Introduction
Nanotechnology is transforming cancer therapy by improving drug delivery, imaging and selective targeting of tumor cells [
1-
3]. In the past, several attempts have been made to formulate nanovesicles from components normally present in cells [
4]. In this direction, SapC-DOPS, a nanovesicle made from saposin C and dioleylphosphatidylserine, is a unique protein-lipid complex that selectively targets and kills human cancer cells
in vitro and
in vivo [
1,
5-
12]
. Saposin C is an 80 kDa heat-stable, protease-resistant protein containing distinct functional domains; that functions as a co-activator of sphingolipid-degrading lysosomal hydrolases (sphingomyelinase and acid β-glucosidase) [
13]. Owing to the presence of a fusogenic domain comprising two amphipathic α − helices containing four Lys residues (K13, K17, K26, and K38), SapC exhibits natural affinity towards negatively charged phospholipids such as phosphatidylserine (PS). This interaction occurs at low pH (pKa of 5.3) and is critical for SapC activation [
13,
14]. We have previously assembled SapC and DOPS into stable nanovesicles and its efficacy and safety profiles have been established in various forms of cancer [
1,
5,
6,
8,
12]. SapC-DOPS is hypothesized to bind to exposed PS on the cancer cell surface and induce apoptosis by increasing intracellular ceramide level leading to subsequent caspase activation [
8]. However, the precise intracellular pathway(s) mediating SapC-DOPS induced apoptotic cancer cell death is still unknown.
Neuroblastoma accounts for 15% of all pediatric cancer mortalities and is the most common extracranial tumor in young adults [
15]. Aggressive chemotherapy and radiation protocols have failed to improve the survival rates significantly in children with high-risk disease [
16]. Efficacy of chemotherapy in neuroblastoma is less than satisfactory due to several factors such as high toxicity, severe morbidity and risk of secondary malignancy [
17]. Moreover, in patients with relapse the long-term survival rates are < 50% emphasizing the need for novel, non-genotoxic targeted therapies. Elevation of intracellular ceramide, a known regulator of mitochondrial function, was noticed during
in vitro treatment of neuroblastoma cell lines with SapC-DOPS [
8]. Ceramide induces apoptosis via the mitochondrial pathway [
18]. Mitochondria play a central role in the induction of apoptosis by acting as both a major amplification step and the principal site of action for pro- and anti-apoptotic members of the Bcl-2 family [
19]. Whereas the anti-apoptotic members (e.g.,Bcl-2 and Bcl-xL) confine apoptogenic proteins within the mitochondrial intermembrane space by promoting pore closure, the pro-apoptotic proteins (e.g., Bax, Bak and Bid) that translocate from the cytosol to mitochondria promote pore opening [
20]. In addition, it is known that these pro-apoptotic molecules promote pore formation independently or in combination with other mitochondrial proteins such as the voltage-dependent anion channel (VDAC) effecting the release of apoptogenic proteins such as Cyto c, Smac/Diablo and apoptosis inducing factor (AIF) from the intermembrane space [
21-
23]. Final commitment to apoptosis is postulated to occur by the following sequence of events: formation of pores or channels in the outer mitochondrial membrane, opening of pores, loss of mitochondrial membrane potential (ΔΨM), apoptogenic protein release from mitochondria and caspase activation [
24]. In this report we evaluate the
in vivo targeting and antitumor capacity of SapC-DOPS in mice bearing neuroblastoma xenografts, and address the molecular mechanisms underlying neuroblastoma cell death after SapC-DOPS exposure. Based on past observations, we test the hypothesis that SapC-DOPS-induced apoptotic cell death is caused by mitochondrial dysfunction, apoptogenic protein release and caspase activation. Cell viability, mitochondrial function and redistribution of apoptotic proteins are assessed
in vitro in the neuroblastoma cell lines SK-N-SH and IMR-32, representative of non-metastatic and metastatic neuroblastoma, respectively. The
in vivo efficacy of SapC-DOPS in suppressing neuroblastoma growth and the insights obtained into its mechanism of action support its potential as a novel therapeutic agent for the treatment of neuroblastoma.
Materials and methods
Reagents and antibodies
The following reagents and antibodies were used: Bongkrekic acid (Santa Cruz Biotechnology, La Jolla, CA), JC-1 (eBioscience, San Diego, CA), Cyclosporine A, 2′,7′-dichlorofluorescein acetate (DCFH-DA), N-acetyl cysteine (Sigma, St.Louis, MO), Dioleylphosphatidylserine (Avanti Lipids, Alabaster, AL), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) ((Roche Diagnostics, Indianapolis, IN), and disuccinyl suberate (Thermo Scientific Fischer, Rockford, IL). Anti-Bcl-2, anti-β-Actin (Abcam, Cambridge, MA), anti-Cyto c (eBioscience, San Diego, CA), anti-AIF, anti-caspase-3, anti-cleaved caspase-3 (Cell Signaling Technology, Boston, MA, anti-Survivin, Smac/Diablo, α-Tubulin (Novus biological, Littleton, CO), anti-COX-4, anti-Bax (N-20; Santa Cruz Biotechnology, La Jolla, CA), anti-Bax (polymer-recognizing A67 clone; Sigma, St.Louis, MO) and anti- cleaved PARP (Millipore, Bedford, MA).
Animal maintenance and experimental procedures were carried out in accordance with the US National Institute of health Guidelines for Use of Experimental Animals and approved by the Institutional Animal Care and Use Committee of the University of Cincinnati and Cincinnati Children's Hospital Medical Center.
Preparation and characterization of SapC-DOPS nanovesicles
The procedures for production of SapC-DOPS nanovesicles have been described in detail before [
1,
6-
9]. Briefly, recombinantly expressed and purified saposin C along with solvent-dried dioleylphosphatidylserine were mixed in acidic citrate-phosphate buffer and freshly assembled into nanovesicles by bath sonication. The lipophilic, infrared dye CellVue Maroon (CVM) was added during SapC-DOPS assembly to fluorescently label the nanovesicles for
in vivo imaging of neuroblastoma human xenografts. The nanovesicles are stable for at least a week, when stored at 4°C. TEM analysis for surface morphology was performed as described earlier [
25].
Mouse xenografts and cell culture
Human neuroblastoma CHLA-20 was a gift from Thomas Inge (Cincinnati Children’s Hospital Medical Center); the origin and culture conditions were previously described [
26]. Athymic nude mice (nu/nu, NIH) (15 mice per group), were injected with 7.5 × 10
6 cells subcutaneously to initiate tumor growth. When tumors reached a volume of 400 mm
3, five doses of either SapC-DOPS (SapC 4 mg/kg body weight, DOPS 2 mg/kg body weight) or PBS (control) were intratumorally administered once every 3 days. Tumor growth was assessed periodically with a caliper, and after 16 days, tumors were excised, weighted, and processed for hematoxylin and eosin staining and apoptosis (TUNEL) assays.
The human neuroblastoma SK-N-SH and IMR-32 cell lines were obtained from American Type Culture Collection and grown in AMEM supplemented with 10% FBS. Human Schwann cells (ScienCell Research Laboratories, Carlsbad, CA) were grown as recommended by the supplier. After overnight attachment, cells were treated with either DOPS or SapC-DOPS for concentration- or time-dependence assays. Where indicated, cells were pretreated for 60 min with bongkrekic acid, cyclosporine A or N-acetyl cysteine.
Cell viability and apoptosis assays
Cell viability was assessed with a standard assay using the tetrazolium dye MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) as previously described [
6] three days after initiating treatment. The following methods were employed to assess SapC-DOPS-induced cell death: G6PD release assay (Life Technologies, Grand Island, NY), was performed according to the manufacturer’s instructions, DAPI staining was performed as described earlier [
27], caspase activation through cleaved caspase-3 and cleaved PARP fragments was evaluated by Western blotting, and cell cycle analysis was performed on a FACS Calibur (Becton Dickinson) in serum-starved, synchronized cells after fixation with 80% ethanol at −20°C for 20 min followed by staining with 100 μg/ml of RNase and 25 μg/ml of PI [
28]. Cell cycle phase was analyzed with the CellQuest-Pro software program (Becton Dickinson).
In vivo apoptosis was measured by TUNEL staining as described earlier [
8].
Evaluation of mitochondrial membrane potential (ΔΨM) and ROS production
Following treatment with SapC-DOPS, cells in triplicate were washed with PBS and evaluated for concentration- and time-dependent changes in ΔΨM by resuspension in fresh JC-1 containing medium, followed by 30 min incubation in the dark at room temperature [
28]. Fluorescence intensity was measured with excitation at 490 nm and the emission monitored at 530 (monomer) and 590 (aggregate) nm, using a BMG microplate reader (BMG Labtech, Inc., Durham, NC). The ratio between green and red fluorescence provides an estimate of ΔΨM that is independent of the mitochondrial mass. For the ROS assay, cells treated with SapC-DOPS were exposed to DCFH-DA for 15 min at 37°C. Fluorescence excitation and emission wavelengths were set at 480 and 530 nm respectively, using a BMG microplate reader (BMG Labtech, Inc., Durham, NC). Mitochondrial superoxide was detected using the fluorescent Mito-Sox probe (Invitrogen). Cells were incubated in Hank’s buffer with 2 μM MitoSox-Red for 30 min at 37°C in a 5% CO
2 atmosphere, washed with PBS and the fluorescence assessed by flow cytometry. Positive control cells were pretreated with 20 μM Antimycin A for 20 min at room temperature. We used the FL1, FL2 and FL3 channels of a FACScalibur flow cytometer (15 mW argon ion laser tuned at 488 nm; CellQuest software, Becton Dickinson Biosciences). Thresholds were adjusted by using non-stained and stained cells for MitoSox-Red fluorescence.
Flow cytometric evaluation of Ca2+ by Fluo-3 AM assay
Intracellular calcium was measured by flow cytometry using the cell permeant, Ca
2+-sensitive fluorescent dye Fluo-3 AM (Life technologies, Carlsbad, CA) [
29]. After treatment with SapC-DOPS for different time points, cells were washed in serum-free Advanced-MEM media, and incubated with Fluo-3 AM for 30 min at 37°C. Later, cells were washed with HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) buffer, trypsinized and centrifuged at 3,500 rpm for 5 min. The pellet was resuspended in HEPES buffer and analyzed using FACS Calibur (Becton Dickinson) with excitation at 488 nm and emission at 525 nm. Approximately 10,000 events were counted.
Western blotting
After treatment with SapC-DOPS, cells were trypsinized and lysed with RIPA buffer (Sigma) containing protease inhibitor (Thermo Pierce) for 30 min on ice. The lysates were centrifuged at 11,300 g for 20 min at 4°C to collect supernatant. Protein concentration was determined by the BCA method (Thermo Fischer Scientific, Rockford, IL). Equal amounts of proteins (30–50 μg) were separated by 4-20% gradient sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membrane (Amersham). After blocking, the membrane was incubated overnight at 4°C with primary antibodies. Following this, blots were probed with the appropriate Li-COR secondary antibodies conjugated with IRDye 800 CW or IRDye 680 LT. Proteins were visualized using an Odyssey IR scanner and quantified using Odyssey software (LI-COR Biosciences, Lincoln, NE).
Mitochondrial and cytosolic fractionation
The mitochondrial and cytoplasmic fractions were separated using the Mitochondrial/Cytosol fractionation kit (BioVision, CA, USA) as per the manufacturer’s instructions. Briefly, whole-cell pellets dissolved in cytosolic fraction extraction buffer were subjected to 55 strokes in a 2 ml Dounce homogenizer on ice. The homogenate was centrifuged at 3,500 rpm for 10 min at 4°C to pellet nuclei and unbroken cells. The supernatant was subsequently centrifuged at 13,000 rpm for 30 min at 4°C to obtain cytosolic supernatant and the mitochondrial pellet. Mitochondrial pellets were resuspended in mitochondrial extraction buffer by gentle vortex for 30 sec.
Bax oligomerization and bax inhibition
Bax oligomerization with cross linking was detected as described previously [
27]. Briefly, cells after treatment with SapC-DOPS cells were washed in conjugating buffer followed by cross linking with 2 mM disuccinyl suberate in non-reducing buffer and incubated for 30 min at room temperature. Reaction was quenched by addition of Tris–HCl (pH 7.5) and incubation at room temperature for 15 min. The samples were then solubilized in lysis buffer containing Nonidet P-40 without a reducing agent and centrifuged at 12,000 x g for 10 min. Bax oligomers were detected using the A67 clone that exclusively detects the polymerized form. Bax inhibition was performed as described earlier [
30]. Briefly, cells were pre-incubated with Bax inhibiting peptide (V5) or negative control peptide (EMD Millipore,Chicago, IL) for one hour, prior to SapC-DOPS treatment.
Lentiviral infection and stable knockdown of Smac/Diablo
Permanent knockdown of Smac was achieved by expression of pre-validated shRNA targeting the sequence CCGACAATATACAAGTTTACT in Smac (shSmac) available as clone ID TRCN04513 in the Sigma-TRC consortium database. DNA oligonucleotides encoding for shSmac were annealed and cloned into pLKO.1 puro. Lentivirus particles carrying shSmac were produced by transfecting 293T cells with pLKO.1-puro-shSmac together with viral packaging vectors (psPAX2, pMD2G) by calcium phosphate transfection at the Cincinnati Children’s Hospital Medical Center viral vector core facility. Three days post infection of SK-N-SH cells with Smac shRNA containing virus, cells were selected in a medium containing puromycin (Life Technologies, Grand Island, NY). Efficiency of the knockdown was checked by Western blot. Cells transfected with the empty vector served as control.
Statistical analysis
Data are represented as the mean ± SE. Statistical analyses were done with the Student’s t test and P < 0.05 was considered significant.
Discussion
This study shows that SapC-DOPS, an antitumor agent formed by the naturally-occurring protein Saposin C and DOPS, targets neuroblastoma cells and inhibits neuroblastoma growth
in vitro and
in vivo. Previous work from our lab has shown that the preferential targeting of SapC-DOPS nanovesicles to cancer cells, while sparing normal ones, is due to higher levels of exposed phosphatidylserine on their outer membranes [
1,
6-
10]. Upon cell binding, SapC-DOPS is internalized and SapC activates lysosomal hydrolases that degrade glucosylceramide and sphingomyelin, resulting in the accumulation of ceramide [
8], a well-known apoptosis inducer [
18]. In the present study we perform a detailed analysis of SapC-DOPS actions in two neuroblastoma cell lines, and reveal that tumor toxicity results from mitochondrial-mediated apoptosis triggered by disrupted ΔΨM, mitochondrial release of Cyto c and Smac, Bax relocation and oligomerization, and activation of Caspase 3. With the efficacy of SapC-DOPS having been confirmed in numerous solid tumor models [
1,
6,
8-
10], the elucidation of SapC-DOPS mode of action is of critical importance to design clinical trials, predict clinical outcomes as well as anticipate and manage potential adverse effects.
Our
in vitro results show that SapC-DOPS exerts dose-dependent cytotoxicity in IMR-32 and SK-N-SH neuroblastoma cells, but have little effect on the viability of normal Schwann cells. Treated neuroblastoma cell cultures showed microscopy features typical of apoptosis, including cell shrinkage and chromatin condensation, while flow cytometric analysis of DNA content showed progressive DNA fragmentation. On the other hand, necrotic cell death was ruled out, as evidenced by a G6PD assay. Next, we addressed the molecular bases of SapC-DOPS induced apoptosis, by first evaluating possible changes in ΔΨM. Mitochondria maintain ΔΨM by controlling ion transport via channels residing in the inner and outer mitochondrial membranes. Loss of ΔΨM is an early requirement of apoptosis [
43] and precedes chromatin condensation [
44]. Upon induction of apoptosis, a series of events induce mitochondrial outer membrane permeabilization (MOMP), altering ΔΨM. Under certain conditions loss of ΔΨM acts as an initiator, whereas in others it follows its onset [
45]. MOMP is mainly controlled by the Bcl-2 family of proteins that either reside on the mitochondrial membrane, or reassemble there after translocation from cytoplasm. Upon oligomerization, they form new channels that release mitochondrial apoptogenic proteins like Cyto c, Smac and AIF. We show here that SapC-DOPS nanovesicles induce, within 6 h, a significant decrease in ΔΨM, which is paralleled by a decrease in mitochondrial Smac and increased cPARP and caspase 3 cleavage, denoting apoptotic cell death. Loss of ΔΨM is critical for SapC-DOPS tumor toxicity, as cell viability was significantly rescued following pre-treatment of cells with the ΔΨM stabilizer agent BA. Further experiments showed that SapC-DOPS induced a delayed release (by 24 h) of other important pro-apoptotic proteins, namely Cyto c and AIF, as well as translocation of Bax from cytosol to mitochondria with oligomerization of Bax monomers.
The nature and specificity of mitochondrial protein channels and their individual preferences towards the apoptogenic proteins Smac and Cyto c is under intense debate [
46]. However, accumulating evidence suggests that several channels function independently or in conjunction with the Bcl-2 family to determine the internal milieu of the organelle [
41,
47]. The phenomenon termed “mitochondrial permeability transition” (MPT) reflects the opening of the mitochondrial permeability transition pore (PTP), triggering an influx of water into the mitochondrial matrix due to osmosis and resulting in MOMP, which promotes apoptotic caspase-dependent and –independent cell death. VDAC, ANT, Cyclophilin D and the Translocator protein (18 kD) are putative constituents of the PTP [
47,
48], although knockout experiments have shown VDAC and ANT to be dispensable for MPT-driven MOMP, suggesting that alternate channels may regulate cell death [
48]. Pre-treatment with cyclosporine A, which inhibits the PTP by binding to Cyclophilin D, failed to prevent SapC-DOPS-induced mitochondrial efflux of Smac or Cyto c. Mitochondrial Ca
2+ overload is a critical activator of the PTP [
49]. In this study, however, flow cytometry with the Ca
2+-sensitive dye Fluo-3 AM showed that total intracellular Ca
2+ levels were not significantly altered after SapC-DOPS treatment. Collectively these results indicate that neither Cyclophilin D-mediated PTP opening nor intracellular Ca
2+ elevations are critical for SapC-DOPS-induced apoptosis of neuroblastoma cells.
Bax oligomerization is proposed to form megachannels in the outer mitochondrial membrane facilitating pro-apoptotic protein release [
36]. In support of an essential role of Bax, we observed that mitochondrial Bax translocation is rapid following SapC-DOPS treatment, and is necessary for Smac and Cyto c release from the mitochondria. However, significant oligomerization of Bax is only noticed at 24 h, which coincides with the peak of Smac and Cyto c release from the mitochondria. Although many studies suggest that in the absence of Bax no cytosolic Smac release occurs [
50], there are reports which show that cytotoxins [
51] as well as apoptosis inducers such as AT-101 [
27] directly target mitochondria and trigger Smac release irrespective of Bax activation. In the present study, Bax inhibition led to complete loss of cytosolic Smac release and an attenuated apoptosis as seen by diminished Cyto c release and caspase-3 activation. These results indicate that Bax is required for SapC-DOPS induced apoptosis. However, the trigger for Bax polymerization is currently unknown. ROS formation may trigger Bax conformational change and translocation [
52]. Consistent with this, we observed an increase in ROS formation by 6 h after SapC-DOPS treatment. However, generation of ROS is not required for apoptosis induction since pretreatment with ROS scavenger, N-acetyl cysteine (NAC) failed to prevent SapC-DOPS-induced cytosolic Smac and Cyto c release. Therefore, our results imply that SapC-DOPS-induced ROS formation is not critical for apoptosis, but may enhance Bax oligomerization to form megachannels. The relationship between Smac release and Bax activation is complex and is still under active investigation. Early mitochondrial release pointed to a crucial role for Smac in SapC-DOPS induced apoptosis. It has been reported that initial Smac release requires active caspases [
53], and we observed caspase activation corresponding to this time point. In general, during apoptosis the temporal release of Cyto c from mitochondria precedes Smac release [
54]. However, some anticancer drugs selectively release Smac rather than Cyto c [
55]. In agreement with the latter, we noticed selective cytosolic Smac release at the early stages of SapC-DOPS-induced apoptosis, whereas Cyto c release was not evident until 24 h. A marked increase in cell viability, retention of ΔΨM and reduction in SapC-DOPS induced apoptosis as seen by a decrease in cytosolic AIF and Cyto c release in Smac knockout cells further confirmed the essential role of Smac. These results are consistent with other reports that show Smac as an essential pro-apoptotic molecule that determines anticancer activity [
56].
The two human neuroblastoma cell lines we used in the present study have been shown to differ in their expression of MYCN protein, which plays an important role in the synergistic activation of Smac in some neuroblastoma cells [
57]. However, we observed that SapC-DOPS induced mitochondrial Smac and Cyto c release pattern was similar in the two neuroblastoma cell lines examined, despite different MYCN status. Further studies may be needed to clarify if SapC-DOPS-induced Bax oligomerization culminates in Smac release independently, or in combination with other Bcl-2 family members.
In summary, our present findings indicate that SapC-DOPS shows selective in vivo tumor targeting and exert significant tumor inhibition in mice bearing human neuroblastoma xenografts. Apoptosis was observed in vivo and in vitro and occurred through a mitochondrial pathway as demonstrated by a loss of mitochondrial ΔΨM and increased mitochondrial superoxide formation, with mitochondrial release of apoptogenic proteins such as AIF, Smac and Cyto c, and mitochondrial translocation and polymerization of cytosolic Bax. Gene knockdown and inhibition studies established Smac and Bax as major regulators of SapC-DOPS-induced apoptosis of neuroblastoma cells. These results, and the benign safety profile evidenced by several studies, suggest that SapC-DOPS may provide an effective therapeutic approach against neuroblastoma.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
Patents are pending for the intellectual property disclosed in this manuscript. X. Qi is listed as an inventor on the patent for SapC-DOPS technology that is the subject of this research. Consistent with current Cincinnati Children’s Hospital Medical Center policies, the development and commercialization of this technology has been licensed to Bexion Pharmaceuticals, LLC, in which X. Qi, holds a minor (<5%) equity interest. The other authors declared no conflict of interest.
Authors’ contributions
Conceived and designed the experiments: SMK, ZC, RSF, XQ. Performed the experiments: SMK, ZC, XQ. Analyzed the data: SMK, ZC, VMB, SDV, RSF, XQ. Contributed reagents/materials/analysis tools: SMK, ZC, RSF, XQ. Wrote the paper: SMK, XQ. Edited and approved the manuscript: SMK, ZC, VMB, SDV, RSF, XQ.