Background
The infectious stages of
Plasmodium parasites, the etiological agents of malaria, are exquisitely designed for cell motility and targeted host cell invasion. Despite traversing several very different tissue environments and invading divergent host cells in the mosquito and vertebrate hosts [
1,
2], each life cycle stage retains a conserved cellular architecture [
3,
4] and mode of actomyosin-based cell movement, called gliding motility. The mechanics of gliding is intimately linked to the cellular architecture of the apicomplexan cell, the phylum to which malaria parasites belong [
4]. The pellicular region underlying the plasma membrane houses much of the machinery associated with motility. Comprised of a series of membrane bound structures, termed the inner membrane complex or IMC, this compartment lies some 20–50 nm under the plasma membrane [
4], the space between housing the gliding motor complex. Current models predict that this structure is composed of a single headed myosin motor, anchored between the IMC and plasma membrane via a series of binding partners [
5]. Motor action then provides the requisite force necessary for motility [
6]. Myosin engages directly with transient, short actin filaments that are themselves linked to the extracellular milieu via the cytoplasmic tails of surface bound adhesins [
7]. Until recently, the linkage between actin filaments and the terminal residues of surface-bound adhesins was thought to involve the glycolytic enzyme fructose 1,6 bisphosphate aldolase [
7], which is known to bind actin [
8]. According to this model, directional passage of the actin-aldolase-adhesin complex rearwards by the myosin motor would then generate rearward force driving the parasite forwards.
Whilst the current model for gliding is appealing it does not explain how directional motility is generated. To date, efforts to visualize motor organization or actin in the pellicle of the parasite have not been successful [
9,
10]. Recent evidence from the apicomplexan parasite
Toxoplasma gondii, a distant relative of
Plasmodium parasites, has also brought into question not only the role of aldolase, beyond its metabolic contribution [
11], but also the essential contribution of each motor complex component to motility in general [
12]. Thus, the question of how directional force generation and subsequent directional gliding is achieved remains entirely unresolved.
Drugs that perturb microfilament turnover demonstrate the importance of dynamic actin to gliding motility [
13,
14]. Since actin forms a polar filament, proteins that interact in an orientated fashion constitute attractive candidates that might impact significantly on directional motility. Computational analysis of available apicomplexan genomes has revealed a remarkable reduction in the repertoire of identifiable actin regulators and actin-binding proteins in this phylum [
15‐
17]. The minimal set in
Plasmodium parasites includes two formins [
18], a single profilin [
19], two actin depolymerizing factors (ADF) [
20,
21], a homologue of the yeast-actin regulator srv2 or CAP protein [
22,
23], capping subunits alpha and beta [
24] and coronin [
25]. Among this minimal repertoire of core actin regulators only coronin appears to fulfil the role of a specific filament binding protein. Coronins are a family of proteins implicated in several roles involving actin dynamics across eukaryotic systems including filament binding and bundling [
26‐
28]. Based on sequence comparison coronins have been divided into three groups, Types I-III [
26]. Type I coronins are defined by a three-part structure consisting of an N terminal seven bladed beta-propeller motif composed of WD40 repeats [
29], a ‘‘unique’’ middle region that varies in sequence and length between variants and species, and a C-terminal coiled-coil (CC) domain that mediates homo-oligomerization [
30] and interactions with the Arp2/3 complex [
31], a key nucleation complex entirely absent in malaria parasites. Apicomplexan coronins are predicted to resemble Type I coronins, with recent structural analysis of
T. gondii coronin (TgCoronin) revealing a conserved N-terminal beta propeller motif and mostly conserved actin-binding residues, as well as a potential dimerization motif in the C-terminal CC domain [
32].
Here the biochemical interactions of the Plasmodium falciparum coronin-like protein (PfCoronin) and actin were addressed towards dissecting its role in organizing directional actin-based motility in Plasmodium parasites. Using genetic, cellular, biochemical and single molecule approaches, we show that PfCoronin is a true actin-filament binding protein able, in vitro, to direct filamentous (F)-actin into parallel bundles. PfCoronin peak expression is centred in late schizogony, where the protein localizes to the merozoite pellicle throughout invasion consistent with a role in motility. PfCoronin interacts with membrane fractions of the parasite cell, likely binding via phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2). Given its potential for organizing actin filaments in situ at the parasite periphery into parallel bundles, a model in which coronin is a key determinant of directional gliding motility in apicomplexan parasites can be proposed.
Methods
Cloning, protein expression and purification
PfCoronin: The full-length gene encoding 6×His-PfCoroninFL was codon optimized for expression in Sf21 cells (GeneArt). The synthetic gene was cloned into the pFastBacHTB vector using BamHI/XhoI restriction sites. Bacmid DNA was produced according to the Bac-to-Bac manual (Invitrogen) using MultiBac cells. Bacmid DNA was transfected into Sf21 cells using Cellfectin II (Invitrogen) according to the manufacturers instructions. Viral stocks were amplified and used at a 1:1,000 dilution for protein expression. Following addition of virus, Sf21 cells were incubated in suspension at 27°C and harvested by centrifugation after 72 h. Cells were re-suspended in lysis buffer (50 mM Tris pH 8.0, 300 mM NaCl, 10 mM MgCl2, 5 mM 2-mercaptoethanol, 0.5% Triton X-100) supplemented with cOmplete EDTA-free protease inhibitors (Roche) and subjected to two rounds of freeze–thaw in liquid N2. The lysate was incubated with 1 mg/mL DNAseI for 30 min rocking at 4°C, followed by centrifugation at 30,000g for 30 min. The soluble fraction was recovered, adjusted to 10 mM imidazole pH 8.0 and incubated with Profinity™ IMAC resin for 2 h at 4°C. The resin was washed sequentially with buffer 1 (50 mM Tris pH 8.0, 300 mM NaCl, 5 mM 2-mercaptoethanol, 20 mM Imidazole), buffer 2 (50 mM Tris pH 8.0, 1 M NaCl, 5 mM 2-mercaptoethanol) and buffer 1. Protein was eluted in elution buffer (50 mM Tris pH 8.0, 300 mM NaCl, 5 mM 2-mercaptoethanol, 250 mM Imidazole) and analysed by SDS PAGE. Fractions containing His-PfCoronin were pooled and cleaved overnight with TEV protease during dialysis against buffer 3 (50 mM Tris pH 8.0, 300 mM NaCl, 5 mM 2-mercaptoethanol) to remove the 6×His tag. The dialyzed protein was incubated with Profinity™ IMAC resin for 2 h to bind un-cleaved protein. The cleaved protein was collected and the resin washed with buffer 3 until no more protein came off as monitored by Bradford reagent (BioRad). The cleaved sample and washes were pooled and concentrated to 0.5 mL. The protein was subjected to size exclusion chromatography on a Superdex 200 10/300 GL column (GE Healthcare) pre equilibrated in 30 mM Tris pH 8.0, 300 mM NaCl, 5 mM 2-mercaptoethanol. Full length PfCoronin eluted at ~12 mL. The N-terminal breakdown product PfCoronin 1-388 (called herein PfCor-N), eluted at ~16 mL. Peak fractions were analysed by Coomassie-stained SDS PAGE to assess protein purity. Fractions containing PfCor-N were pooled, concentrated and stored at 4°C.
PfAldolase The gene for PfAldolase was amplified from
P. falciparum genomic DNA using the primers PfAldoF 5′GATCGGATCCATGGCTCATTGCACTGAATATATG and PfAldoR 5′GATCCTCGAGTTAATAGACATATTTCTTTTC, and ligated into the pProEX-HTb vector (Invitrogen) via BamHI/XhoI restriction sites, introducing an N-terminal 6×His tag. The plasmid was transformed into BL21 (DE3)
Escherichia coli cells and the protein expressed for 4 h at 37
°C after addition of 1 mM IPTG. The cells were harvested, re-suspended in lysis buffer (20 mM Tris pH 8.0, 300 mM NaCl, 0.3% Triton X-100, 5 mM 2-mercaptoethanol) supplemented with cOmplete EDTA-free protease inhibitors. The suspension was sonicated and clarified by centrifugation at 30,000
g for 30 min at 4
°C. The supernatant was collected, adjusted to 10 mM imidazole pH 8.0 and incubated for 2 h at 4
°C with Profinity ™ IMAC resin. The resin was washed sequentially with Wash Buffer 1 (50 mM Tris pH 8.0, 300 mM NaCl, 20 mM imidazole pH 8.0, 5 mM 2-mercaptoethanol), Wash buffer 2 (50 mM Tris pH 8.0, 1 M NaCl, 5 mM 2-mercaptoethanol) and Wash Buffer 3 (50 mM Tris pH 8.0, 300 mM NaCl, 5 mM 2-mercaptoethanol). His-PfAldolase was eluted with elution buffer (Wash Buffer 3 + 250 mM imidazole pH 8.0) and assessed for purity and quantity by SDS PAGE. Elution fractions containing His-PfAldolase were pooled and dialysed against Buffer A (50 mM MES pH 7.0, 100 mM NaCl, 2 mM DTT, 1 mM EDTA) for 2 h, then subjected to cation exchange chromatography using HiTrap SPFF (GE Healthcare). A gradient from buffer A to buffer B (50 mM MES pH 7.0, 1 M NaCl, 2 mM DTT, 1 mM EDTA) was used to elute the protein. Peak fractions containing His-PfAldolase, as determined by Coomassie-stained SDS PAGE, were pooled, concentrated and subjected to size exclusion chromatography using a Superdex 200 10/300 gel filtration column (GE Healthcare) pre-equilibrated in Buffer A. His-PfAldolase eluted off the column as a single peak at ~13 mL, corresponding to a molecular weight of ~160 kDa which approximates the size of a tetramer. Peak fractions were pooled, concentrated to 100 uM, aliquoted, flash frozen in liquid N
2 and stored at −80
°C. Actin was purified from rabbit skeletal muscle acetone powder (Sigma-Aldrich) using established protocols [
33].
Sedimentation assays
High speed 2 μM RSMA in CaBG was adjusted by the addition of 10× Mg-EGTA exchange buffer (ME) (10 mM MgCl2, 2 mM EGTA) to make Mg bound RSMA (Mg-ATP-Actin). Mg-ATP-Actin was polymerized by the addition of 10× KMEI (0.5 M KCl, 0.1 M imidazole pH 7.0, 0.01 EGTA pH 8.0, 0.01 M MgCl2) and incubation for 2 h at room temperature. Proteins of interest [PfCor-N, PfAldolase and alpha-Actinin (Cytoskeleton Inc.)] were added to the appropriate concentration and the mixture incubated for a further 30 min at room temperature. The samples were centrifuged at 60,000 rpm in a Beckman preparative ultracentrifuge for 1 h at room temperature. The supernatant was carefully removed and adjusted with 5× RSB. The pellet was rinsed with MgBG (2 mM Tris pH 8.0, 0.2 mM ATP, 0.5 mM DTT, 0.1 mM MgCl2) and centrifuged at 60,000 rpm in a Beckman preparative ultracentrifuge for 1 h at room temperature. The supernatant was carefully removed and discarded, and the pellet re-suspended in 2× RSB to a volume equivalent to the first supernatant after addition of RSB. The supernatant and pellet samples were boiled for 5 min and equal volumes were separated by SDS PAGE, the gels stained with Coomassie brilliant blue (BioRad) and the bands analysed by densitometry.
Low speed Low-speed sedimentation assays were performed as per high-speed sedimentation assays with the following alterations. Mg-ATP-Actin was polymerized in the presence of the proteins of interest for 2 h at room temperature. Samples were centrifuged at 13,000 rpm in a standard benchtop centrifuge at 4°C. Supernatants were carefully collected and the pellet discarded. Supernatants were adjusted with 5× RSB, boiled for 5 min and separated by SDS PAGE. The gels were stained with Coomassie brilliant blue and the bands analysed by densitometry.
Kd determination Pre-polymerized Mg-ATP-Actin, prepared as per the high-speed sedimentation assay protocol, was incubated with the protein of interest for 30 min then centrifuged at 60,000 rpm for 1 h at 22°C. The supernatants were collected, and adjusted with 5× RSB. The pellets were rinsed with 1× KMEI and centrifuged as per the high-speed sedimentation assay protocol. The pellets were re-suspended in 2× RSB to the equivalent volume of the supernatant samples. Equal volumes were separated by SDS PAGE and the gels stained with Coomassie brilliant blue. For assays involving proteins too close in size to resolve by standard Coomassie staining, following SDS PAGE the proteins were subjected to Western blot analysis. Band densities were analysed by densitometry and
Kds determined according to the methods outlined in [
34,
35].
Electron microscopy
Appropriate amounts of purified PfCor-N or PfAldolase were added to 2 μM preformed Mg-ATP-Actin filaments for 30 min at room temperature. The samples were adsorbed onto Formvar-carbon films supported on 200-mesh copper grids. Grids were glow discharged before sample application, then negatively stained with aqueous uranyl acetate (1%). Samples were observed with an FEI Tecnai F30 microscope at 300 kV.
Fluorescence microscopy
Mg-ATP-Actin was polymerized by the addition of 2× TIRF buffer alone or in the presence of proteins of interest and incubated in a covered tube at room temperature for 1 h. The samples were incubated with 1 μM Alexa Fluor
® 488 Phalloidin (Life Technologies) for 5 min at room temperature. 3 μL of the samples were adsorbed onto coverslips coated with 0.05 μg/μL poly-
l-Lysine (Sigma-Aldrich). Fluorescence images were acquired using a Zeiss inverted LSM-510 confocal microscope and processed using ICY image analysis software [
36].
TIRF microscopy
Oregon Green (OG) labelled RSMA was prepared as previously described [
37]. 1.5 μM Mg-ATP-Actin (33% OG labeled) alone and in the presence of proteins of interest (Pf-Cor or Fimbrin, a kind gift from Colleen T. Skau) was prepared for TIRF microscopy by the addition of 2× TIRF buffer (10 mM imidazole pH 7.0, 50 mM KCl, 5 mM MgCl
2, 1 mM EGTA, 0.5 mM DTT, 0.2 mM ATP, 50 μM CaCl2, 15 mM glucose, 20 μg/mL catalase, 100 μg/mL glucose oxidase, 0.5% methylcellulose 400 cP) to stimulate polymerization. The samples were immediately loaded into a pre-made flow chamber and excited by evanescent wave fluorescence on an IX-71 Olympus microscope fit with through the objective TIRF illumination. Images were acquired every 15 s for 10–20 min by an iXon EMCCD camera (Andor Technology) as previously described [
38]. Movies were processed and analysed using ImageJ.
Plasmodium falciparum culture and maintenance
The 3D7
P. falciparum isolate was cultured as previously described [
39]. Parasites were maintained in O
+ erythrocytes (Australian Red Cross Blood Bank, South Melbourne, Australia) at approximately 4% haematocrit, in a culture medium of RPMI-HEPES supplemented with 0.18% (w/v) NaHCO3 and 10% (v/v) pooled human serum from unexposed Melbourne blood donors or 0.5% (w/v) AlbumaxII (Gibco). Cultures were incubated at 37°C under a 94% N
2, 1% O
2, 5% CO
2 gas environment. Transfected lines were maintained in the presence of appropriate drugs to select for the corresponding resistance marker included in the transfection vectors.
Reverse transcriptase PCR (RT-PCR)
RT-PCR was performed as described [
40]. Briefly, total RNA was extracted from synchronized 3D7 parasites at appropriate time points post-invasion using TRIzol
® (Invitrogen), residual genomic DNA was removed using an RNAeasy
® column (Qiagen), and 5 μg of total RNA was reverse transcribed with or without SuperScript ™ II reverse transcriptase using random hexamers (Invitrogen), all according to the manufacturers instructions. The following primers were used: Cor_RT_fwd (5′-CCTTTAATCAAGAATTTATA-TCC-3′) and Cor_RT_rev (5′-CCTCATTCACATTCTCATCCTC-3′); ACT1_RT_fwd (5′-CCAAAGAATCCAGGAATTATGG-3′) and ACT1_RT_rev (5′-GGAACAGTGTGTGATA-CACCATC-3′).
Vector construction and tagging
Endogenous tagging of PfCoronin (PF3D7_1251200) at the C-terminus was performed as described using the pD3HA vector with parasite transfection following standard protocols [
41].
Antisera and immunoprecipitation
Antisera was raised in rabbits against PfCor-N, expressed and purified from BL21 (DE3)
E. coli using standard methods. Immunoprecipitation was performed as previously described [
40]. Briefly, 40–48 h 3D7 PfCoroninHA schizonts were subjected to protein extraction using 1% TNET (1% Triton X-100, 50 mM Tris pH 7.4, 150 mM NaCl, 5 mM EDTA) supplemented with cOmplete EDTA-free protease inhibitor cocktail (Roche). Pull downs were performed using anti-PfCoronin or anti-HA coupled to protein G-Sepharose (Amersham Biosciences) according to the manufacturers instructions. Proteins were separated by SDS PAGE and subjected to western blot analysis. The blots were probed with rat anti-HA [1:1,000] or rabbit anti-PfCoronin [1:1,000] and processed as previously described.
Immunofluorescence assays
Parasites were synchronized according to established methods to obtain late schizonts or merozoites for re-invasion using either sorbitol or heparin treatment [
42,
43]. Schizonts or invading parasites were fixed in a fixing solution of 4% paraformaldehyde (ProSciTech)/0.0075% gluteraldehyde (ProSciTech) in phosphate buffered saline (PBS) while rocking at room temperature for 30 min. Cells were permeabilized using 0.1% Triton X-100 (BioRad) for 10 min at room temperature and blocked overnight using Blocking Solution [3% (w/v) Bovine Serum Albumin (BSA) (Sigma-Aldrich) in PBS], while rocking at 4°C. Cells were incubated with appropriate primary antibodies diluted in Blocking Solution for 1 h at 4°C. Primary antibodies used were rat anti-HA [1:1,000] (Roche), rabbit anti-PfGAP45 [1:500] [
40], rabbit anti-Act 239-253 [1:300] [
10], mouse anti-PfRON4 [1:500] [
44]. Samples were washed twice in PBS and incubated for 1 h at 4°C with appropriate secondary antibodies: Alexa Fluor
® 488 or 594 goat anti-mouse, Alexa Fluor
® 488 or 594 goat anti-rabbit and Alexa Fluor
® 594 goat anti-rat (Invitrogen) [1:500] in Blocking Solution. Samples were washed three times in PBS and cells were settled onto coverslips (type 1.5, Zeiss) coated with 1% polyethyleneimine (PEI) (Sigma-Aldrich). Cells were mounted with VectaShield
® (Vector Laboratories) with 0.1 ng/μL 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Fluorescence images were acquired using Plan-Apochromat 100×/1.40 oil immersion Phase contrast lens (Zeiss) on an AxioVert 200 M microscope (Zeiss) equipped with an AxioCam Mrm camera (Zeiss). Deconvolution of image stacks was undertaken using Axiovision release 4.7 or 4.8 software. Routine image manipulation was performed using FIJI and Adobe Photoshop.
Solubility profile analysis
For solubility analysis of PfCoronin purified 3D7 P. falciparum merozoites were hypotonically lysed by re-suspending the merozoites in water supplemented with complete EDTA-free protease inhibitor cocktail (Roche). The samples were snap frozen in liquid N2 and incubated on ice for 10 min to thaw, releasing the cell contents. Water soluble and insoluble proteins were separated by ultracentrifugation at 1,00,000g for 30 min at 4°C (TLA100.2 rotor, Beckman Optima TL Ultracentrifuge, Beckman Coulter). Water insoluble fractions were further treated with Na2CO3 pH 11.5 for 1 h at 4°C. Carbonate soluble and insoluble fractions were isolated by ultracentrifugation as described. Samples were adjusted with 4 x reducing sample buffer (RSB) and subject to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) followed by Western blot analysis.
Biosensor analysis
The amino analogue of PI(4,5)P2 (NH2-PI(4,5)P2 was synthesized with an ω-amino group on the sn-1 position of a saturated lipid side chain as described previously [
45]. NH2-PI(4,5)P2 was then conjugated with Sulfo-NHS-biotin (Thermo Scientific) to enable immobilization onto the NeutrAvidin derivatized sensor surface according to a previously described protocol [
46]. Experiments were performed using a Biacore 3000 biosensor (Biacore Life Sciences, GE Healthcare). Various concentrations of PfCor-N (2.6 μM, 1.3 μM, 650 nM, 325 nM, 162.5 nM and 81.2 nM) and PfADF1 (3.8 μM, 1.9 μM, 950 nM, 475 nM, 237.5 nM, and 188.8 nM) were injected over PI(4.5)P2, immobilized onto a CM5 sensor surface derivatized with NeutrAvidin using NHS/EDC chemistry (140RU immobilized) (Catimel 2013). A NeutrAvidin channel was used as the control. The reactivity of immobilized PI(4,5)P2 was assessed by injecting various concentrations of the GST-tagged Pleckstrin Homology domain of Phospholipase C, gamma 1 (GST-PLCδ-PH) (350, 175, 87.5, 43.8, 21.9 and 11 nM) [
46].
Kinetic constants were derived from the resulting sensorgrams with BIAevaluation 4.1 software (Biacore Life Sciences, GE Healthcare) using Global analysis using a 1:1 Langmuir model that includes terms for mass transfer of analyte to the surface.
Discussion
Apicomplexan gliding and host cell invasion are known to be reliant on a conserved actomyosin motor that generates the force necessary for directional motility. This motor requires dynamic actin filaments, anchored in the parasite pellicular space, to provide a track along which myosin can engage and drive forward cell motion. The actin filaments at the core of the motor are short, unstable and highly dynamic with unusual kinetics [
67‐
73]. Furthermore, they show no evidence of forming any ordered actin structure within the parasite cell [
9,
10]. Indeed, current evidence suggests that the majority of actin in cells is monomeric, with only ~2% predicted to be incorporated into filaments [
74]. Indeed, their highly dynamic nature is essential for functional motility, as treatment of parasites with actin inhibitors impedes host cell invasion and gliding motility [
13,
14,
75,
76]. Given such dynamics there is still a major gap in current understanding as to how directional motility, specifically the provision of oriented actin microfilament tracks for myosin, is achieved.
Until recently, it was believed that part of the process of motor engagement, and potentially a major organizing component, came from anchoring of actin filaments to secreted adhesins via the tetrameric enzyme fructose 1,6 bisphosphate aldolase [
7]. Indeed several adhesins from the thrombospondin related anonymous protein (TRAP) family [
7,
40,
77] and other unrelated proteins [
47,
78] have been independently linked to aldolase. However, recent evidence suggests that whilst the binding may occur readily in vitro (via pull downs) or in the native cell, the interaction in vivo is not a functional requirement for normal motility. Rather it is primarily involved in energy metabolism in the parasite cell [
11]. Thus whilst its role in recruiting energy sources to regions of motor activity may still be critical to motility, it may not play any organizing role in the motor. These observations highlight the clear lack in understanding about the entire organization of the motor complex and how it leads to directional force and movement. Evidence presented here suggests coronin as a first organizing factor that links F-actin with the parasite plasma membrane, arranging these into parallel bundles and as such contributing directly to directed gliding motility.
Here, evidence clearly describes the ability of the β-propeller domain of PfCoronin to bundle actin filaments together using bulk biochemical assays and multiple microscopic techniques. The filament-bundling capacity is somewhat surprising, as previous reports of bundling by other coronins required homo-oligomerization mediated by the C-terminal CC domain to bring multiple actin filaments together into a bundle [
30,
32,
53,
79]. However, recent mutational studies have identified multiple binding sites for F-actin on coronin [
48,
49], which form a ridge that spans the length of the β-propeller domain [
49]. It has been postulated that these multiple binding sites could be interacting with two or more actin monomers within the filament [
49,
80], or perhaps, given the results of this study, with two or more monomers from different filaments. Further mutational analysis of the actin binding sites in PfCoronin will be essential to address this phenomenon of F-actin bundling by monomeric coronin.
In vivo, PfCoronin was shown to display a peripheral localization, consistent with the pellicle space (Figure
6e). This data, in combination with a peak of protein expression in maturing and invading merozoites (Figure
6a, b), alludes to a role for PfCoronin in the invasion process. However, the consistent spread of PfCoronin at the parasite periphery during invasion suggests that this role is not limited to linking actin filaments to the plasma membrane at regions of known motor engagement (Figure
7). Indeed, the interaction of PfCor-N with PI(4,5)P
2 in vitro suggests that the linkage between actin and the membrane may be more direct than previously envisaged. Rather than actin linking via exclusive interactions with tetrameric aldolase to the tails of secreted surface adhesins [
7] the entire track for myosin force generation may be bound to the plasma membrane or sub-domains within it. Whilst the caveats of PfCor-N interactions with vertebrate actin need to be verified with a reliable source of correctly folded
Plasmodium actin, if validated, the bundling ability of the protein combined with its in vivo distribution would suggest that native PfCoronin may be constantly organizing actin into ordered arrays underlying the plasma membrane, which are temporarily stabilized during motor engagement, permitting any associated adhesin to facilitate the transmission of motor force. Such a scenario would make the apicomplexan actomyosin motor look more muscle-like with an organized face at the IMC side of the pellicular space dedicated to myosin motor organization, and at the plasma membrane arrayed patches of parallel-bundled actin filaments ready for myosin engagement. Further mutational, optical and detergent extraction approaches may provide insights into this organization in support of such a model.
Although PfCoronin may be providing an organizing template for motility, there is still a need to explain how myosin motor force is directed and how actin filament polarity is determined within the context of the pellicular space. A portion of directionality determination may fall to the other actin regulators, such as the formins [
18]. Further work in this area is clearly needed. In addition, the exact contribution of PfCoronin to parasite motility, the effect PfCoronin binding to actin (and importantly native actin) has on the myosin motor and further comprehensive genetic dissection in
P. falciparum, via knockout, conditional knockdown or expression of domain deletions, will be important for understanding the overall regulation of the spatial organization of actin in the parasite pellicle, and consequently the mechanics of host-cell invasion and directional gliding motility.
Authors’ contributions
All authors worked closely together to design and interpret experiments and edit the final manuscript; Experiments were performed by MAO, FA, DSM, DTR, WW, BC, TC. MAO and JB wrote the core paper. All authors read and approved the final manuscript.