Background
Small-cell lung cancer (SCLC) is a highly lethal malignancy that accounts for 10–15% of lung cancers [
1]. SCLC is characterized by a rapid doubling time, high growth fraction, and early development of widespread metastases [
2]. Although the incidence of SCLC is reportedly decreasing over time, 5-year survival rates is still lower than 10%[
3]. SCLC is highly sensitive to initial chemotherapy and radiotherapy; however, most patients eventually die of widespread metastasis and rapid development of chemoresistance to chemotherapy [
4,
5]. In addition, though genetic changes have been reported in SCLC [
6], the precise molecular mechanisms involved in SCLC development and chemoresistance remain to be fully elucidated.
Recently, research has postulated a class of non-protein-coding RNAs (ncRNAs) that longer than 200 nucleotides in length, defined as long non-coding RNAs (lncRNAs), participates in cell biological processes and human disease pathogenesis [
7,
8]. lncRNAs are poorly conserved and regulate gene expression at various levels, such as chromatin modification, transcription and post-transcriptional processing [
9,
10]. With more and more studies on lncRNA, some researchers classify lncRNA for five broad categories: sense, antisense, bidirectional, intronic, intergenic; and summarize four known molecular functions of lncRNAs: signal, decoy, guide, and scaffold [
11]. Interestingly, increasing evidence suggests that lncRNAs play a important role in tumorigenesis, and their aberrant expression confers tumor initiation, cancer cell growth and apoptosis, chemoresistance, invasion and metastasis [
12‐
14]. For example, promotion of lung cancer metastasis by lncRNA MALAT1 (Metastasis Associated Lung Adenocarcinoma Transcript 1); control of hepatocellular cancer cell growth and apoptosis by MEG3; regulation of oesophageal adenocarcinoma cell proliferation and migration by HNF1A-AS1 [
15‐
17]. In addition, studies showed that the long non-coding RNA HOTTIP promotes gemcitabine resistance by regulating HOXA13 in pancreatic cancer [
14]. Our laboratory also reported that lncRNA HOTAIR affects chemoresistance by regulating HOXA1 methylation in SCLC [
18]. However, functional roles of lncRNAs in SCLC have not been well documented.
The TUG1 (Taurine upregulated gene) lncRNA, located at chromosome 22q12, was originally identified as a transcript up-regulated by taurine [
19]. Recently, accumulating evidence has shown that TUG1 is a negative prognostic factor for osteosarcoma patient survival, and high expression of TUG1 in patients has been correlated with enhanced bladder and esophagus cancer cells proliferation and metastasis [
20‐
22]. In previous study, researcher found TUG1 could induced by p53, then binds to PRC2, and play a key role in cell-cycle regulation [
23]. Some studies have explored that TUG1 may regulate genes expression through binding to PRC2. For instance, TUG1 could regulate the expression of HOXB7 by binding to PRC2, then affects cell proliferation in human non-small cell lung cancer [
24]. In gastric cancer, TUG1 epigenetically silencing of p57 by binding with PRC2 to regulates cell proliferation [
25]. However, little is known about TUG1 in SCLC.
In this study, we attempted to explore the potential involvement of TUG1 in SCLC. We found that TUG1 was upregulated in SCLC tissues than matched adjacent normal tissues and its upregulation is related with poor prognosis. Knockdown of TUG1 impairs proliferation, migration, invasion and induces cell apoptosis and cell-cycle arrest of human SCLC cell lines. Moreover, we identify the role of TUG1 in chemoresistance in SCLC cells for the first time. Additionally, we found TUG1 affect cell growth and chemoresistance by regulating LIMK2b expression via binding with EZH2. Taken together, our findings suggest that TUG1 may be a novel potential molecular target for treating SCLC patients.
Discussion
Recently, the study about the biological function of TUG1 has become one of the hottest topics in various cancer. TUG1 was overexpressed in various solid tumor including osteosarcoma, bladder, esophagus, gastric and liver cancer [
20‐
22,
25,
27]. Nonetheless, the clinical features of TUG1 expression in SCLC have not been reported yet. In this study, we analyzed the expression of TUG1 in 33 cases of human SCLC tissues and found that the high expression level of TUG1 indicates shorter survival time of the SCLC patients. Therefore, our research may provide an independent prognostic factor for SCLC patients.
To explore the functional role of TUG1 in SCLC, we therefore established stable TUG1-downexpressed cells in the study. Our data indicate that TUG1 was upregulated in SCLC, inhibition of TUG1 expression resulted in decreased cell growth and enhanced chemosensitivity both in vitro and in vivo. Moreover, we found that knockdown of TUG1 also increased cell apoptosis, G1 cell-cycle arrest, and impaired SCLC cell migration and invasion ability.
To further investigate the mechanisms of TUG1 involved in cell growth and chemoresistance, we conducted the bioinformatics analysis and found LIMK2b, which located at 300kp of TUG1. LIMK2 is a member of LIM kinase (LIMK) family that includes LIMK1. LIMK2 encodes a kinase that regulates actin dynamics through phosphorylation of cofilin, and comprises two alternative transcripts, LIMK2a and LIMK2b [
28‐
30]. Recent reports illustrate that LIMK2 is involved in tumor growth, and induces migration and invasion of tumor cells [
31‐
33]. Additionally, studies also showed a negative correlation between LIMK2 and anticancer drugs, which suggesting that LIMK2 may be a predictive marker of drug resistance [
34,
35]. Previous study showed that LIMK2b could encode only one and a half LIM domains after the first LIM domain partially replaced, which is special to the LIMK2 gene and conserved between murine and human genes [
36,
37]. Recent studies demonstrated that LIMK2b is a direct target of p53 and involved in the control of cell proliferation and cell division. The report also showed that LIMK2b has a critical role in promoting the G2/M DNA-damage checkpoint [
38]. In the present study, we firstly hypothesized that TUG1 may associated with LIMK2b. Our results showed that knockdown of TUG1 significantly decrease the expression of LIMK2b. Furthermore, the impacts of TUG1 on cell growth and chemoresistance were reversed by concomitant LIMK2b -GFP, which indicating that the effect of TUG1 on cell growth and chemoresistance is partly mediated through LIMK2b. Moreover, we also found that LIMK2b was over- expressed and positively correlated with TUG1 in SCLC tissues. However, RIP analysis indicated that there was no direct combination between TUG1 and LIMK2b, which suggested that TUG1 affected cell growth and chemoresistance is not directly through LIMK2b. The results stated above raises an interesting question: What is the linker between TUG1 and LIMK2b? Several recent studies indicated that TUG1 regulate genes expression by binding with EZH2 to affect cell proliferation in human non-small cell lung cancer, gastric cancer and hepatocellular carcinoma [
24,
25,
27]. So, we hypothesized that EZH2 may be a linker between TUG1 and LIMK2b. To prove our hypothesis, we used ChIP assays to demonstrate that knockdown of TUG1 decreased the binding of EZH2 and H3K27me3 levels across the LIMK2b promoter. EZH2 as an important component of polycomb repressive complex2 (PRC2) has been reported to be necessary for the formation of the H3K27me3, and recruits histone deacetylases then resulting in gene transcriptional repression in cancer cells [
39‐
41]. These results suggested that TUG1 epigenetically regulated LIMK2b through EZH2.
Conclusions
In summary, our study showed that TUG1 was upregulated in SCLC tissues and its overexpression is closely associated with clinical stage and overall survival in patients with SCLC. Furthermore, the effects of TUG1 on cell proliferation, cell apoptosis, cell cycle regulation, migration, invasion and chemoresistance indicated that TUG1 promotes tumorigenesis. We also demonstrated that TUG1 is involved in cell growth and chemoresistance of SCLC through regulating LIMK2b by binding with EZH2. This study may provide a strategy and lead to the development of lncRNAs directed diagnostics and therapeutics against SCLC.
Methods
Patients and tissue samples
A total of 33 formalin-fixed, paraffin-embedded (FFPE) tissues (33 primary cancerous, 11 adjacent non cancerous tissues) were collected from patients who had underwent bronchofiberscopy or biopsy for SCLC between the period 2009.1 and 2013.11 and receiving care and follow-up at The First Affiliated Hospital of Hebei North University, informed consent was obtained from all patients before sample collection. The experiments were approved by the Ethics Committee of The First Affiliated Hospital of Hebei North University, and conformed to the standards set by the Declaration of Helsinki. Clinical data included the patient gender, age, smoking history, limited- or extensive-stage disease and follow-up (Table
1).
Cell culture and treatment
Human SCLC cell line NCI-H69, NCI-H446, NCI-H69ARwere purchased from the American Type Culture Collection (ATCC, United States of America (USA)) and maintained in RPMI1640 medium contain in l-glutamine with 10% and 20% fetal calf serum respectively in an incubator at 37 °C with 5% CO2. The cisplatin-resistant NCI-H446DDP cell line was obtained by culturing cells in gradually increasing doses of cisplatin up to 2.0 uM after a total of 7 months in our laboratory. The drug-resistant cells were maintained in drug-free medium for at least 2 weeks before any experiment. To inhibit EZH2 activities, cells were treated with 12 μM GSK343 (S7164, Selleck) or 10 μM EI1 (S7611, Selleck) for 36 h.
RNA isolation, quantitative reverse transcription-polymerase chain reaction (qRT- PCR)
Total RNA was extracted from cell lines and FFPE tissues using TRIzol (Invitrogen), RNeasy FFPE Kit (Qiagen) according to the manufacturer’s instructions. According to Prime Script RT reagent Kit (TIANGEN, Beijing, China), reverse transcription reactions were processed at 42 °C for 15 min, followed by 3 min at 95 °C for cDNA synthesis. Then quantitative real time PCR was performed in an ABI illumina instrument . Primers were designed by Shanghai Sangon Biotech Co Ltd. TUG1 F: 5′ TAGCAGTTCCCCAATCCTTG3′; R: 5′CACAAATTCCCATCAT TCC- C3′; LIMK2b F: 5′ AGGCAGTCACAGACGGATTT3′; R: 5′GAGCTTCCCATCCT- TCTCATAG 3′; GAPDH was used as an endogenous control. The relative gene expression levels of TUG1 were determined using the comparative delta-delta CT method (2-∆∆Ct).
Cell transfection
SCLC cells were transiently transfected with small interfering siRNA or scrambled siRNA negative control (NC) . Following the manufacturer’s protocols, cells were seeded in six-well plates and transfected with siRNA by Lipofectamine 2000 (Invitrogen) when grew to reach about 70% confluence. Three individual TUG1 siRNAs (siTUG1 1*, siTUG1 2*, siTUG1 3*1), EZH2 siRNA (si-EZH2 1*, si-EZH2 2*, si-EZH2 3*) and siNC were designed by GenePharma Inc (Shanghai, China) . The nucleotide sequences of siRNAs for TUG1 and EZH2 were shown in table S1.
The lentiviral particles of shTUG1 (forward, 5′-GATCCGCTTGGCTTCTATTCTG AATCCTTTCAAGAGAAGGATTCAGAATAGAAAGCCAAGCCAAGCTTTTTTG-3′ and reverse, 5′-GCGAACCGAAGATAAGACTTAGGAAAGTTCTCTTCCTAA GTCT TATCTTCGGTTCGAAAAAAC-3′) and LIMK2b-GFP were also designed and purchased from GenePharma Co., Ltd. To generate the lenti-viruses, shRNA plasmids were co-transfected into SCLC cells along with envelope (VSVG) and packaging (pGag/Pol, pRev) plasmids using lipofectamine 2000 (Invitrogen). The viral supernatants were harvested and filtered after 48 h transfection. Cells were infected in the presence of a serum-containing medium supplemented with 8 μg/ml polybrene. Following infection for 48 h, cells were selected with 2.0 μg/ml puromycin (Sigma). Knockdown efficiencies were examined by qRT-PCR.
Cell counting kit-8 (CCK-8) assay
Cell proliferation and drug resistance were assayed by the Cell Counting Kit-8 (CCK8) assay. For cell proliferation assay, transient transfection cells were seeded in 96-well plates about 5 × 103 cells per well. According to the manufacturer’s protocol, testing cell proliferation every 24 h. For cell drug resistance assay, after transient transfection cells, then treated it with drugs for 24 h. Three chemotherapy drugs [Cisplatin (DDP; Shandong, China), Adriamycin (ADM; Jiangsu, China) Etoposide (VP-16; Jiangsu, China),] were used. After incubation with 10ul of CCK-8 reagent (Beyotime Institute of Biotechnology, shanghai, China) for 2 h or 4 h, the absorbance at 450 nm was measured. The cells incubated without drugs were set at 100% survival and were used to calculate the concentration of each chemotherapeutic drug IC50. The assay was performed in five replicate wells, and three parallel experiments for each sample were conducted.
Collected cells that transduced with shTUG1, both shTUG1 and LIMK2b-GFP or control shRNA and seeded (200 cells/well) in six-well plates. Then, the cells were incubated in an incubator with 5% CO2 at 37 °C. After two weeks later, removed the culture medium, and rinsed cells three times with PBS. Nextly, the cells were fixed with 4% paraformaldehyde, then stained with 0.1% crystal violet. The number of colonies were counted by visual inspection.
Cell invasion and migration assay
For the invasion assays, 24-well Matrigel invasion chambers
(Corning Incorporated, Corning, NY, USA) was used. After TUG1 knockdown, 3x104 cells were seeded on the upper chamber. To stimulate invasion, the bottom chamber was added 500 μL medium with 20% FBS . After 48 h, cells in the bottom chamber were stained with 0.1% crystal violet, then counted using a microscopy (100 × magnification). Additionally, Wound healing assay was performed for analysis of cell migration. Cells transfected with either shTUG1 or shNC, were seeded on six-well plates, then created an artificial scratch wound with a 100-μl pipette tip. Cells with serum-free medium for a further 24-h incubation. Recovery of the disruption was observed for 0 h, 24 h. Each assay was performed at least three times.
Flow cytometric analysis
For apoptosis and cell-cycle assay, cells were transfected with siTUG1, then treated with drugs for 24 h or not before collected. Cell apoptosis assay was conducted by using AnnexinV/propidium iodide detection kit (Keygene, Nanjing, China). For cell-cycle assay, cells were collected and fixed in 70% ethanol at 4 °C for 16 h and then stained with propidium iodide.
Tumor xenograft experiments
This study was conducted according to the institutional guidelines of Guangdong Province and were approved by the institutional guidelines of Guangdong Province and by the Use Committee for Animal Care. Male BALB/c nude mice aged 3–4 weeks were purchased from the Experimental Animal Center of Sun Yat-sen University (Guangzhou, China). Cells were harvested and re-suspended in serum free medium at a concentration of 1 × 107 cells/0.2 ml. Each mouse was inoculated subcutaneously in the right flank with SCLC cells stably transduced with shTUG1 or shControl. Tumor size was monitored every 3 days, and mice were euthanized after 4 weeks. In vivo chemosensitivity assays, the animals were treated with chemotherapeutics or PBS via intraperitoneal injection (7 mg/kg body weight etoposide [once every 2 days] and 3 mg/kg body weight cisplatin [once every 8 days]).
Western blotting
Equivalent amounts of cell protein lysates were electrophoresed on an 10% SDS-polyacrylamide gel, transferred to a PVDF membrane. Then the membrane was incubated with primary antibodies overnight at 4 °C. Followed incubated by horseradish peroxidase-labeled secondary antibody. Anti-LIMK2b was purchased from Abcam (1:1,000). GAPDH was used as a protein-loading control. The immune complexes were detected by chemiluminescence (ECL).
RNA immunoprecipitation (RIP) assay
RNA immunoprecipitation was conducted using Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore) following the manufacturer’s protocol.
Chromatin immunoprecipitation
The ChIP assays were performed according to the Protocol for the fast chromatin immunoprecipitation (ChIP) method [
42]. EZH2 antibody was purchased from Abcam. H3 trimethyl Lys 27 antibody was from Millipore. Gene specific primers for LIMK2b are listed in Additional file
5: Table S5. Results were normalized using the internal control IgG. Precipitated chromatin DNA was recovered and analyzed by qPCR.
Statistical analysis
Statistical analyses were performed using SPSS version 21.0 software. Experimental results are presented using means ± SD. Independent- samples T test or one-way ANOVA were used to analyze the possible differences between groups. The association between TUG1 expression and clinical features were analyzed by Pearson Chi-Square test. Survival curves were assessed by Kaplain-Meier analysis. Prognostic factors were analyzed by univariate and multivariate analyses (Cox proportional hazards model). P values < 0.05 was considered statistically significant.
Acknowledgements
Disclosure of potential conflicts of interest.
There are no potential conflicts of interest to disclose.