Background
Retinoblastoma is the most common paediatric ocular malignant tumor occurring in 1 of every 15,000–20,000 live births [
1,
2]. This tumor is caused due to inactivation of both the alleles of Retinoblastoma (
RB1) gene resulting in the defective pRB protein.
RB1 is a major tumor suppressor gene that is involved in cell cycle progression, DNA replication and terminal differentiation [
3]. Loss of pRB activity in the retinal progenitor cells leads to impaired cell cycle, uncontrolled cell proliferation and tumor progression. In addition to RB1 as the rate-limiting step for tumor initiation, there are multiple genes (oncogenes and tumor suppressor genes) that undergo mutations, such as
MYCN gain, loss of 16q, etc., thereby promoting tumorigenesis [
4,
5]. Recent studies have shown that there are cases of unilateral Retinoblastoma that are devoid of Rb mutations and these tumors have distinct histological and genomic landscapes (e.g. high MYCN expression) that facilitate aggressive tumor formation similar to that seen in RB1(−/−) tumors [
4,
6]. The hypothesis of cancer stem cells (CSCs), which is now synonymous with tumor initiating cells (TICs) and stem-like cancer cells (SLCCs), originated first from blood related cancers, wherein a small fraction of the tumor cells were reported to be responsible for tumor formation and were attributed with properties of normal stem cells such as quiescence, proliferation, and drug resistance [
7]. The salient features of both CSCs and normal stem cells are their potency for self-renewal and forming a cellular hierarchy within the tumor/normal tissue. Additionally, both stem cells and CSCs have the ability to differentiate and migrate [
8]. In paediatric brain cancers, tumor derived progenitors form neurospheres that can be passaged at clonal density and are able to self-renew. These cells express several genes characteristic of neural and other stem cells including
CD133, NESTIN, SOX2, MSI1, BMI1, MELK, OCT4, etc. [
9,
10].
In retinoblastoma, several studies have reported the presence of stem cells in both primary tumors as well as cell lines, using a few properties attributed to cancer stem cell phenotype, ability to actively extrude drugs, slow cycling, clone formation post nutrient starvation, etc. [
11‐
16]. Seigel and co-workers showed the presence of Hoechst dye exclusion, Bromodeoxyuridine (BrdU) label retaining cells, Aldehyde Dehydrogenase 1 (ALDH1) and stem cell markers in the total population of Rb cell lines, primary tumors and simian virus-40 luteinising hormone β sub-unit Large T-antigen (SV40 βLH-T-Ag) mouse tumors [
12,
13]. In cultured primary tumors cells, expression of a few retinal development related genes and in vivo tumorigenicity was demonstrated by Zhong et al., thereby hinting at a presence of stem-like cancer cells within Rb tumors [
17]. Our group provided evidence of putative stem-like cells in primary Rb tumor cells using a bi-parameter model by flow cytometry with a phenotype of low CD133, high CD44 expression and small sized cells (FSC
lo/SSC
lo/CD133
lo/CD44
hi) expressing progenitor cell markers (
PROX1 and
SYX1A) [
18]. Similar to our study on primary Rb, we observed the two parametric distribution of Rb Y79 cell line with a small subset of cells exhibiting low forward and side scatter profile with low CD133 expression (FSC
lo/SSC
lo/CD133
lo). It is interesting to note that other than the studies on normal developing retina and Rb deficient retinal cells, which suggests that CD133 expression is low in progenitors and high in differentiated photoreceptors [
19,
20], the Rb tumor studies suggest that CD133 expression is specific to cancer stem cells [
15,
17,
21]. This prompted us to investigate the surface marker profile of Y79 cell line and compare the functional properties of CSCs [
22] within the CD133 sorted populations.
Methods
Cell culture
Retinoblastoma Y79 cells (Riken: RCB1645 Y79 - a generous gift from Dr. S. Krishnakumar, Sankara Nethralaya, Chennai, India) were revived and cultured in Roswell Park Memorial Institute-1640 (RPMI-1640) media supplemented with 10% Fetal Bovine Serum (FBS), antibiotics and L-Glutamine (Gibco™, ThermoFisher Scientific). The cell line was authenticated at the time of purchase from Riken. Regular mycoplasma tests have been carried out and the experiments were conducted in compliance with good laboratory practices (GLP). Media was changed every 3 days and the cells were sub-cultured following observation of cell confluency of about 70%. Enrichment and characterization of putative cancer stem cells were carried out in the cultured Y79 cells and then sorted using the surface marker, CD133. In vitro functional characterization of the sorted subsets was carried out to assess the cell cycle status, clone forming ability, differentiation, invasion, chemoresistance and gene expression signature.
Flow Cytometry analysis and sorting
One million Y79 cells were stained by incubating with directly labelled primary antibodies (CD133-Miltenyi Biotech, CD44, CD90, CXCR4-Ebioscience and ABCB1-Abcam) for 45 min at 4 °C. The antibodies were standardized by varying their dilutions and checking the expression percentage. The cells were then washed thrice with wash buffer to remove excess antibody and run in the BD LSRFortessa™ flow cytometry analyser and the analysis was done using FACSDiva™ software version 6.2. Appropriate controls were used for the experiments. A total of 20,000 to 50,000 events were acquired for analysis. The cells were gated based on size, granularity and doublet discrimination as described previously [
18]. In brief, Y79 cells were first selected based on forward and side scatter, and the doublets were excluded using the doublet discrimination plots. The negative control (unstained cells) is used to set the laser voltages, sorting gates and establish the Allophycocyanin (APC) expression profile for the population. The labeled cells were then run through the cytometer and the two populations (CD133hi and lo) are collected in tubes with medium containing 2X antibiotic solution. The post-sort purity and viability was determined. The sorted cells were then used for CSC characterization.
Magnetic activated cell sorting
The Y79 cells in their growth phase were sorted using the CD133 Microbead Kit according to the manufacturer’s protocol (Miltenyi Biotec Inc., Auburn, CA). Briefly, the cells were centrifuged at 300 g for 10 min and resuspended in 300 μL of buffer per 107cells. 100 μL of FcR Blocking Reagent was added and mixed well. To the cell suspension, 100 μL of CD133 Microbeads were added, mixed well and incubated for 30 min at 4 °C. The cells were washed twice with the buffer and resuspended in 500 μL of buffer. Magnetic separation was carried out in LS columns using the MiniMACS™ separator and the two populations were collected in labelled tubes. The sorted cells were then assessed for CD133 expression using flow cytometry for determining the sorting purity and further experiments were carried out following viability count using Trypan blue.
Cell cycle analysis
Sorted CD133hi, CD133lo and unsorted total Y79 cell populations were pelleted by centrifugation and resuspended in PBS with 50 μg/ml propidium iodide for cell cycle analysis. After incubation on ice for 30 min, cell populations were treated with 0.25 mg/ml RNaseA for 45 min at 37 °C to remove RNA. Cells were analysed by flow cytometry at an excitation wavelength of 488 nm and the cell cycle histogram was assessed using the BD FACSDiva software.
The sorted CD133hi and CD133lo Y79 cells were grown in agarose as single cells to assess their colony forming potential. Briefly, a base coat of 0.8% agarose was added into the wells of a 24-well plate and further covered with cell suspension (1000 cells/well in 0.48% agarose). Plates were incubated for 2 weeks following which the resulting colonies were then fixed with 3.7% paraformaldehyde and stained with crystal violet. The images of the colonies were taken at 1.5X and 4X magnification and analysed using ImageJ and OpenCFU software. For colony forming efficiency (CFE) analysis, colonies greater than 50 cells were counted and percentage of colonies were calculated. The morphology of the colonies was assessed for characteristics of holoclones, meroclones and paraclones. The CD133lo clones were then expanded and the expression of CD133 was checked for four passages in vitro.
Matrigel Transwell invasion assay
The Matrigel transwell invasion assays were performed using Corning transwell 24-well inserts with 8 μm pore size as per manufacturer’s instructions. Briefly, 104 cells each of CD133hi and CD133lo subsets were serum-starved overnight and plated into 100 μl serum-free medium onto the inner chamber of the transwell plate, which was previously coated with Matrigel (1:50) (BD Biosciences). The bottom well was then filled with 600 μl of media with 10% serum. The cells were incubated for 24 h at 37 °C and 5% CO2 level. Following incubation, the media was removed from the plate and the non-invasive cells were scraped off from the upper side of the insert and the cells in the lower side of the membrane were fixed in 3.7% Paraformaldehyde (PFA), washed, and stained using crystal violet. Experiments were performed in triplicate transwell and the invaded cells were quantified by counting the average number of cells per 20X field of view and 10 fields per chamber.
Cytotoxicity assay
The sorted Y79 cells (CD133hi and CD133lo) were assessed for chemoresistance against Carboplatin (Alkem Pharmaceuticals) using MTT assay. Briefly, 5000 cells/90 μL media each of the populations were seeded in a 96 well plate and incubated overnight at 37 °C and 5% CO2 level. Carboplatin was added at varying concentrations (1 μM–100 μM) at a final volume of 10 μL in the wells and incubated for 48 h. Following incubation, 20 μL of 5 mg/mL MTT reagent was added to each well and incubated for 3 h. The Formazan crystals formed were dissolved in 100 μL of Dimethyl sulfoxide (DMSO) and the absorbance was recorded at 595 nm using an ELISA plate reader. The percentage of viability was calculated compared to the controls for each of the population and drug concentration.
Gene expression microarray and pathway analysis
Microarray was performed in duplicates using human whole genome (4x44K) cDNA arrays (Agilent technologies, USA). Labelling reactions were performed using 500 ng of RNA from CD133
hi and CD133
lo populations. Labelling of the probes was carried out using the Low RNA input linear amplification kit (Agilent technologies, USA) where total RNA was first converted to cDNA using T7-oligo d(T) primers. From this cDNA, labelled cRNA was generated via an in vitro transcription reaction using T7 RNA polymerase and Cy3 (for CD133
hi population) or Cy5 (CD133
lo population) labelled CTP respectively. Probes with higher labelling efficiency (specific activity ≥8 pmol Cy3 or Cy5/ng cRNA) were selected for competitive hybridization as per the manufacturer’s instructions. 825 ng each of Cy5 and Cy3 labelled cRNAs from CD133
lo and CD133
hi populations were mixed and added to hybridization buffer and placed on the array. Hybridization was done in a chamber (Agilent technologies, USA) for 17 h at 65 °C with gentle rotation. The slide was scanned and image was analysed using feature extraction tool version 9.5.3.1 (Agilent technologies, USA) and data was analysed using GeneSpring version 10 (Agilent technologies, USA). Lowess algorithm was used to normalize the data. Fold change was calculated based on ratio of Cy5/Cy3 intensities and genes with fold change ≥ + 1.5 or ≤ − 1.5 where considered differentially regulated for which with
p-values were assessed. Further, we performed functional enrichment analysis to identify enriched biological processes and pathways in our differentially regulated genes using DAVID bioinformatics resources (version 6.8) and KEGG pathway database [
23,
24]. Biological processes and pathways with
p-value ≤0.05 where considered significantly enriched. Additionally, we validated the up-regulated genes involved in pathways using Polymerase Chain Reaction (PCR).
Semi quantitative PCR
Total RNA was isolated from the sorted populations by the TRIzol™ method of solubilisation and extraction. The isolated RNA was quantified using Nanodrop and cDNA was prepared using SuperScript™ First-Strand Synthesis System kit (Invitrogen). The prepared cDNA was then analysed for the expression of
ACTB, BMI1, CD133, NANOG, PROX1, MACC1, SNAI2 and
ABCG2 genes by semi-quantitative PCR. The primer sequences used for PCR are enlisted in Table
1. The samples were then observed for gene expression using a 2% agarose gel and the image was captured using BioRAD ChemiDoc™ and Image Lab software.
Table 1
Primer sequences for the genes used in semi-quantitative PCR
S No. | Gene | Forward primer | Reverse primer |
1. | ACTB | atgcagaaggagatcactgc | tcatagtccgcctagaagca |
2. | CD133 | cctctggtggggtatttctt | aggtgctgttcatgttctcc |
3. | BMI1 | gcttcaagatggccgcttg | ttctcgttgttcgatgcatttc |
4. | NANOG | caaccagacccagaacatcc | ttccaaagcagcctccaag |
5. | OCT4 | atgcattcaaactgaggtgcctgc | ccaccctttgtgttcccaattcct |
6. | PROX1 | caagttgtggacactgtggt | gcagactggtcagaggagtt |
7. | MACC1 | cggtcaggaagaattgcac | ttaccacgaagggtgaaagc |
8. | SNAI2 | tgtgacaaggaatatgtgagcc | tgagccctcagatttgacctg |
9. | ABCG2 | ggaactcagtttatccgtgg | cgaggctgatgaatggagaag |
Statistical analysis
The quantitative data were stated as Mean ± SEM, and GraphPad Prism (GraphPad Software, La Jolla, CA) was used for unpaired Student’s t-test and ANOVA with Bonferroni’s Post-hoc tests. The representative images were analysed using ImageJ software. The experiments were repeated at least thrice with biological replicates and p < 0.05 was considered for statistical significant difference between the groups.
Discussion
Retinoblastoma is a small round cell tumor that comprises of rapidly dividing tumor cells, arising from the retina, within extensive areas of ischemic necrosis as they outgrow their own blood supply [
25]. This study attempts to characterize the stem-like cancer cells in the well-established Rb Y79 cell line using the surface marker widely used in other tumors for CSC isolation- CD133 (Prominin). The study confirms that Y79 Rb cell line harbours stem-like cancer cells endowed within the CD133
lo enriched population. This was demonstrated by CSC properties such as exclusive surface marker phenotype, size and percentage, slow cycling/dormancy, clone forming ability and differentiation, invasiveness, chemoresistance and primitive gene expression markers.
While in several solid tumors [
26], CD133
hi cells are heralded as the cells with CSC properties, there are also contrasting reports of CD133
lo subset being capable of exhibiting tumorigenicity and clone forming ability in tumors such as Glioma [
27], Glioblastoma [
28], Colon cancer [
29], etc. Sun and co-workers reported that in neural stem cells, the CD133 negative population are clonogenic and slow cycling in nature [
30]. In the developing retina, CD133, which is a conserved surface glycoprotein, is reported to be acquired upon differentiation. In support of this observation is the study by Lakowski et al. who reported that the neuroblastic layer of developing photoreceptors showed lower expression of CD133 when compared to the outer segments of the photoreceptors that had intense expression [
19]. Also, Xu and their group showed that in Rb deficient retinal cells, CD133 expression was strong in maturing photoreceptors and weak in the retinal progenitor cell population [
20]. Studies have shown that CD133 (Prominin) is crucial for photoreceptor outer segment morphogenesis and the mutations within the gene is associated with several retinal dystrophies which ascertains its pivotal role in the visual cycle [
31]. It therefore appears logical to speculate that the CD133 is a marker acquired after cellular differentiation in Retinoblastoma, and the putative CSCs would lack the expression similar to progenitors, since they are believed to arise from the undifferentiated retinal cells.
One of the challenging issues in characterizing CSCs is the sorting/enrichment strategies which are crucial for validating the functional attributes of stem-like cancer cells [
22].With regard to Rb primary tumors, our earlier work highlighted, using a bimodal pattern, that FSC
lo/SSC
lo CD133
lo/CD44
hi cells show more primitive markers as compared to CD133
hi cells [
18]. In contrast to our observation of CD133
lo cells as the Rb CSC subset, Hu et al. using the principle of generating stem-like cancer cells by serum-free culture in WERI-Rb cell line, documented higher percentage of CD133
hi cells within the clones when compared to cultured WERI-Rb cells [
15]. Based on the evidence of varying expression of CD133 expression in different stages of embryonic stem cell development and its differentiation into neural lineage [
32], it is logical to speculate that there could be a range of expression within tumors of different lineages. Similarly, it could also be affected by modifications induced in primary tumors and the culture conditions of cell lines, which needs to be explored further. This interesting and contrasting expression possibly reflects the evolving concept that the CSC properties of tumor cells enhance or decrease in a gradual fashion and is possibly tissue specific. The surface markers CD90 and CXCR4 are within the range reported by our earlier study in patient samples and correspond to 79.7 ± 1.3% and 14.4 ± 0.5% respectively. This study confirms the presence of CSCs in Y79 cell line comparable to the surface markers observed in the primary tumors [
18], however with one major difference which is the absence of CD44 expression in all cells. Lack of expression of CD44 (Hyaluronic acid receptor) could possibly be attributed to culture conditions and absence of hyaluronic acid, which is abundantly present in the vitreous fluid [
33]. This observation is also supported by Ma et al.
, who showed that long-term serum-free cultures of neurospheres from primary Retinoblastoma showed increased expression of CD44 marker in addition to CD133 when compared to the in vitro differentiated cells [
21]. The evidence from retinal studies and increasing expression of CD133 in long-term cultures of Rb supports our observation of CD133 as a marker of differentiation. A thorough comparison of CSC functional properties between the CD133 enriched populations, that was lacking in earlier reports, is highlighted in this study which ascertains the robustness of CD133
lo phenotype as a CSC marker.
Another important characteristic of CSCs appears to be the dormancy of cells and segregation within the G0/G1 phase of the cell cycle indicating that they are inherently slow cycling. It has been reported that CSCs are quiescent/slow cycling in nature unless triggered by selection pressure [
34]. While the bulk of the tumor population remains in a constant balance between the G
1/G
2-S-M phases, CSCs are believed to remain in a G
0/G
1 phase [
35]. This attribute makes the CSCs resistant to conventional therapies that target the rapidly dividing tumor cells. In ovarian cancer, Kusumbe et al. showed that the quiescent fraction of the tumor exhibited stem cell activity and ability to revert to a state of self-renewal and differentiation [
36]. Our study also demonstrated that CD133
lo cells were observed to be in the G
0/G
1 phase implicating that these are the slow cycling and dormant cells.
The ability to form large colonies within a short period is another hallmark of stem-like cancer cells. Using the soft agar colony forming assay, the study documented that the CD133
lo cells were capable of forming larger colonies in soft agar when compared to smaller colonies of the CD133
hi subset in 2 weeks of culture. Siegel et al. has shown the evidence for neurosphere forming ability of Y79 cells in culture for 5 days [
13]. However, clone forming ability of CD133 sorted populations is one of the novel features of this study. The experiments revealed CD133
lo cells formed increased number of large sized colonies as against CD133
hi cells in an anchorage independent colony formation assay. This is in concordance with the defined characteristics of holoclones and paraclones in human epidermal keratinocytes by Barrandon and Green and the more recent study on prostate cancer cell clones by Beaver et al. [
37,
38]. The CD133
lo cells form large clusters of small sized cells with a smooth outline representative of holoclones, whereas CD133
hi cells form much smaller colonies with irregular margins depicting paraclones. CD133
lo colonies exhibited larger colony area than the CD133
hi clusters after 2 weeks hinting at their ability to self-renew and proliferate. The CD133
lo population with higher clonogenicity further supports the CSC nature of these cells. The clones could be expanded to passage 5 and showed gradual increase in CD133
hi cells with increasing passages suggesting that these cells are capable of self-renewal as well as differentiation to CD133
hi cells. In support of this observation is a study by Wang et al. whose group reported that glioma cells that were CD133 negative were capable of forming tumors in nude rats and differentiating into CD133 positive cells [
27]. The CSCs generated CD133
hi cells upon multiple passages thereby confirming both self-renewal and differentiation. The results from these functional studies of CD133
lo vs CD133
hi Y79 cells strongly hint that CD133 is a marker of differentiated/mature Rb tumor cells. Validation of this by in vivo tumorigenicity assays would be a valuable study in future.
The invasive potential of these CSCs were evaluated using a matrigel transwell system and the serum starved CD133
lo cells exhibited higher invasiveness (
p < 0.05) when compared to their counterparts. These observations are in agreement with other tumors such as breast cancer, colon cancer, ovarian cancer, etc., in which the CSCs were shown to have increased metastatic potential which concurs with our findings [
39‐
41].
The CD133
lo cells also exhibited chemoresistance towards Carboplatin at higher doses (
p < 0.001), which caused cytotoxicity in the CD133
hi population at the end of 48 h exposure. CSCs have shown to have increased chemoresistance which helps them to overcome the therapeutic killing by being able to efflux drugs and resist cell death [
42,
43]. In the CD133
lo population, it was noted that these cells were not only capable of resisting cell death but also exhibited high proliferation in presence of Carboplatin at the end of a 48 h exposure. On the contrary, CD133
hi cells showed a profile similar to the total Y79 population with decreasing viability upon exposure to increasing drug concentrations. It is possible to extrapolate that this could be one of the reasons why in some of the cases of Retinoblastoma, the enucleated eyeballs from patients who have received chemotherapy, showed evidence of viable tumor cells with mitotic activity [
44].
Gene expression studies in Y79 cell line revealed several pathways deregulated in the putative CSCs with significant up-regulation of stem cell genes and genes involved in proliferation, chemoresistance and metastasis when compared to the non-CSC population. In support of the evidence in primary tumor cells [
18], where CD44
hiCD133
lo cells exhibited the progenitor cell markers, the CD133
lo cells showed similar marker profile except for CD44 expression. Microarray data also shows that there was significant higher expression of embryonic and neural stem cell markers in the stem-like cancer cells of Y79 cell line. Stem and progenitor cell genes such as
OCT4,
NANOG,
BMI1,
ABCG2 and
PROX1 were highly expressed in CD133
lo population. This is in concordance with the gene expression findings by few groups on total and ABCG2 enriched Rb Y79 cells, and WERI-Rb cells [
13,
15,
16]. This study also identified an important regulator of metastasis, Metastasis-associated in colon cancer 1 (
MACC1) gene to be expressed in Y79 cell line. To the best of our knowledge, this is the first report of
MACC1 overexpression in Retinoblastoma and specifically within the CD133
lo subset of Y79 cell line. This gene has been recently identified as an important factor in tumor cell proliferation, invasion and metastasis in several cancers such as Colon, HCC, Breast, Ovarian, etc. via the c-MET/HGF signalling pathway and is being evaluated as a potential therapeutic target [
45,
46].
This study also has its set of limitations, the foremost being lack of a positive co-marker for CSCs. Even though the functional studies validate the CD133lo Y79 cells being endowed with CSC properties, which are in tune with the findings in primary tumors; positive co-markers would add more strength to the data. The multidrug resistance markers that were identified in the microarray study (ABCB1, ABCB5) could be used for co-localization studies in future. Though quiescence is one of the hallmarks of CSCs, documentation of the same is a challenge. Cell cycle analysis does not segregate the G0/G1 phases or the different population of cells within the G0 phase of cell cycle, which could also contain differentiated, senescent and stem cells. The study partly addressed it using surface phenotype and clone forming ability, however, segregating the different populations in G0/G1 phase would add value to the study. The CFE measurement was performed for the colonies formed at a 2-week period. Longer incubation period and characterization of the primary clones could further ascertain the clone forming ability and stem cell phenotype. However, the cumulative evidence of all the investigations point towards the CD133lo cells being endowed with CSC properties in Rb Y79 cell line which is a novel finding of this study. We believe that similar CSC characterization studies on other Rb cell lines and primary cells would add more strength to the hypothesis.