Background
Ovarian steroid hormones such as estradiol (E
2) play important roles in many biological processes, including ovarian follicular development, oocyte maturation, endometrial proliferation and mammary gland development [
1,
2]. In addition, dysfunctions in estrogen synthesis are associated with the development of polycystic ovary syndrome and premature ovarian failure [
3,
4]. According to the traditional two-step theory of E
2 biosynthesis, androgen is produced from cholesterol in theca cells and converted into E
2 via cytochrome P450 aromatase, a rate-limiting enzyme for estrogen synthesis, in granulosa cells (GCs) [
5]. Follicle-stimulating hormone (FSH) is a glycoprotein hormone that is produced by the anterior pituitary gland. This gonadotropin plays an essential role in steroidogenesis of ovarian GCs. The binding of FSH to its receptor (FSHR) on the surface of GCs in immature preantral follicles activates the effector adenylyl cyclase, which leads to the synthesis and upregulation of the intracellular second messenger cyclic adenosine monophosphate (cAMP) [
6]. By activating multiple signaling cascades, FSH triggers the specific, time-related expression of genes, such as
Cyp19a1, and promotes the proliferation and differentiation of GCs [
7]. FSH induces the phosphorylation of the cAMP response element binding protein (CREB), which transactivates
Cyp19a1 by binding to a cAMP-responsive element-like sequence (CLS) in its proximal promoter (PII promoter) [
8‐
10]. Besides classical regulations in the FSH pathway, epigenetic mechanisms remain to be elucidated, which will increase our understanding of ovarian physiology.
MicroRNAs (miRNAs) are small noncoding RNAs that are 20-24 nucleotides in length and are endogenously expressed in most eukaryotes. Previous studies demonstrated that miRNAs play important roles in diverse biological processes, such as development, inflammation and tumorigenesis [
11]. The primary mechanism by which miRNAs regulate gene expression is via posttranscriptional binding to the 3'-untranslated region (3'-UTR) of mRNAs, which leads to either degradation or translational repression of the mRNA. In the ovary, many miRNAs are involved in the proliferation, apoptosis, and differentiation of GCs [
12,
13]. Some miRNAs have recently been reported to influence steroid hormone release from human ovarian GCs based on a genome-scale miRNA screen [
14]. Studies examining miRNA-regulated E
2 biosynthesis determined that miR-224 [
15] and miR-383 [
16] play important roles in the TGF-β/Smads pathway by targeting
Smad4 and
RBMS1, respectively. The Cyp19a1 gene has also been confirmed to be a direct target of miR-378 [
17] and miR-98 [
18].
Among the miRNAs that are involved in the cAMP signaling pathway, miR-132 has been demonstrated to be upregulated in rat GCs by either cAMP [
19] or FSH treatment [
20] and in periovulatory mouse granulosa cells (mGCs) after LH/hCG induction [
21]. A recent study in polycystic ovary syndrome patients showed that the expression levels of miR-132 in follicular fluid were significantly lower in patients than in controls [
22]. They also found that overexpression of miR-132 increased E
2 secretion from KGN, a steroidogenic human granulosa-like tumor cell line. These findings suggest that miR-132 may play diverse roles such as steroidogenesis in different developmental stage of granulose cells. The functions of miR-132 may be related to the fact that cAMP mediates divergent pathways depending on the differential status of GCs [
23]. Our aims of this study are to determine if miR-132 is involved in the cAMP pathway in primary cultured mGCs isolated from immature mice and to investigate the role of miR-132 in E
2 synthesis using a relatively low plating density to retain the estrogenic phenotype of mGCs [
24]. Our study also identified
Nurr1 as a direct target of miR-132, which mediates the regulation of E
2 synthesis by miR-132 in mGCs.
Methods
Animals
Three-week-old ICR mice were purchased from the Lab Animal Center of Yangzhou University (Yangzhou, China). All animals were maintained in the Animal Laboratory Center of Drum Tower Hospital (Nanjing, China) on a 12-h/12-h light/dark cycle (lights off at 19:00), with food and water available ad libitum. All animal experiments were approved by the Institutional Animal Care and Use Committee at Nanjing Drum Tower Hospital (SYXK 20014-0052).
Isolation and culture of primary mGCs
A previously described in-house method [
25] was performed to isolate mGCs from the ovaries of 21-day-old immature mice. Briefly, the ovaries were harvested and separated from the surrounding fat. After the ovaries had been punctured repeatedly with 25 gauge needles, the mGCs were collected and plated in DMEM/F12 (Gibco, Life Technologies, Carlsbad, CA, USA) containing 10 % FBS (Gibco), 1 mM sodium pyruvate (HyClone, Thermo Scientific, South Logan, UT, USA), 2 mM L-glutamine (Gibco), and 1 % antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin; Gibco). The medium was replaced 24 h after plating to remove any unattached cells. The mGCs were cultured in medium at 37 °C in a humidified environment with 5 % CO
2 and were used after the first passage. At 24 h after plating, the cells were placed in phenol red-free DMEM/F12 (HyClone) supplemented with 2 % charcoal/dextran-treated fetal bovine serum (C-FBS; HyClone) for 48 h. The cells were subsequently treated with medium alone or with 1 mM 8-bromoadenosine 3',5'-cyclic monophosphate (8-Br-cAMP) (Sigma, St. Louis, MO, USA) for 0, 3, 6, 12, 24 or 48 h. Total RNA was isolated, and the expression of miR-132 was analyzed using quantitative polymerase chain reaction (PCR).
Immunofluorescence staining
mGCs were plated on 18 mm microcover glasses (Matsunami, Osaka, Japan) for 24 h and subsequently fixed with 4 % paraformaldehyde in PBS for 30 min at room temperature. The cells were then washed with PBS and permeabilized with 0.2 % Triton X-100 in PBS for 15 min at room temperature. After being blocked with 1 % BSA in PBS, cells were stained for FSHR by incubation with a 1:100 dilution of an anti-FSHR polyclonal antibody (Bioworld Technology, St. Louis Park, MN, USA), followed by incubation with a 1:200 dilution of an Alexa Fluor 488-conjugated goat anti-rabbit IgG (Molecular Probes, Life Technologies, Carlsbad, CA, USA) for 1 h. PBS was used as negative controls for primary and secondary antibodies to exclude nonspecific staining. Nuclei were stained with a 1:5000 dilution of DAPI (Vector Laboratories, Burlingame, CA, USA). Images were visualized using a FLUOVIEW FV10i confocal microscope system (Olympus, Tokyo, Japan).
Immunohistochemistry
Formalin-fixed paraffin-embedded 21-day-old immature mice ovaries were serially sectioned, dewaxed with xylene and rehydrated through a graded alcohol series. Sections were then treated with 3 % hydrogen peroxide to quench endogenous peroxidase activity, microwaved sequentially to retrieve antigen, and incubated in blocking solution for 1 h. Sections were then incubated with a 1:100 dilution of an anti-FSHR polyclonal antibody (Bioworld Technology) overnight at 4 °C. The next day, the sections were incubated with goat anti-rabbit secondary antibody ABC detect kit (ZSBio, Beijing, China) at 37 °C for 30 min, and then stained with 3,30-diaminobenzidine (DAB) and counterstained with hematoxylin. Negative control sections were processed concurrently using PBS and similarly pre-treated.
Plasmid construction
NURR1 cDNA [GeneBank: NM_006186.3] was synthesized and amplified from the total RNA of human endometrial stromal cells using the SuperScript III One-Step RT-PCR System with the Platinum Taq High Fidelity Kit (Invitrogen, Life Technologies, Carlsbad, CA, USA) and the following primers: 5'-CGACACTGTCCACCTTTAATTTC-3' and 3'-TTTAGGGATCAAGGGGGCTA-5'. A second PCR step was performed using the Platinum Pfx DNA Polymerase (Invitrogen) and the following primers: 5'-TATAAGATCTGATGCCTTGTGTTCAGGCGCAG-3' and 5'-TAGCGGTACCTTAGAAAGGTAAAGTGTCCAG-3'. To create a Flag-Nurr1 protein expression vector, fragments harboring full-length
NURR1 were cloned into pFLAG-CMV-2 (Sigma) using the BglII and KpnI restriction sites (Promega, Madison, WI, USA). The wild-type sequence of the Nurr1 3'-UTR [GeneBank: NM_013613.2] that contains the miR-132 binding site was amplified using mGC cDNA as a template and the following primers: 5'-TATCTCGAGGAATTGAAGGCAGAGGCTTG-3' and 5'-TCGTCTAGATGACTCATCTCATGTGCCGTA-3'. To create the pmirGLO-Luc-Nurr1 3'-UTR WT vector, the resulting PCR fragment was cloned into the pmirGLO dual-luciferase miRNA target expression vector (Promega) using the XhoI and XbaI restriction sites (Promega). The mutant sequence contained two mutations in the ‘seed sequence’ of the miR-132 binding site, which is indicated in Fig.
5a. We designed primers (5'-CAGCTTTTGGATGTTTCCAGAG-3' and 5'-CACTCTGGAAACATCCAAAAGC-3') to create a pmirGLO-Luc-Nurr1 3'-UTR MU vector via overlap extension PCR. A luciferase reporter gene plasmid containing NGFI-B response elements upstream of the reporter (NBRE-Luc) was constructed according to previously described methods [
26] using the pGL3-Basic vector (Promega), which was a generous gift from Sun Jianxin at Thomas Jefferson University, Philadelphia, USA. The sequences of all recombinant plasmids were confirmed by DNA sequencing.
Transient transfection
Chemically synthesized single-stranded RNAs that mimic mature endogenous miR-132 [GeneBank: NR_029546.1] after transfection into cells were used as miR-132 mimics, and mimics NC were used as negative controls. Chemically modified antisense RNA oligonucleotides optimized to specifically target miRNA molecules in cells were used as miRNA inhibitors, and inhibitors NC were used as negative controls. Nurr1-specific siRNA oligonucleotides (sense: 5'-CCACCUUGCUUGUACCAAAdTdT-3'; antisense: 3'-dTdT GGUGGAACGAACAUGGUUU-5') were used to knock down endogenous Nurr1, and siNC oligonucleotides were used as negative controls. These oligonucleotides were purchased from Ribobio (Guangzhou, China). Primary mGCs were transfected with either oligonucleotides or plasmids using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. For each transfection, a final oligonucleotide concentration of 100 nM was used.
Western blot analysis
Total protein was isolated from mGCs that were harvested 48 h after treatment. The cells were rinsed twice with ice-cold PBS (pH 7.4) and lysed with whole lysis buffer (50 mM Tris-HCl, pH 7.6; 150 mM NaCl; and 1.0 % NP-40) containing protease inhibitor cocktail (Sigma). The protein concentrations were measured using the Pierce BCA protein assay (Thermo). Equal amounts of total protein (40 μg) were separated on a 10 % SDS-polyacrylamide gel and transferred to a polyvinylidene fluoride membrane (Millipore, Billerica, MA, USA). Immunoblotting was performed using primary antibodies against Nurr1 (1:1000; R&D Systems, Minneapolis MN, USA) and Nur77 (1:500; Santa Cruz, CA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was selected as an internal control and was visualized using rabbit anti-GAPDH IgG (1:10000; Bioworld). Immunodetection was accomplished using a goat anti-rabbit IgG (1:5000; GenScript, Piscataway, NJ, USA) or a donkey anti-goat IgG (1:5000; Santa Cruz) secondary antibody and an enhanced chemiluminescence detection kit (Millipore) with the Clinx Chemiscope 3400 Mini Western Blot Imaging System (Clinx Science Instruments, Shanghai, China). Signals from the Western blot images were quantified by measuring the optical density of each band. The blot density of the control was set as 100 %. After normalization to the corresponding GAPDH band, the relative density values of other bands were calculated by dividing the optical density values by the control value. All experiments were repeated three times.
RNA extraction and quantitative real-time PCR
Total RNA was extracted from cultured cells using the TRIzol reagent (Invitrogen). cDNA was synthesized from 1 μg of purified total RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instructions with either the random primers provided in the kit or specific reverse primers (miR-132: 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGACCATG-3', U6: 5'-AACGCTTCACGAATTTGCGT-3'). The specific primers used for real-time PCR analysis are listed in Table
1. Each 20 μL real-time PCR reaction had the following components: 2 μL of RT product (equivalent to 20 ng of total RNA), 10 μL of iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), and 250 nM forward and reverse primers. Real-time PCR for gene transcription was performed on a MyiQ Single Color Real-time PCR Detection System (Bio-Rad Laboratories). The cycle parameters for miRNAs were as follows: an initial 15 min incubation at 95 °C, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The cycle parameters for genes were as follows: an initial 3 min incubation at 95 °C, followed by 40 cycles of 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s. The data were analyzed using the 2
-ΔΔCt method [
27], and the obtained fold changes in miRNA or gene expression were normalized to U6 snRNA or 18S rRNA as endogenous controls, respectively. Each sample was analyzed in triplicate, and the experiments were repeated three times.
Table 1
Sequences of primers used for real-time PCR analysis
miR-132 | ACACTCCAGCTGGGTAACAGTCTACAGCCA | GGTGTCGTGGAGTCGGCAATTCAGTTGAG |
U6 snRNA | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
Cyp19a1
| TGTGTTGACCCTCATGAGACA | CTTGACGGATCGTTCATACTTTC |
Cyp11a1
| TCCCTGTAAATGGGGCCATAC | AGGTCCTTCAATGAGATCCCTT |
Nurr1
| GATCGAGCAGAGGAAGAC | AAGCGCATCTGGCAGCTA |
18S rRNA | ATGGCCGTTCTTAGTTGGTG | CGGACATCTAAGGGCATCAC |
Luciferase reporter assay
mGCs with a confluency of ~60 % were transfected with luciferase reporter plasmids and miR-132 mimics/inhibitors or the corresponding negative controls. All cells were co-transfected with the Renilla luciferase reporter plasmid (pRL-RSV; Promega) as a control for transfection efficiency. Luciferase activity was assayed 48 h after transfection using the Dual-Luciferase Reporter Assay System (Promega), and the ratio of firefly luciferase to Renilla luciferase was measured using a Centro XS3 LB 960 Microplate Luminometer (Berthold Technologies, Bad Wildbad, Germany). At least three transfection assays were performed to obtain statistically significant data.
Hormone assays
For hormone assays, mGCs were cultured in 12-well plates in phenol red-free DMEM/F12 (Hyclone) supplemented with 2 % C-FBS (HyClone) and 2 μM 4-androstene-3, 17-dione (Sigma). To determine the effects of 8-Br-cAMP on mGC function, mGCs were treated with medium alone or with 1 mM 8-Br-cAMP (Sigma) for 24 h or 48 h. To determine the effects of miR-132 on mGCs, the medium was changed 6 h after transfection with miR-132 mimics/inhibitors or the corresponding negative controls, and the cells were cultured for an additional 48 h. To determine the effect of Nurr1 on mGCs, siNurr1 was transfected into cells 24 h prior to the transfection of miR-132 mimics, and the cells were cultured for an additional 24 h or 48 h. Culture medium was collected at the indicated time points, and the concentrations of E2 and progesterone in the culture medium were determined using the Access Immunoassay System 2 (Beckman Coulter, Brea, CA, Germany), an automated random-access chemiluminescence-based assay. The intra- and interassay coefficients of variation were less than 10 % and 15 %, respectively. Each assay was performed in triplicate, and the experiments were repeated at least three times.
Statistical analysis
Data were expressed as the mean +/- SEM of at least three independent experiments. Student’s t-test was performed for comparisons of the mean values of two groups; one-way ANOVA was used to determine differences among the mean values of more than two groups because the quantitative data followed a normal distribution. P values less than 0.05 were considered statistically significant.
Discussion
Both FSH and LH promote intracellular cAMP in GCs via binding to their receptors [
23]. We isolated naïve GCs from immature mice and used 8-Br-cAMP to mimic the secondary messenger downstream of the FSH pathway. Our
in vitro analysis of miR-132 expression in cultured mGCs treated with 8-Br-cAMP demonstrated that miR-132 levels were significantly upregulated and peaked at 12 h (Fig.
1e). The induction of miR-132 was also observed in FSH or cAMP -treated rat GCs [
19,
20]. The treatment of mouse ovaries with an ovulatory dose of LH/hCG revealed that miR-132 was highly upregulated in periovulatory mGCs [
21]. The results of previous studies are consistent with our findings, which demonstrated that miR-132 was induced by hormonal stimulation and activation of the cAMP pathway in GCs. A previous study demonstrated that miR-132 is regulated by CREB via CRE motifs upstream of miR-132 [
31]; this finding explains the observed upregulation of miR-132 by cAMP activation in GCs. These findings also suggest that miR-132 mediates functions of the cAMP pathway during the differentiation process of GCs.
There is increasing interest in identifying the functions of miRNAs in GCs. miR-21, which in addition to miR-132 and miR-212, is an LH-induced miRNA, blocks apoptosis in mGCs [
32]. The TGF-β/Smads signaling pathway plays critical roles in early follicle development, GC proliferation and differentiation. Our previous study demonstrated that miR-145 and miR-181a suppress the proliferation of mGCs by targeting Acvr1b and Acvr2a, respectively [
25,
33]. This pathway also regulates the expression of many miRNAs, including miR-224 and miR-383 [
15,
16]. Elevated miR-224 can enhance TGF-β1-induced mGC proliferation by targeting Smad4 and ovarian E
2 release [
15], while the downregulation of miR-383 promotes steroidogenesis by targeting
RBMS1 and can be transactivated by SF-1 through direct binding to the promoter of the miR-383 host gene
SGCZ [
16]. In porcine GCs, miR-378 is spatiotemporally expressed and shows an inverse expression pattern to that of aromatase. Aromatase expression and subsequent E
2 production by GCs are directly post-transcriptionally downregulated by miR-378 [
19]. In KGN cells, overexpression of miR-132 increased E
2 levels [
22], which is consistent with our findings in mGCs. However, a study in equine follicle development found that miR-132 was increased in granulose cells from luteinizing follicles with higher progesterone and lower estradiol concentration in the follicular fluid [
34]. In preovulatory mGCs, knockdown of miR-132 failed to affect estradiol or progesterone after cAMP treatment [
21]. In a genome-scale screen of steroid hormone release influenced by miRNAs in human primary ovarian GCs, 51 miRNAs were found to suppress E
2 release, whereas none of the miRNAs (including miR-132) studied were found to have a stimulatory effect on the E
2 level [
14]. This discrepancy could be attributed to differences between species and cell models. miR-132 may exhibit diverse functions at specific stages of GCs development. Therefore, we utilized a lower plating density to retain an estrogenic phenotype of GCs. Our data suggest that E
2 production and the
Cyp19a1 mRNA levels in mGCs are elevated by miR-132 directly. Our loss-of-function study also demonstrated that the knockdown of miR-132 could downregulate the expression of
Cyp19a1. Consequently, the increased levels of miR-132 after 8-Br-cAMP treatment could contribute to the extended suppressive effect of miR-132 inhibitors on
Cyp19a1. Taken together, miR-132 was induced by cAMP and likely mediated the FSH pathway
in the primary cultured mGCs that we studied because of its stimulatory effect on E
2 synthesis. To better understand the functions of miR-132 in GCs of terminal differentiation (e.g. apoptosis), further studies are needed.
In addition, our research elucidated some of the molecular mechanisms that underlie the stimulatory effect of miR-132 on E
2 synthesis. We hypothesized that miR-132 stimulates E
2 synthesis via translational regulation of an orphan nuclear receptor
-Nurr1. Orphan nuclear receptors in the ovary, such as SF-1, which is also known as NR5A1 [
6,
35], are emerging as important ovarian factors that regulate female reproduction. The orphan nuclear receptor Nurr1 belongs to the nuclear receptor subfamily 4A (NR4A) subgroup along with Nur77 and Nor1 [
29]. The genes encoding these transcription factors are classified as immediate early response genes because their expression is rapidly induced by a variety of physiological stimuli, including fatty acids, prostaglandins, growth factors, calcium, cytokines and peptide hormones (e.g., FSH) [
36]. NUR77 is a novel transcription factor that contributes to the regulation of prolactin gene expression in human endometrial stromal cells and regulates androgen receptor gene expression in ovarian GCs [
37,
38]. Both NUR77 and NURR1 suppress the transcription of aromatase and modulate its expression in the KGN human granulosa-like tumor cell line [
29]. In a recent study of embryonic stem cell differentiation, miR-132 was demonstrated to directly regulate the expression of
Nurr1, which is an important transcription factor in dopamine neuron development and differentiation [
29]. Our study demonstrates that miR-132 suppressed Nurr1 expression by targeting its 3'-UTR (Fig.
5b). Interestingly, the Nurr1 protein levels in mGCs were dramatically decreased by the overexpression of miR-132 (Fig.
5e), whereas the
Nurr1 mRNA levels were only slightly changed (Fig.
5f). This finding indicates that in mGCs, miR-132 induces
Nurr1 translation inhibition but not mRNA degradation by binding to the 3'-UTR of
Nurr1. It has been suggested that the promoter-proximal region of the aromatase PII promoter, which contains the binding sites for SF-1 and a CLS, also mediates the transcriptional repression of NURR1 and NUR77 [
29]. However, this protein-DNA interaction might be too transient or too weak to be detected by the gel shift assay used in the previous study. The underlying mechanism by which NR4A mediates the transcriptional repression of
Cyp19a1 remains to be elucidated. In contrast to the previously reported transient peaks in NR4A expression, the cAMP-mediated induction of miR-132 resulted in a delayed elevation pattern [
29]. Conceivably, miR-132 expression could contribute to the decline of
Nurr1 and the subsequent upregulation of
Cyp19a1.
A previous study demonstrated that in neurons, miR-132 is regulated by multiple factors, such as BDNF [
39], and is required for both neuronal morphogenesis and long-term synapse activation [
28]. Some targets of miR-132, including
p250GAP [
40] and
MeCP2 [
41], have been identified. Interest in the involvement of miR-132 in endocrine biology has emerged recently. miRNA profiling in LβT2 cells exposed to gonadotropin-releasing hormone revealed the significant induction of miR-132, which subsequently regulated cellular motility [
42]. Our study suggests that miR-132 may exert differential effects on reproductive endocrine regulation (e.g., the promotion of estrogen synthesis). In light of the important roles of both miR-132 and estrogen in brain function, it would be of interest to determine whether miR-132 influences local estrogen synthesis in the nervous system. In addition, the induction of miR-132 during Kaposi’s sarcoma-associated herpes virus infection represses the expression of p300, a co-activator of CREB, which acts as part of a negative feedback loop that leads to the inhibition of miR-132 expression and the restoration of p300 expression [
43]. This regulatory network may contribute to the observed decline in miR-132 levels after peak expression is reached during cAMP treatment. The precise regulatory role of miR-132 and its functions in GCs remain to be elucidated. In addition, further
in vivo studies, such as a study using floxed miR-212/132 mice [
44] to specifically ablate miR-132 in GCs, could improve our understanding of the effect of miR-132 on E
2 synthesis. A recent study in polycystic ovary syndrome patients found that the expression levels of miRNA-132 in follicular fluid were significantly lower in patients than in controls [
22]. The dysfunctions of miR-132 in the development of polycystic ovary syndrome and premature ovarian failure are to be elucidated in future studies.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
SW, HS, GY and YH designed the study and prepared the manuscript. SW, QZ, YJ and TF performed in vitro primary GCs culture, immunofluorescence staining and immunohistochemistry. SW and YJ constructed the vectors. SW performed Western blot, and quantitative real-time PCR, and data analysis. IC assisted in data analysis and helped prepare the manuscript. All authors read and approved the final manuscript.