Background
Renal cell carcinoma (RCC) is the sixth most common malignant tumor in the United States, representing approximately 5% of adult male malignancies in 2017 [
1]. The mortality of RCC patients appears to be increasing each year, resulting in frequent studies on biological detections and treatments [
2]. Drug targeted therapies, including mammalian targets of rapamycin and vascular endothelial growth factor, have boomed [
3,
4]. Unfortunately, drug resistance can occur in late stage patients, resulting in a bad prognosis [
5,
6]. Therefore, the molecular mechanisms of RCC tumorigenesis need to be thoroughly investigated.
Long non-coding RNAs (lncRNAs) are a set of non-protein coding transcripts longer than 200 nucleotides [
7]. They have been shown to have various functions including post-transcriptional regulation, chromatin modification and other biological processes [
8,
9]. Some lncRNAs have been shown to play crucial roles in different kinds of cancer cells, including breast [
10], colorectal [
11], gastric [
12] and renal [
13] cancer cells.
microRNAs (miRNAs) are also non-coding RNAs (ncRNAs) that are well known to play important roles in tumor biological processes [
14,
15]. Effective diagnostic and therapeutic strategies have been used in clinical settings worldwide. Recently, a new mechanism was discovered in which some lncRNAs and mRNAs could interact with each other by competing with some common miRNAs [
16]. In this case, lncRNAs could function as competing endogenous RNA (ceRNA) to sponge related microRNAs for the derepression of downstream genes at a post-transcriptional level [
17,
18]. This mechanism provides a new way to study ncRNAs in tumors.
Our previous study indicated that miR-335 could function as a tumor suppressor in RCC. Expression of miR-335 was downregulated in RCC tissues compared to corresponding normal renal tissues. Low expression of miR-335 was associated with tumor size, lymph node metastasis and T stage. miR-335 could inhibit proliferation and invasion through direct suppression of BCL-W [
19]. Whether lncRNAs could regulate miR-335 to influence the biological behaviors of RCC cells has not been characterized.
Here, we first identified a novel lncRNA, RP11-436H11.5, that was more highly expressed in RCC tissues than in paired normal renal tissues. Downregulation of lncRNA RP11-436H11.5 could result in significant suppression of proliferation and invasion in vitro and in vivo. Our data demonstrated that lncRNA RP11-436H11.5 could directly bind with miR-335-5p and function as a miRNA decoy to regulate BCL-W expression.
Methods
Clinical samples
Human RCC tissues and adjacent normal renal tissues were acquired from patients diagnosed with RCC in the Department of Urology, Shengjing Hospital of China Medical University. The ethics consents were signed by each patient before the study. All patients agreed that the data from their samples could be used for experimental studies and paper presentations.
Reagents
Bcl2L2 (BCL-W) antibody was purchased from Abcam Public Limited Company (Product code ab38,629). GAPDH antibody (0411) was from Santa Cruz Biotechnology (Catalog# sc-47,724). All the antibodies were stored at −20°C.
Cell culture
RCC cells (A498, 786-O and OSRC-2) were purchased from American Type Culture Collection (ATCC, Manassas, VA) and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Invitrogen, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine, penicillin (25 units/ml) and streptomycin (25 g/ml). All cell lines were detected and authenticated as bacteria and mycoplasma free following ATCC’s instructions within the past 3 months.
Lentivirus packaging
The siRNA sequences targeting lncRNA RP11-436H11.5 were F-primer TAATTTGTTTCTAGATGTGTG and R-primer CACATCTAGAAACAAATTAAT. A Gibson assembly assay was performed for oelncRNA RP11-436H11.5 with F-primer TTTCGACATTTAAATTTAATGCTGTTTTACTTGCACGCAC and R-primer ATTCCTGCAGCCCGTAGTTTCCTACACAAAAACTTGGGTA. miR-335 mimics were synthesized by RiboBio (Guangzhou, Guangdong, China). These plasmids and the psPAX2 packaging plasmid, pMD2G envelope plasmid were transfected into HEK293T cells to get the lentivirus soups following the manufacturer’s protocol and frozen in −80°C for use.
RNA extraction and qRT-PCR assay
Total RNAs were extracted using Trizol reagent (Invitrogen, Grand Island, NY). RNAs were reverse transcribed by Superscript III transcriptase (Invitrogen, Grand Island, NY). QRT-PCR was applied using a Bio-Rad CFX96 system with SYBR green to detect the mRNA expression level of a gene of interest. The qRT-PCR protocol was as follows: 50°C for 2 min, 95°C for 8 min 30 s, followed by 45 cycles at 95°C for 15 s, and 60°C for 1 min. The extension is 95°C for 1 min, 55°C for 1 min, and 55°C for 10 s. GAPDH was used as a normalized control.
miRNAs were extracted using a PureLink® miRNA kit. The qRT-PCR protocol was as follows: 95°C for 2 min, followed by 45 cycles at 95°C for 15 s, and 60°C for 45 s. U6 and/or RPL32 was used as a normalized control.
Cell proliferation assay
RCC cells were seeded in 24-well plates (3000 cells/well) and cultured for indicated periods. Then media were replaced with MTT regent and DMSO was used to dissolve the blue crystals. Cells proliferation and viability were measured with absorbance at 570 nm.
Cell invasion assay
RCC cells were seeded in a 6-well plate after designated treatments and incubated for 72 h. The upper chambers were coated with Matrigel (1:20, BD Corning) 2 h before plating the cells. Cells were collected with serum-free media and plated into the upper chambers at a concentration of 1 × 105/ml. A total of 750 μl of 10% FCS media was added into the lower chambers for incubation at 37°C in 5% (v/v) CO2 incubator for 12–14 h. The invaded cells were permeabilized by methanol for 20 min at room temperature and stained with 0.1% (w/v) crystal violet in a dark room.
Luciferase reporter assay
LncRNA RP11-436H11.5 involving wild-type or mutant miRNA response elements (MREs) were cloned into the psiCHECK2 vector (Promega, Madison, WI) at downstream of the Renilla luciferase ORF. A498 and 786-O cells were plated in 24-well plates, and transfected with constructed plasmids with lipofectamine 3000 transfection reagent (Invitrogen, Carlsbad, CA). Luciferase activities were measured 36–48 h after transfection by Dual-Luciferase Assay (Promega) according to the manufacturer’s manual.
Western blot assay
Protein was extracted with lysis buffer and electrophoretically transferred onto PVDF membranes (Millipore, Billerica, MA). Then the membranes were blocked by Bovine Serum Albumin (Sigma-Aldrich, St. Louis, MO) and bred with primary antibodies at 4°C overnight. Thereafter, the membranes were incubated with secondary antibodies at room temperature for 1 h. Bands were visualized by an ECL chemiluminescent detection system (Thermo Fisher Scientific, Rochester, NY).
RNA pull-down assay
Cells were quantitated and treated with 1 ml of cell lysis buffer for 72 h. Then, cells were rotated overnight at 4°C after adding 1.5 μl of RNase inhibitor, 10 μl of streptavidin agarose beads and 500 pM antisense oligos. Beads were washed 5 times by cell lysis buffer. Total RNAs were subjected to qRT-PCR analysis.
Ago2 immunoprecipitation assay
Transfected cells were lysed with RIPA lysis buffer (150 mM NaCl, 20 nM Tris-HCl (PH 7.5), 1% NP-40, 2.5 mM sodium pyrophosphate, 1 mM Na2EDTA, 1 mM EGTA, 1% sodium deoxycholate, 1 μg/ml leupetin, 1 mM Na3VO4, and 1 mM beta-glycerophosphate). Cell suspension was centrifuged 15 min at 14000 rpm. The supernatant was rotated overnight at 4 °C after adding 2 μl of AGO2 antibody and 10 μl of beads. The mixture was washed 3 times with lysis buffer. RNAs were extracted using Trizol reagent (Invitrogen).
In vivo studies
Twenty-four 6–8-week-old nude mice were purchased from Shanghai SLAC Laboratory Animal Co. Ltd. A498 cells were engineered to express luciferase reporter gene (PCDNA3.0-luciferase) and then stably transfected with pLVTHM, shlncRNA RP11-436H11.5 and oelncRNA RP11-436H11.5. Approximately 1 × 106 A498 cells (mixed with Matrigel, 1:1) were injected into the subrenal capsule. Tumor formation and metastasis were monitored by Fluorescent Imager (IVIS Spectrum, Caliper Life Sciences, Hopkinton, MA) once a week. Mice were sacrificed after 6 weeks. Tumors were removed for study.
Statistical analysis
Data were expressed as the mean ± SEM from at least 3 independent experiments. Statistical analyses involved paired t-tests with SPSS 17.0 (SPSS Inc., Chicago, IL). Overall survival (OS) was evaluated by Kaplan-Meier survival curves and compared by log-rank test. P < 0.05 was considered statistically significant.
Discussion
RCC is a common tumor-related cause of death worldwide. The incidence of RCC has increased from 61,560 to 63,990 over the past three consecutive years in the United States [
1,
21,
22]. LncRNAs have been found to take part in many biological processes, that maintain relatively low expression levels and are primate specific [
23]. Recent studies have shown that abnormal expression of lncRNAs can lead to tumor onset and progression [
24‐
26]. Therefore, it is important to find new lncRNAs for the prevention and treatment of RCC.
Our previous study found that miR-335 suppressed RCC cell proliferation and invasion by repressing BCL-W expression [
19]. However, the functional impacts of lncRNAs in miR-335-BCL-W-mediated tumorigenesis remain unclear. Based on our previous study, candidate lncRNAs were selected by a human lncRNA target prediction tool (DIANA TOOLS). The qRT-PCR screening results showed that lncRNA RP11-436H11.5 was upregulated in RCC tissues compared to adjacent normal renal tissues. In addition, RCC patients in the high lncRNA RP11-436H11.5 group showed a worse prognosis by Kaplan-Meier survival curves than those in the low lncRNA RP11-436H11.5.
Notably, recent studies have shown that lncRNAs can function as a miRNA sponge to regulate mRNA expression levels [
27‐
29]. LncRNAs can sponge miRNAs by MREs to protect downstream mRNAs from repression [
30]. For example, lncRNA BC032469 could upregulate hTERT expression to promote proliferation in gastric cancer by sponging miR-1207-5p [
31]. LncRNA-BGL3 functioned as a ceRNA to cross-regulate the expression of PTEN by sponging 6 miRNAs [
32]. Our previous study demonstrated that miR-335 suppressed RCC cell proliferation and invasion by repressing BCL-W. Subsequently, we considered whether lncRNA RP11-436H11.5 regulated miR-335-BCL-W-mediated RCC cell proliferation and invasion by functioning as a miRNA sponge. To prove this notion, luciferase reporter assays were applied to verify the binding effect of predicted MREs on the full-length lncRNA RP11-436H11.5 transcript. As our expected, miR-335-5p repressed the lncRNA RP11-436H11.5 reporter gene by complementary bindings. In addition, RNA-pull down assays further confirmed that lncRNA RP11-436H11.5 sponged miR-335-5p to derepress BCL-W expression. Furthermore, luciferase reporter assays revealed that ectopic overexpression of lncRNA RP11-436H11.5 increased BCL-W expression by sequestrating miR-335-5p. Taken together, we put forward for the first time that lncRNA RP11-436H11.5 functioned as a ceRNA by upregulating BCL-W expression by sponging miR-335-5p and promoted proliferation and invasion in RCC cells. Furthermore, deregulation of lncRNA RP11-436H11.5 expression led to depress BCL-W levels, hindering RCC cell growth.
From our study, we had reasons to believe that ectopic overexpression of lncRNA RP11-436H11.5 might be used as a biomarker of poor prognosis in RCC patients. Our study also revealed that lncRNA RP11-436H11.5 adjusted a miRNA/targeted gene transcript transformation to perform its functions in RCC pathogenesis. We considered that interruption of the lncRNA RP11-436H11.5-miR-335-BCL-W signals might help us find a new way to suppress RCC progression.
It is worth mentioning that the number of patients used for Kaplan-Meier analysis is low. However, these were all the tissues in our hospital during this period. More RCC tissues should be included in the study to yield convincing results. In addition, we all know that cross-regulation of ceRNAs at the gene level is exceedingly complicated. One lncRNA can regulate an army of miRNAs at the same time, and one miRNA can regulate multiple genes. Therefore, the miR-335-BCL-W signal may not be the only pathway targeted by lncRNA RP11-436H11.5 in RCC. On the other hand, there may be other lncRNAs that regulate the levels of key genes in RCC cell proliferation and invasion. Additional studies to find pivotal genes and related lncRNAs can help us better understand the pathogenesis and progression of RCC.
Acknowledgements
We thank Yun Cui from the Department of Urology, National Urological Cancer Center, Peking University First Hospital and Institute of Urology for helping us prepare the manuscript.