CATTTGTCGTGCCTGAAGAC | ATGGTGAAAGCGTCCTGGTA | 133 |
EphA2 | CCCGGAGGACGTTTACTTCT | GGATGGATGGATCTCGGTAG | 124 |
PI3K | CGTTTCTGCTTTGGGACAAC | CCTGATGATGGTCGTGGAG | 100 |
MMP14 | TATGGCTTCTGCCCTGAGAC | GGGTTTCTTCTGCCCACTT | 120 |
MMP2 | TATGGCTTCTGCCCTGAGAC | CACACCACATCTTTCCGTCA | 142 |
MMP9 | CAGTCCACCCTTGTGCTCTT | ACTCTCCACGCATCTCTGC | 118 |
LAMC2 | ACATTCCTGCCTCAGACCAC | TCCCTTGTCAGTTGCTCCAT | 121 |
Immunostaining
After fixation for 20 min in 4 % paraformaldehyde at 37 °C, cells were permeabilized for 15 min in 0.5 % Triton-X and subsequently blocked in 5 % goat serum for 1 h. After incubation with the appropriate primary (overnight incubation at 4 °C) and secondary (2 h at 37 °C) antibodies, the cells were imaged using a confocal laser scanning microscope (Leica TCS SP8).
Cell morphology assay
MHCC97H cells were plated at 8 × 103 cells per well in an 8-chamber slide in serum-free medium (serum starvation) for 24 h. After serum starvation, cells were treated with vehicle, Y27632 or IVC for 1 h. After treatment, cells were fixed with 4 % paraformaldehyde, permeabilized using 0.1 % Triton X-100 and stained with phalloidin (Sigma, USA) and DAPI (blue). Cells were imaged using a confocal laser scanning microscope (Leica TCS SP8).
Cell migration assay
Cell migration was evaluated using an in vitro wound healing assay. In brief, MHCC97H cells containing IVC at a final concentration of 7.5, 15 or 30 μM were seeded to a six-well plate and incubated for 8 h to allow the formation of a cell monolayer. Cells were scratched with the tip of a 200 μl pipette and then incubated at 37 °C in a humidified atmosphere of 5 % CO2 for 48 h. To observe the wound healing, each well was observed at 0, 24 and 48 h after scratching.
Matrigel invasion assay
Invasion was assayed in Transwell cell culture chambers (Corning Costar) attached with a membrane filter (8.0 μm pore size; Nucleopore). Briefly, the inserts in the membrane filter were coated with Matrigel on the upper surface. MHCC97H cells were adjusted to a density of 1 × 106 cells/ml in serum-free DMEM high glucose culture medium. Cell suspension (200 μl) was seeded into the upper surface, while the lower chambers were filled with 500 μl DMEM medium with 20 % FBS. After culture at 37 °C in a humidified atmosphere of 5 % CO2 for 48 h, the cells that invaded the Matrigel matrix and adhered to the bottom surface of the membrane were fixed with methanol and stained with 0.5 % crystal violet. The number of invading cells was counted using an inverted light microscope (Nikon, Japan). Assays were performed in duplicate wells.
Cell apoptosis, cell cycle and cell viability assessment
Apoptosis and cell cycle of MHCC97H cells exposed to IVC (3.75, 7.5, 15, 30 or 60 μM) for 24 h were examined by flow cytometry (BD Accuri C6). For the apoptosis assay, cells were stained with PE Annexin V and 7-amino-actinomycin (7-AAD) following the manufacturer’s instructions to detect early apoptotic cells (PE Annexin V+/7-AAD- events) and late apoptotic cells (PE Annexin V+/7-AAD+ events). For the cell cycle assay, cells were fixed with 70 % ethanol overnight at 4 °C, washed with PBS, re-suspended in 500 μl PBS with 100 μg/ml RNase and incubated for 30 min at 37 °C. Next, 2.5 μl PI solution (10 mg/ml) was added and cell cycle was analyzed. For cell viability assays, MHCC97H cells were trypsinized and seeded at 1 × 104 cells/well in a 96-well plate. After 24 h, various concentrations of IVC were added, followed by incubation for another 48 h. Next, 10 μl CCK8 (Dojindo) solution was added to each well and the plate was incubated for additional 2 h. Absorbance readings at 490 nm were obtained using a spectrophotometer (Thermo Varioskan).
Statistical analysis
The data were expressed as mean ± standard errors (S.E.) and examined for their statistical significance of difference with ANOVA and the Student’s t-test. P-values of less than 0.05 were considered statistically significant.
Discussion
Gene-expression analysis of human HCC has led to the successful molecular classification of HCC into six robust subgroups of cancers (G1–G6) associated with clinical and genetic characteristics [
21]. Despite the recent advances in treatment, the mortality rate of HCC remains high, and therefore new effective anti-HCC drugs are urgently needed. Better understanding about the molecular mechanism of HCC invasiveness is essential for the development of effective treatment of HCC. It is generally recognized that the high metastatic ability of HCC cells is the critical reason for the fatalities associated with HCC [
22]. The growth and metastasis of HCC cells depend on an effective microcirculation. Effective microcirculation in aggressive tumors consists of vasculogenesis, angiogenesis and VM causing resistance to conventional anti-angiogenic medicaments, and thus many researchers have been seeking to develop new angiogenic and VM inhibitors from cleaved proteins, monoclonal antibodies, synthesized small molecules and natural products [
23,
24]. These new anti-vascular therapeutic agents should be able to target both angiogenesis and VM, anti-VM therapy for tumor VM [
25]. Although IVC was originally identified as a precursor compound of incarvillateine, details about the pharmacological mechanism underlying the anti-tumor activity of IVC have not been clarified. The results of the present study demonstrated that IVC exhibited remarkable inhibitory effect on several types of cancer cells, including MHCC97H cells. Importantly, IVC dose-dependently inhibited the proliferation of MHCC97H cells, which are known to have the capacity of VM formation [
17], suggesting that IVC is a potential new anti-HCC drug candidate.
Deregulation of the cell cycle leads to robust tumor cell proliferation, which is an important hallmark of cancer [
26]. Progression through the S-phase must be strictly controlled so that cells undergo only a single round of chromosomal DNA replication. Our cell cycle analyses demonstrated that IVC caused the accumulation of MHCC97H cells at G1 phase and only CDK-2 and cyclin-E1 were down-regulated after IVC treatment. Previous studies reported that the CDK-2/cyclin-E1 complex plays a crucial role during the transition from G1- into S-phase [
27]. CDK inhibitors including p21 and p27 and the tumor suppressor p53 also play a key role in regulating cell cycle progression through suppressing CDK-2 activity and G1/S phase transition [
28,
29]. Our real time-qPCR and western blot results showed that p21 and p53 were up-regulated after IVC treatment, without any changes on the other CDKs/cyclins, suggesting that IVC induced MHCC97H cell cycle arrest at G1 phase probably via upregulating p21 and p53. We also found that 15 μM IVC treatment induced significant cell apoptosis, and this IVC-induced apoptosis may be associated with PARP and Caspase3 degradation, which is consistent with other studies [
30]. These results suggest that IVC may be a potential antiproliferation agent for HCC.
Accumulating evidence indicates that Rho and the downstream target ROCK plays an important role in oncogenesis. ROCK promotes actin filament stabilization and the generation of actin-myosin contractility. Y27632 or fasudil, inhibitors of ROCK, caused loss of actin stress fibers and focal adhesion complexes [
31]. We found that treatment of MHCC97H cells with IVC decreased the level of p-MYPT-1 and distributed stress fiber formation in a concentration-dependent manner similar to the case with Y27632 (Fig.
4), indicating that IVC is a potential mediator of Rho/ROCK. Given the volume of the literature supporting a role for Rho/ROCK in controlling cell movement, it is not surprising to find that inhibition of IVC blocked MHCC97H migration and invasion, which is similar to the finding of our previous study [
17]. The inhibitory effects of IVC with different concentrations on cell migration and invasion and ROCK activity were below IC
50 value of 35.7 ± 4.7 μM in order to avoid potential toxicity. Thus, IVC could effectively exert a regulated impact on cell migration and invasion, but are hardly associated with cytotoxicity of the compound.
Rho GTPases contribute to multiple cellular processes that could affect cancer progression, including cytoskeletal dynamics, transcriptional regulation, vesicle trafficking, apoptosis, cell cycle progression and migration [
32]. ROCK activity is necessary for progression from G1 to S-phase by controlling the expression of cyclins, CDKs, and numerous other cell cycle regulators [
33]. Furthermore, ROCK activity has been shown to promote CDK-2 and cyclin-E1 translocation into the nucleus [
34], suggesting that inhibition of ROCK signaling may lead to cell cycle arrest in G1 phase. Moreover, ROCK inhibition has been shown to increase phosphorylation of p53 [
35,
36]. Additionally, ROCK proteins are essential for multiple aspects of both the intrinsic and extrinsic apoptotic processes, including regulation of cytoskeletal-mediated cell contraction and membrane blebbing, nuclear membrane disintegration, modulation of Bcl-2 family member and caspase expression/activation and phagocytosis of fragmented apoptotic bodies [
34]. This finding could serve as an explanation why IVC not only mediates G1 arrest but also induces apoptosis. Together our results suggest that IVC mediates the proliferation of human cancer cells via downregulating the Rho/ROCK pathway.
However, our previous finding that ROCK inhibitor: Y27632 at the concentrations up to 50 μM does not essential for survival and proliferation of MHCC97H cells [
17], which is different to the results of IVC, suggests Y27632 and IVC have distinct effects on cell proliferation and apoptosis. In respect of these differences, we found that long-term treatment with fasudil improved pulmonary vascular remodeling with suppression of vascular smooth muscle cells (VSMC) proliferation and enhancing of VSMC apoptosis [
37], which is similar to the result of IVC but is different to Y27632 [
17], indicating that each compound has various functions with respective or unique mechanism. Interestingly, Y27632 has been reported to have opposite effects on cell motility. Koga et al. [
38] reported that Y27632 promoted human trabecular meshwork cells in adhesion, contraction and motility, which was inconsistent with our or other reports [
17,
39,
40], implying that same compound has a wide variety of effects on different cell line. Moreover, growing number of ROCK inhibitors have been reported, however, their pharmacological effects varied in different diseases [
41].
Besides, it is well known that ROCK have two subtypes: ROCK1 and ROCK2. However, Y27632 targets the highly conserved kinase domain of ROCK, which does not distinguish between ROCK1 and ROCK2 isoforms. Inhibition of ROCK1 resulted in a decreased proliferation, whereas inhibition of ROCK2 had the opposite effect, significantly enhancing proliferation relative to the control cells and regulating cyclin D1 [
42‐
44] to mediate the canonical Wnt/TCF pathways involving β-catenin. Therefore, the relative contribution of these kinases to the effects of Y27632 treatment differ in different cell types and cellular processes. This is an important consideration in developing specific therapeutics tailored to distinct cellular responses and diseases. Taken together, our manuscript showed that Y27632 and IVC have distinct effects on cell proliferation and apoptosis, further investigation will be performed to explain what’s different.
Our previous study reported that selective blockage of ROCK with Y27632 reduced the formation of tubule-like structures in a dose-dependent manner [
17]. Therefore, we further investigated the anti-VM activity of IVC. Similarly, here we found that IVC reduced VM in a dose-dependent manner compared with Y27632. The key signaling pathway of VM formation is the colocalization of VE-cadherin and activation of PI3K by EphA2, which subsequently induce the expression and activation of MMP-14, which subsequently triggers MMP-2 activation. MMP-14 and MMP-2 promote the cleavage of LAMC2 to the pro-migratory γ2′ and γ2 × fragments. Our investigation showed that VM-associated genes were down-regulated, suggesting that IVC could attenuate the characteristics associated with tumor cell plasticity essential for VM. To prove IVC as a potential anti-VM candidate, we will continue to perform animal experiments to examine tumor size, invasion and VM-associated genes in nude mice.
Competing interests
The authors have declared that no competing interests exist.
Authors’ contributions
ZJG carried out the design of the experiments, performed most of the experiments and drafted the manuscript. ZDD participated in the design of the experiments, western blot and cell culture. WX and WYZ participated in statistical analysis and interpretation. GSY and ZGH participated in animal experiments. LXY participated in the statistical analysis and helped draft the manuscript. LQ and LGL participated in the design of the experiments and helped draft the manuscript. All authors read and approved the final manuscript.