MiR-384 inhibits the proliferation of colorectal cancer by targeting AKT3

The fresh CRC and the matched normal colorectal tissues were collected from the Department of Pathology, Third Affiliated Hospital of Xinxiang Medical University (Xinxiang, China) from September 2016 to December 2017. All patients did not receive chemotherapy, radiotherapy or immunotherapy prior to surgery. All tissues were freshly frozen in liquid nitrogen until further use. All the cases had been diagnosed with adenocarcinoma on the basis of hematoxylin–eosin (HE) staining. The prior approval for the study had been obtained from Xinxiang Medical University Institutional Board (Xinxiang, China).

The stable cells of SW480/miR-384, SW480/Vector, HCT116/miR-384, HCT116/Vector, and LOVO/miR-384-in, LOVO/NC, SW620/miR-384-in, SW620/NC established in our previous study were cultured in RPMI-1640 or DMEM (Invitrogen). The cells of SW480, HCT116, LOVO and SW620 were obtained from American Type Culture Collection (ATCC). The medium was supplemented with 10% fetal bovine serum(FBS, Gibco) and 1% penicillin/streptomycin (Invitrogen).

Following the manufacturer’s instruction, the total RNA was extracted from the cultured cells and fresh CRC tissues with Trizol (Invitrogen, USA). 2 μg of total RNA synthesized the cDNA. Quantification of miR-384 was conducted by the All-in-One TM miRNA real-time PCR Detection Kit (GeneCopoeia, China) via the Applied Biosystems 7500 Sequence Detection system mixed with 5 ng cDNA and 10 pM of each primer. The cycling conditions were conducted as previously described [16]. As for the target gene of AKT3, the primers were shown in Additional file 1: Table S1. The data were normalized to U6 or GAPDH and calculated as 2^−ΔΔCT.

Protein lysates obtained from the cells were subjected to SDS-PAGE and then the gel was transferred to Polyvinylidene difluoride (PVDF, Merck Millipore). The PVDF membranes were blocked with 5% non-fat dry milk and then the membranes were incubated with rabbit anti-AKT3 (1:200, Proteintech, USA) or mouse anti-α-tubulin (1:2000, Proteintech, USA) overnight at 4 °C. The next day, they were incubated with the appropriate secondary antibodies (HRP-conjugated anti-rabbit IgG (1:5000, CST, USA) or HRP-conjugated anti-mouse IgG (1:5000, CST,USA) and detected with a chemiluminescence imaging analysis system (Tanon, China).

1 × 10³ cells were seeded on 96-well plates and cultured for 24 h. 20 μl 5 g/l 3-(4,5-dimethylthiazol-z-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma, USA) was added to each well and incubated for 4 h. Then, MTT was removed and 150 μl dimethyl sulphoxide (DMSO; Sigma, USA) was added to the wells. The absorbance was measured at 450 nm with a microplate autoreader (Bio-Rad, Hercules, CA, USA). The experiment was conducted repeatedly for three times.

The cells were trypsinized and plated on 6-well plates (200 cells/well) and cultured for 2 weeks. The colonies were stained with Hematoxylin for 30 min after fixation with 4% paraformaldehyde for 10 min. The number of colonies, defined as > 50 cells/colony, was counted. Three independent experiments were performed.

Six-well plates were covered with a layer of 0.6% agar (Sigma, USA) in medium supplemented with 20% fetal bovine serum. Cells were prepared in 0.3% agar and seeded in triplicate at 3 a dilution of 1 × 10³. The plates were incubated at 37 °C in a humid atmosphere of 5% CO₂ for 2 weeks. Each experiment was repeated at least 3 times. Colonies were photographed after 2 weeks at an original magnification of 200×.

4 to 6-week-old BABL/c nude mice were purchased from the Center of Laboratory Animal Science of Guangdong (Guangzhou, China). All animal experiments were conducted in accordance with current Chinese regulations and standards regarding the use of laboratory animals, and all animal procedures were approved by the Xinxiang Medical University Institutional Animal Care and Use Committee. Xenograft tumors were generated by subcutaneous injection of 2 × 10⁶ stable cells of SW480/Vector, SW480/miR-384, LOVO/NC, and LOVO/miR-384-in (n = 6) on the hindlimbs. Another 6 nude mice were used to conduct the restoration experiments in vivo. 3 weeks later, all mice were euthanized by dislocating the cervical spine. Tumor size was measured by a slide caliper (volume = length × width × height). The tumors were fixed with 10% neutral buffered formalin and embedded in paraffin. Then 4 μm sections were cut and stained with haematoxylin and eosin according to standard protocols. Sections further underwent immunohistochemistry (IHC) staining: They were sections baked at 60 °C for 1 h, deparaffinized with xylenes and rehydrated with graded ethanol. After incubation in 3% H₂O₂ to quench the endogenous peroxidase activity, the sections were heated in 0.01 M, sodium citrate buffer, pH6.0, for antigenic retrieval. Later, the sections were blocked with normal non-immume serum for 20 min and then incubated by mouse anti-Ki-67(Maixin, China) overnight at 4 °C. The next day, the sections were treated with secondary antibody followed by streptavidin–horseradish peroxidase complex. Finally, DAB was used for colour development. PBS was used to replace the primary antibody as the negative control. Finally, the stained slides were evaluated independently by two pathologists who were blind to the clinical parameters. The positive tumor cells were stained for Ki-67 protein in the nucleus.

The miR-384 binding site in the AKT3 is located at 4362–4367 bp, whose full length of 3′UTR is 5439 bp. The region of human AKT3 3′UTR at 4141–4510 was PCR-amplified and inverted into the XhoI/NotI sites of the psiCHECK-2 luciferase reporter plasmid (Promega). The primers were as follows: F: CCGCTCGAGATACACGCAAATACACTCC; R: GGGGCGGCCGCCTTCTACAGTATCCACCAC. Cells were seeded in 24-well plates (1 × 10⁵/well) the day before transfection. Then the psiCHECK-2-luciferase reporter gene plasmids psiCHECK-2-AKT3-3′-UTR or control-luciferase plasmid were transfected into the cells with the control pRL-TK Renilla plasmid (Promega) by Lipofectamine 2000 Reagent (Invitrogen). Luciferase and Renilla activities were assayed 48 h after transfection by the Dual Luciferase Reporter Assay Kit (Promega) following the manufacturer’s instructions. All experiments were conducted at least 3 times and the data were presented as mean ± standard deviation (mean ± SD).

All statistical analyses were carried out by SPSS20.0 for Windows. The data were expressed as the means ± standard deviations (SD) from at least three independent experiments. The comparisons of the means were carried out by one-way analysis of variance (ANOVA) test with post hoc contrasts by LSD test. Comparisons were considered significant when p < 0.05. The comparison was conducted by Mann–Whitney U-test. Spearman’s correlation analysis was carried out to analyze the relationship between miR-384 expression and AKT3 expression. Statistically significant data were indicated by asterisks: *p < 0.05 or **p < 0.01.

The expression of miR-384 was detected by qPCR analysis in 26 cases of CRC biopsies and their matched normal samples obtained from the Third affiliated Hospital. It was found that miR-384 was down-regulated in 88.5% (23/26) of CRC tissue samples (T) compared to their matched adjacent normal tissues (N) (Fig. 1a). Student’s t test showed that the expression level of miR-384 in CRC tissues samples was significantly lower than that in adjacent normal tissues (Fig. 1b, c). Taken together, these results showed that miR-384 was down-regulated in CRC tissues.

To explore the possible role of miR-384 on the proliferation of CRC, MTT, soft agar and colony formation assay were performed with the stable cells of SW480/miR-384, SW480/Vector, HCT116/miR-384 and HCT116/Vector (Fig. 2a). The results showed that the over-expression of miR-384 obviously decreased the OD value of MTT, the colony number of soft agar and colony formation assay of SW480 and HCT116 (Fig. 2b–g). So, miR-384 overexpression significantly inhibited the proliferation of CRC cells in vitro. To further confirm the effect of miR-384 in inhibiting the proliferation of CRC cells in vivo, we performed the tumorigenesis assay in nude mice and found that the volume of tumors in SW480/miR-384 group was much smaller than that in SW480/Vector group (Fig. 2h). IHC confirmed that the tumors of the SW480/miR-384 group showed much lower Ki-67 indices than that in control group (Fig. 2i, j).

The proliferative abilities of the stable cells LOVO/miR-384-in, LOVO/NC, SW620/miR-384-in and SW620/NC were detected by MTT, soft agar and colony formation assay (Fig. 3a). The results demonstrated that the suppression of miR-384 obviously increased the OD value of MTT, the colony number of soft agar and colony formation assay of LOVO and SW620 cells compared with their negative control group (Fig. 3b–g). Therefore, miR-384 knock-down significantly increased the proliferative abilities of CRC cells in vitro. To further observe the inhibition effects of miR-384 on CRC proliferation in vivo, LOVO/miR-384-in cells and the control cells LOVO/NC were injected to the hind limbs of the nude mice. Results demonstrated that LOVO/miR-384-in group showed much lager tumors and much higher Ki-67 indices than that in LOVO/NC group (Fig. 3h–j).

The publicly available bioinformatic algorithms (TargetScan, miRada) were firstly used to analyze the target gene of miR-384. The results indicated that AKT3 was the theoretical target gens of miR-384 (Fig. 3a). Real-time PCR and western blot analyses showed that the mRNA and protein levels of AKT3 was significantly down-regulated in miR-384 over-expressed cells, whereas they were up-regulated with the inhibition of miR-384 (Fig. 4b, c). To confirm whether AKT3 was directly inhibited by miR-384, the dual-luciferase reporter system was performed. It was found that the co-expression of miR-384 markedly inhibited the Renilla luciferase reporter activity of the wild-type AKT3 3′UTR, but did not change the activity of the mutant 3′UTR constructs and their scramble vectors (Fig. 4d). The above results verified that AKT3 was the target gene of miR-384.

To further confirm the role of miR-384 in the progression of CRC, we next restored the expression of AKT3 in SW480/miR-384 cells (Fig. 5c) by transfection of AKT3 ORF constructs without 3′UTRs, and observed their effects on proliferation. The results showed that the proliferative abilities of SW480/miR-384 cells increased with the restoration of AKT3 both in vitro (Fig. 5d–f). The in vivo tumorgenesis assay in nude mice showed the same trend (Additional file 1: Figure S1A, B). The above results confirmed that miR-384 inhibit the proliferation of CRC by targeting AKT3.

We detected the expression of AKT3 in 10 cases of CRC and their paired normal colorectal tissues and the data were normalized to 2 housekeeping genes (GAPDH and β-actin). The standard deviations normalized to GAPDH was lower than that of β-actin (Additional file 1: Figure S2A). Therefore, we used GAPDH for normalization of AKT3 expression analysis to further verify the correlation between the expression of miR-384 and AKT3 was analyzed in another 10 freshly collected CRC biopsies and paired normal tissues. It was showed that miR-384 was down-regulated in CRC tissues while AKT3 was up-regulated in CRC tissues (Fig. 6a). Spearman correlation analyses demonstrated that the expression of miR-384 expression was negatively correlated with the expressions of AKT3 (Fig. 6b).