Background
The wall of the uterus consists of endometrium, myometrium and perimetrium (tunica serosa). The bovine endometrium is a complex tissue that comprises the tunica mucosa (lamina epithelialis and lamina propria consisting of loose connective tissue) and the tunica submucosa of the uterus. In the lamina propria, neutrophils and lymphocytes are commonly detectable. The endometritis is characterized by an increase number of inflammatory cells associated to epithelial erosion and/or necrosis and diffuse oedema of endometrium [
1]. Meta-analysis studies show that endometritis reduces pregnancy rate by 16 % [
2]. The economic losses related to this disease are substantial and associated with a great impact on the economy to drop in milk yield and calves, and treatment costs [
3]. Approximately, 80 % to 100 % of cows have intrauterine bacterial contamination in the first two weeks postpartum. In most cases, clinical disease does not develop, as the normal uterus is able to clear a bacterial infection efficiently [
4]. In 10 %-20 % of cows, however, the infection is not controlled and may lead to chronic uterine inflammation [
1,
5]. It is commonly accepted that the development of uterine infection depends on the immune response of the cow, as well as species and number of bacteria [
1]. Economically, important uterine diseases in cattle are commonly associated with bacterial infection by
Escherichia coli,
Trueperella pyogenes,
Fusobacterium necrophorum or
Prevotella species [
1,
5‐
8]. The most significant pathogenic bacteria responsible for uterine infection are
E. coli, which produce an endotoxin lipopolysaccharide (LPS) that is present in their cell wall.
Establishment of uterine bacterial infection may also depend on metabolic disease, although the specific mechanisms are still not clear or by endocrine environment, that affects the likelihood of bacteria elimination [
9‐
11].
The inflammatory response is a complex process involving many signalling cascades. In the genital tract, the initial response of the endometrium against infection is dependent on innate immunity and mucosal defence systems [
3,
12]. The uterine immune response is provided at the cellular level, by uterine leukocytes and polymorphonuclear cells that are the cells phagocytizing and clearing bacteria [
13]. In horse, at the molecular level, cytokines have a significant role in the recruitment of inflammatory cells [
14]. In cattle, interleukin-6 and TNF-α stimulate the production of antimicrobial peptides that assist in the elimination of pathogenic bacteria [
15,
16]. Moreover, bovine endometrial epithelial and stromal cells can respond to bacterial LPS through the Toll-like receptor (TLRs) [
17]. Activated TLRs subsequently stimulate the production of pro-inflammatory cytokines and chemokines [
18].
Literature on the treatment of endometritis in cattle is extensive and at times inconsistent. Specifically, uterine disease treatments aim at reverting inflammatory changes that impair fertility, whilst enhancing uterine defence and repair [
19]. In cows, many therapeutic agents and procedures have been developed to treat endometritis, including systemic or intrauterine administration of antibiotics [
20‐
22], or administration of PGF2α and its analogue [
20‐
24]. The intrauterine infusion of antiseptics (e.i. Lugol’s solution) has been tested although side-effects on future fertility of the cows have been reported [
23,
25]. Furthermore, approaches using proteolytic enzymes [
21], administration of estradiol [
26,
27] or GnRH [
28] have also been described. Even if all these treatments show some effects on uterine healing, no definitive results can be extrapolated from published clinical trials.
Platelet-rich plasma (PRP) is an emerging therapeutic application in tissue regeneration and engineering due to its enrichment in growth factors with mitogenic and anti-inflammatory potential [
29,
30]. In particular, PRP is a concentration of platelets (3-5 fold the plasma baseline level) containing transforming growth factor β1 (TGF-β1) and TGF-β2, platelet derived growth factors (PDGF-AA, PDGF-BB, PDGF-AB), insulin-like growth factor 1 (IGF-I), epidermal growth factor (EGF), vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF) and hepatocyte growth factor (HGF) that are very important for regeneration processes. Indeed, these growth factors act synergistically to increase the infiltration of neutrophils and macrophages, to promote angiogenesis, fibroplasia, matrix deposition and, ultimately, re-epithelialization, inducing the consequent tissue regeneration [
29]. Lastly, the presence of anti-inflammatory molecules, including HGF [
31] also confers on PRP the ability to suppress inflammatory process.
In this context, the specific aim of this study was to investigate the effect of PRP
in vivo and
in vitro, on a model of healthy or LPS stressed bovine endometrial cells.
In vivo, the progesterone receptor (PR) expression was detected immunohistochemically. The steroid hormone progesterone (P4) plays a key role in reproductive events associated with establishment and maintenance of pregnancy. Conceptus growth and development require the action of P4 on the uterus to regulate endometrial function, including conceptus-maternal interactions, pregnancy recognition, and uterine receptivity to implantation [
32]. Indeed, low P4 concentrations have been implicated as a causative factor in the low pregnancy rates observed in high-yielding dairy cows [
33].
In vitro, genes involved in the regulation of oestrous cycle, in pro-inflammatory process and the release of some cytokines were evaluated.
Methods
Experimental design
This study was based on three experiments. The first experiment evaluated the endometrium histologically and immunohistochemically, after in vivo PRP administration, using PR receptor as a marker of cell receptivity. The second experiment evaluated the effect of a 5 % and 10 % concentration of PRP in culture medium, on in vitro endometrial cell proliferation and on the expression of some genes involved in the regulation of oestrous cycle and fetal-maternal interaction, to establish whether it is able to improve the functions of this cell line. The genes included prostaglandin-endoperoxide synthase 2 (COX2 or PTGS2), tumor protein p53 (TP53), oestrogen receptors (ER-α and ER-β), progesterone receptor (PR) and v-myc avian myelocytomatosis viral oncogene homolog (c-Myc). The third in vitro experiment evaluated the ability of PRP to counteract an in vitro model of inflammation by stressing endometrial cells with LPS at different times and concentrations. Expression of pro-inflammatory genes and release of some cytokines were evaluated.
Materials
Chemicals were obtained from Sigma-Aldrich Chemical (Milan, Italy) unless otherwise specified. LPS was purchase by Sigma-Aldrich Chemical (E. coli 0:111B4; L2630 catalog number). Tissue culture plastic dishes were purchased from Euroclone (Milan, Italy).
Animals
All procedures were performed according to approved animal care and use protocols of the institutional ethics committee and to good veterinary practice for animal welfare as to European directive 2010/63/UE. Written farmers’ consent was obtained at the beginning of the study.
From a group of Holstein Friesian, animals at 150-180 days in milking belonging to a 180 cows dairy farm located in North Italy, 14 cows bearing a well-developed corpus luteum (CL) diagnosed by B-mode ultrasound evaluation of the ovaries, were selected. They received an i.m. luteolytic dose of PGF2α to synchronize the estrous cycle. All animals (n = 10) showed estrous signs in the following 96 hours and at that time bacteriological and cytological analyses, trans rectal and vaginal palpation, and sonography of the reproductive tract were conducted to exclude genital diseases. These animals were enrolled for the first study.
Endometrial samples for in vitro study were collected from slaughtered bovines under legal regulations
Preparation of platelet-rich plasma
Collection of blood
Blood was obtained from two donor cows at forty days in milking, as this is the period the circulating platelet count is higher than other periods (data not shown). These animals were in good health, free from infectious diseases and they did not receive medication during the previous two months. The collection of blood and the preparation of PRP, with the method of double centrifugation, were performed as reported by Lange-Consiglio et al. [
34]. After surgical scrub preparation of a few centimeters of skin around the subcutaneous mammary vein, 450 ml of blood was collected in
ad hoc Terumo blood bags (Terumo Srl, Rome, Italy) containing citrate-phosphate-dextrose-adenine (CPDA-1) using the 16-gauge needle provided with the bags. The bags were transported at 4 °C to the laboratory within 2 h of collection and immediately processed.
Double centrifugation method
All separation steps were performed under a horizontal laminar flow hood in aseptic conditions. To prepare the PRP, the blood was drawn into sterile Falcon tubes of 50 mL each (EuroClone SpA, Milan, Italy). The tubes were centrifuged at 100 x g for 30 min at 4 °C. This caused separation of the blood into three components: red blood cells at the lowest level, “buffy coat” in the middle layer, and platelet rich plasma (PRP) in the upper layer. Afterward, the PRP was carefully aspirated and distributed in new 50-ml tubes and centrifuged again at 1,500 x g for 10 min at 4 °C to obtain the platelet pellet and the poor platelet plasma (PPP) on the upper layer. Afterward, two-thirds of the volume of PPP was aspirated for later use and the pellet mixed in the residual PPP volume to allow for platelet count before the final dilution with PPP to obtain PRP at a standard concentration of 1 × 10
9 platelets/ml [
34]. All platelet counts on peripheral blood and PRP were performed using a HeCo Vet automatic hematology analyzer (SEAC, Florence, Italy). The total amount of PRP obtained for each donor was aliquoted in 10 ml ready-to-use doses that were stored in syringes. The syringes were then frozen at −80 °C and thawed at 37 °C three times [
35] to allow the release of platelet-derived factors. The PRP was subjected to aerobic and anaerobic bacteriological examination to verify its sterility. Syringes containing the PRP dose were kept frozen at −20 °C until use.
Experiment 1: in vivo effect of intrauterine administration of PRP
At day 4 post estrus, all previously selected animals were checked by ultrasound for the presence of a newly formed CL and were randomly divided in two groups. Seven cows were treated with PRP while the other seven animals were enrolled as control (CTR). Physiological solution (0.9 % NaCl) was used as placebo for these latter. Ten ml of PRP or ten ml of physiological solution were aseptically infused into the uterus by a disposable sterile catheter included in a protective sheath guided into the cervix by manipulation per rectum. To prevent transfer of vaginal flora into the uterine lumen, the protective sheath was removed just after cervix penetration and the catheter was hence introduced into corpus uteri where PRP was infused.
Endometrial biopsy
Endometrial biopsies were collected using a stainless steel Hauptner equine endometrial biopsy instrument as previously described by Chapwanya et al. [
15] and Katagiri and Takahashi [
36]. Samples were obtained just before treatment at day 4 post estrus (T0) and 7-day post treatment, that is at day 11 post estrus (T1). Briefly, after cleaning the base of tail, perineum and external genitalia, animals were given caudal epidural anesthesia (4–5 ml 2 % of lidocaine). Afterwards, the biopsy instrument included in a protective sheath was introduced into the uterus through the cervix by manipulation per rectum. Once the cervix was passed, and the protective sheath ruptured, the tip of the biopsy instrument inside the uterus was identified using the hand per rectum. Then, with the help of the hand in the rectum, the medial uterine wall was gently pressed into the instrument jaws and biopsies were taken from the dorsomedial aspect of one horn just anterior to the bifurcation. Biopsies for histology were gently removed from the biopsy instrument with a fine gauge needle and transferred to a vial of fixation solution. All biopsies were processed by the same operator. The samples were performed for histological and immunocytochemical studies.
Histological and immunohistochemical examinations
Samples were routinely formalin-fixed (10 % buffered formalin) for 48-72 hours and paraffin-wax embedded. Four-micrometer thick sections were stained with hematoxylin and eosin (HE), while others were prepared on poly-L-lysine–coated glass slides for immunohistochemistry to detect the presence of PR.
The immunohistochemical staining of all samples was performed using the avidin–biotin–peroxidase complex procedure with a commercial immunoperoxidase kit (Vectastain Standard Elite; Vector Laboratories, Inc., Burlingame, CA, USA).
Tissue sections were immersed in a pre-heated solution at 94 °C of Dewax and HIER Buffer H (Thermo Fischer Scientific, Lab Vision Corporation, Fremont, CA, USA) diluted 1:15 with deionized water for 40 minutes. This solution is designed to simultaneously dewax and perform heat induced epitope retrieval.
Endogenous peroxidase was blocked using 1 % hydrogen peroxide in Tris buffer for 45 min.
Sections were incubated for 18 hours at 4 °C with anti-PR (Thermo Fischer Scientific, Lab Vision Corporation, Fremont, CA, USA) mouse monoclonal antibodies diluted 1:400. After incubation with the secondary biotinylated anti-mouse immunoglobulin (diluted 1:200; Vector Laboratories, Inc.) for 30 min, the avidin–biotin–peroxidase complex method (Vector Laboratories, Inc.) was performed. Positive staining was visualized with 3.3-diaminobenzidine-4 HCl (Vectastain, Vector Laboratories, SK-4100) and nuclei were counterstained with Mayer’s hematoxylin. Diluent negative control sections were produced by omission of the primary antibody.
Evaluation of histological and immunohistochemical data
Tissue samples were evaluated in order to assess the absence of pathological lesions.
The immunohistochemically stained tissue slides were examined using standard light microscopy. Three randomly selected areas were evaluated per section. The staining results were independently scored semi quantitatively by different blinded operators at 400X magnification. The results of PR protein expression were assessed by categorizing immunoreaction of epithelial cells, muscular layer and glandular cells into five groups according to the percentage of positive cells. These group were: 0) no positive cells; 1) <1 % of positive cells; 2) from 1 % to 10 %; 3) from 11 % to 33 %; 4) from 34 % to 66 % and 5) from 67 % to 100 % [
37]. The intensity of labeling was graded as: weak positive staining (W); moderate positive staining (M); intense positive staining (I) and scored as follows: W = 1, M = 2, I = 3. A total score was conferred adding together the positive cells percentage score and the intensity of immunolabeling score [
37].
Experiment 2: effect of different concentrations of PRP on in vitro endometrial cells proliferation and gene expression
Tissue collection and cell isolation
Fresh bovine uteri were collected from three different cows at the slaughterhouse intended for human consumption and unrelated to our experiments. Samples were obtained from healty normal-cycling cows at diestrus stage (middle-late luteal phase). Only uteri belonging to cows with an obvious corpus luteum on the ovary were used for endometrial fragment collection and ensuing cell culture.
Endometrial samples were kept at 4 °C in saline solution supplemented with 4 μg/ml amphotericin B, 100 IU/ml penicillin-100 μg/ml streptomycin and processed within 2 h. Endometrial stromal cells were obtained according to the protocol described by Donofrio et al., [
38]. Briefly, the endometrium was digested in 25 ml of sterile filtered Hanks’ buffered salt solution supplemented with 50 mg collagenase II, 100 mg bovine serum albumin, and 10 mg DNase I for 90 minutes at 38.5 °C in a shaking bath. Then, cells were filtered with an 80-μm filter, centrifuged at 300 x g for 10 minutes, and washed twice in PBS. Before seeding, the total number of viable cells was evaluated by the exclusion method staining with trypan blue and using a Bürker chamber.
Cells expansion
A pool of endometrial stromal cells cultures from three different cows was established in Dulbecco's Modified Eagle's Medium high glucose (HG-DMEM) supplemented with 10 % FBS, 100 UI/ml penicillin–100 μg/ml streptomycin, 0.25 mg/ml amphotericin B and 2 mM L-glutamine (standard complete medium). For maintenance of cultures, cells were plated in 75 cm2 flasks (SPL Cell culture flask 70025) at up to 1x105 cells/cm2 and incubated at 38.5 °C with 5 % CO2 in a humidified atmosphere. To remove non-adherent cells, the medium was replaced for the first time after 48 h. Adherent cells were detached with 0.05 % trypsin-EDTA just prior to reaching confluence (80 %) and then reseeded for culture maintenance at the density of 1x104 cells/cm2.
Proliferation studies
All data are representative of three independent experiments.
In vitro effect of PRP on endometrial gene expression
In this study, culture medium was replaced for the first time after 48 h to remove non-adherent cells and changed with complete standard medium supplemented with two different concentrations of PRP, 5 % and 10 %, as a FBS substitute. Control cells were grown in complete standard medium supplemented with 10 % FBS. The cells were expanded for 10 passages, which was the last time point included in our study. Cells from each well were then collected to evaluate mRNA expression of genes involved in the regulation of oestrous cycle and fetal-maternal interaction by quantitative real-time PCR. The genes evaluated were prostaglandin-endoperoxide synthase 2 (COX2), tumor protein p53 (TP53), oestrogen receptors (ER-α and ER-β) and progesterone receptor (PR). The expression of c-Myc was also evaluated.
Molecular characterization of endometrial cells was performed at passages 1, 3, 5 and 10 by qualitative PCR. Data were obtained from three replicates.
Experiment 3: In vitro effect of PRP after LPS treatment on gene expression
P5 endometrial cells were plated in six well plates at a density of 50,000 cells/well in DMEM standard complete medium containing two different concentration of LPS, 10 ng/ml and 100 ng/ml. Evaluation of the expression of genes involved in inflammation was performed at 1, 6, 12, 24 and 48 h. The LPS concentrations were chosen on the base of results of Herath et al. [
39] that demonstrated level of LPS around 100 ng/ml in cows with clinical endometritis. Supernatants were collected and stored at -20 °C until being used for ELISA to measure PGE-2, IL-1β and IL-8.
To study the in vitro effect of PRP in cells inflammed with LPS, endometrial cells were treated with 10 ng/ml LPS and 5 % PRP for 1, 6, 12, 24 and 48 h. At each time point, the expression of same genes was analyzed. Data were obtained from three replicates.
Molecular characterization
Total RNA was extracted from endometrial cells using TRI Reagent Solution (Life Technologies, Monza, Italy). Samples were then treated with DNase in order to eliminate DNA contamination. RNA concentration and purity were measured by Nanodrop Spectrophotometry (NanodropH ND1000). The quality and integrity of the total RNA extracted were verified by electrophoresis on a 1.5 % (w/v) agarose gel. The cDNA was synthesized from total RNA (200 ng) using the PrimeScript RT reagent Kit (Takara Bio). Gene expression evaluation was performed using bovine specific sequences. Oligonucleotide primers were designed using open source PerlPrimer software v. 1.1.17 based on available NCBI
Bos taurus sequences or on mammal multi-aligned sequences. Primers were designed across an exon–exon junction in order to eliminate genomic DNA amplification and their sequence conditions and the references used are shown in Table
1.
Table 1
Oligonucleotide sequences used for RT-PCR analysis
Interleukin-1β (IL-1β) | TGCAGCTGGAGGAAGTAGAC | GTCGGGCATGGATCAGACAA | 60 | 338 |
Interleukin 8 (IL-8) | ACATACCCTGCCACAAGGC | TGGGGACTGCTCTTCCCTCT | 57 | 146 |
Inducible nitric oxide synthase (iNOS) | GGACCTCAACAAAGCCCTGA | CCTTGACCCAATAGCTGCCA | 60 | 293 |
Prostaglandin-endoperoxide synthase 2 (COX2) | CATGGGTGTGAAAGGGAGGAA | AAAGACGTCAGGCAGAAGGG | 60 | 700 |
Tumor protein p53 (TP53) | CCTAGGAGCACTAAGCGAGC | GCCCCTCTCTCTTGAGCATT | 55 | 268 |
Oestrogen receptor alpha (ERα) | AGGGAAGCTCCTATTTGCTCC | CGGTGGATGTGGTCCTTCTCT | 55 | 234 |
Oestrogen receptor beta (ERβ) | GCTTCGTGGAGCTCAGCCTG | AGGATCATGGCCTTGACACAG | 55 | 262 |
Progesterone receptor (PR) | GAGAGCTCATCAAGGCAATTGG | CACCATCCCTGCCAATATCTTG | 55 | 227 |
v-myc avian myelocytomatosis viral oncogene homolog (c-Myc) | GCGCCGCATTCGCGAAACTT | TGAGGGGCATCGCTGCAAGC | 58 °C | 214 |
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | ATGAGATCAAGAAGGTGGTG | CCAAATTCATTGTCGTACCAG | 60 | 190 |
Qualitative PCR analysis was performed in a 25 μl final volume with Taq DNA Polymerase recombinant commercial kit (Invitrogen Life Technologies) under the following conditions: initial denaturation at 94 °C for 2 minutes, 32 cycles at 94 °C for 30 seconds (denaturation), 55–60 °C for 30 seconds (annealing), 72 °C for 30 seconds (elongation) and final elongation at 72 °C for 10 minutes. For conventional PCR, primers were used at 200 nM final concentrations.
Quantitative PCRs were performed with SYBR green method in a MyiQ iCycler thermal cycler (Biorad). PCR reactions were carried out in triplicate for each sample. The reactions were set on a strip in a final volume of 25 μl by mixing, for each sample, 1 μl of cDNA, 12.5 μl of 2X concentrated SYBR Premix Ex Taq II (Takara Bio) containing SYBR Green as a fluorescent intercalating agent, 0.2 μg forward primer, 0.2 μg of reverse primer and MQ water. PCR efficiencies were tested and found to be close to 1. The thermal profile for all reactions was 30 seconds at 95 °C and then 40 cycles of 5 seconds at 95 °C, 30 seconds at 60 °C. Fluorescence monitoring occurred at the end of each cycle. Efficiency of amplification for each primer was monitored through the analysis of serial dilution. Additional dissociation curve analysis was performed and in all cases showed a single peak. The data thus obtained were analyzed using the iQ5 optical system software version 2.0 (BioRad). The expression of each gene was normalized to the reference gene glyceraldehyde-3-phosphate dehydrogenase (
GAPDH) (internal control) in order to standardize the results by eliminating variation in cDNA quantity. Such gene was identified among others used as endogenous control genes based on previous studies focusing on endometrial gene expression [
40]. Relative gene expressions were presented with the 2
−ΔΔCt method [
41].
Protein release by ELISA
Protein release (PGE-2, IL-1β and IL-8) was measured in cell-free supernatants obtained by centrifugation at 250 x g for 5 min and stored at −80 °C until measurement. Protein production was assessed according to the manufacturers’ instructions (Bovine PGE-2 MBS737103, MyBioSource; Bovine IL-1β Screening Set ESS0027, Thermo Fisher Scientific; CXCL8/IL-8 DuoSet DY208, R&D Systems). The Human CXCL8/IL-8 DuoSet was previously validated for measurement of bovine IL-8 [
42]. The limits of detection for PGE-2, IL-ß and IL-8 were 1.0, 20.1 and 14.3 pg/ml, respectively.
Results are expressed in pg/ml.
Statistical analysis
Statistical analysis was performed using GraphPad Instat Software version 3.00 for Windows (La Jolla, CA, US). For proliferation data, three replicates for each experiment were performed. Results are reported as mean ± standard deviation (SD). One-way analysis of variance (ANOVA) for multiple comparisons by Student-Newman-Keuls multiple comparison tests was used.
Immunohistochemical data were analyzed by unpaired Student's t-test.
For cytokines, statistical differences were determined using ANOVA followed by Dunnett's multiple comparison test, the Tukey–Kramer multiple comparisons test or unpaired t test.
Differences were considered statistically significant for P values < 0.05.
For quantitative PCR data, non-parametric tests were used. The Mann-Whitney U-test was employed to compare two groups (treated vs untreated). Results were considered significant if the value of P was < 0.01.
Discussion
In the present study, the effect of PRP has been investigated
in vivo on healthy animals (without endometrial infection) and in an
in vitro model where bovine endometrial cells were stressed with LPS. After
in vivo application, our results delineate a trend showing that,
in vivo, PR expression was detected with a similar average score in all the animals at T0. At T1 in epithelial cells, PR average scores in control and PRP animals remain unchanged. In glandular epithelium and smooth muscle cells, at T1, PR expression increases in PRP animals. These results have to be further explored but may indicate that PRP might be helpful in maintaining and/or increasing the number of progesterone receptors in uterine tissues. In our
in vitro experiment, bovine endometrial cells were cultured with two different concentrations of PRP (5 % and 10 %) and mRNA levels of different genes were quantified and compared to control cells, cultured with 10 % FBS only. Various research groups have studied the use of PRP as a supplement of cell culture [
43‐
45] demonstrating that PRP increases cell proliferation. PRP confirmed this effect also on endometrial cells, mainly at the concentration of 5 %. This concentration of PRP sustained the shortest population doubling time at P5 while the highest concentration (10 %) inhibited proliferation rate, leading to speculate that this effect may be due to an excess of growth factors. This data was confirmed by growth curve study with 5 % of PRP at different passages. According to this, at P5, 5 % of PRP induced an intensive endometrial cells proliferation. Regarding gene expression, the presence of 5 % of PRP at P5 induced also an up-regulation of the expression of
COX2,
TP53,
ER-α,
ER-β and
PR. To test the release of some proteins, we evaluated the secretion of prostaglandin E2 (PGE2). Indeed, it is known that in the bovine uterus, COX2 converts arachidonic acid to prostaglandin H2, which is then converted, by PGE synthase and PGF synthase, to PGE-2 [
46]. In these cells, PGE-2 production was modulated in parallel with
COX2 expression in all conditions. This is the first study reporting the effects of PRP on the proliferation and gene expression of bovine endometrial cells
in vitro and further studies are required to elucidate the mechanisms through which the PRP up-regulates these genes. Although, the molecular mechanisms involved in this up-regulation are not clear, is conceivable that PRP-derived growth factors play an important role. Indeed, the expression of
c-Myc, that was up-regulated in this study and which is involved in cell proliferation and growth, is activated by EGF that is a component of PRP [
29].
In our study, we even further tested the hypothesis that PRP has anti-inflammatory properties and is able to influence gene expression of pro-inflammatory factors in an in vitro model of inflammation. To develop an in vitro cell culture system with stressed cells and to study gene response, endometrial cells were exposed to the bacterial endotoxin LPS before and after the treatment with PRP. Exposure of endometrial cells to 10 ng/ml LPS resulted in marked changes in the expression of pro-inflammatory genes that was reduced by the addition of 5 % of PRP. The presence of PRP ameliorated the LPS-induced molecular changes in endometrial cells as they increased the levels of gene expression of IL-1β, IL-8, iNOS and COX2 expression. In parallel with gene expression, the release of some proteins was studied confirming the observations regarding gene regulations. LPS demonstrates to be capable of inducing the release of PGE-2, IL-1β and IL-8 whose pick were obtained 1 h and 12-24 h, after stimulation with LPS. PRP reduce the release of these proteins-and the maximum modulatory activity was observed immediately after 1 h for PGE-2 and IL-1β, and between 12 h and 24 h for IL-8. Therefore, our results indicated consistent anti-inflammatory effect of PRP.
How can we explain these results? Recent literature demonstrates the healing potential of autologous platelet-rich plasma in human medicine, including maxillofacial surgery, dental implant surgery, orthopedic surgery, bone reconstruction, muscle and tendon repair, reversal of skin ulcers, retinal hole repair in eye surgery, and cosmetic surgery [
29]. In veterinary medicine, little clinical information exists about its application. PRP is mainly used for equine tendon repair [
47] although its application has also been reported for intestinal wound healing in pigs [
48] and for the treatment of a large cutaneous lesion in a dog [
49]. Recently, our group has proposed its use as an alternative therapy for bovine mastitis and for repeat breeder cows syndrome, showing promising results [
32,
50]. Indeed, in acute mastitis, the treatment with only PRP did not show statistically significant differences compared to antibiotic alone or treatment with PRP combined to antibiotic, but it was better than the use of only antibiotic for chronic mastitis [
32]. In repeat breeder treatment, after intrauterine administration of PRP the percentage of pregnant cows was 70 % compared to control group, treated with physiological solution, where the rate was 33.33 %. Moreover, immunohistochemical study, by the nuclear antigen Ki-67, a marker of cell proliferation, showed more proliferating nuclei in the treated uterine horn, after three days of administration, compared to the control one [
50]. In tissues with a high proliferative rate, Ki-67 is expressed in all cell cycle phases except for the resting or G0 phases [
51,
52] and reaches a maximum level during G2 and M [
53]. Since Ki-67 was significantly more expressed in uterine horns treated with PRP, Lange-Consiglio et al. [
50] supposed that the growth factors released by platelets in the PRP might have had an effect on endometrial cell proliferation. Indeed, in all treated horns there were statistically more proliferating nuclei compared to the controls. Also in our
in vitro study, PRP induce cell proliferation confirming these previous results [
50], but a longer
in vitro culture time (P5) is necessary to stimulate a good proliferation rate. It is difficult to explain the different times of PRP efficacy between
in vivo and
in vitro study, probably they are mainly due to the different doses used.
After the study with PRP on repeat breeder cows, our group tried to test the effect of PRP on
in vitro endometrial stressed cells by LPS. Results showed that LPS provoked a rapid increase in endometrial mRNA expression and release of IL-1β and IL-8. Previous studies have shown that bovine endometrium expresses the TLR-4/CD14/MD-2 receptor complex in both epithelial and stromal cells [
17,
18,
54]. This is a key component of the innate immune system, which is necessary to detect LPS. Subsequent activation of TLR4 triggers the production of cytokines, particularly IL-1β and chemokine IL-8 in bovine endometrium. Accordingly, after LPS treatment, we found an immediate rapid rise in
IL-1β expression, which had already peaked by 1 h, and had been followed by a rise in
IL-8 expression, with a significant up-regulation at 6 h and 12 h. These waves of cytokine gene activation, short for
IL-1β and prolonged for
IL-8 until 12 h, are supported by data of DeForge and Remick [
55] that studied the kinetics of these cytokines in LPS-stimulated human whole blood as an
ex vivo model of sepsis. LPS also induces an inflammatory response characterized by the increased expression of
iNOS and
COX2 and stimulates the secretion of PGE, as demonstrated also by Herath et al. [
56]. Prostaglandins, produced by the uterine endometrium, have multiple roles in endometrial function [
46]. Indeed, they are key regulators of several reproductive events, including estrous cycle, implantation, pregnancy maintenance and parturition. The release of PGE-2 induced by 5 % of PRP could support these events. In addition, PGE has an important role in the mammalian immune response, acting through prostaglandin E receptors 2 and 4 (PTGER2 and PTGER4) to control inflammation [
3]. Instead, the intensive LPS-induced PGE secretion by endometrial cells may impair fertility. In fact, this has been suggested as a pathogenic mechanism after uterine bacterial infection, which could result in an extended luteal phase and thus contribute to an impaired reproductive performance. According to this,
COX2 was greatly up-regulated in the present study by LPS. Regarding the inducible iNOS, it is the main isoenzyme governing the production of NO, and it is considered an important mediator of cellular interactions and a potent regulator of many local processes [
57]. iNOS is typically expressed at the sites of inflammation, produces large amounts of NO for a prolonged time and is usually related to the activation of pro-inflammatory macrophages [
58]. In this context, our findings showed a significantly higher expression of
iNOS in cells cultured in presence of LPS. This gene returned nearly to baseline within 48 h, supporting the idea that the inflammatory process is controlled by negative feedback regulation in order to eliminate excessive tissue inflammation and damage [
59].
The treatment with 5 % of PRP, after LPS action, down-regulated the expression of all pro-inflammatory genes. The inhibition of NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activation could be a possible mechanism through which PRP exerted these anti-inflammatory effects. Within mammalian cells, including endometrial cells, NF-kB is present in an inactive status [
60]. It regulates more than 150 genes, including those involved in inflammation and other immune responses [
61]. Upon phosphorylation, it translocates into the nucleus [
62] by the interaction of specific receptors on the surface of a cell, and it triggers the inflammatory cascade. In particular, LPS is reported to bind the surface antigen CD44 and induce the translocation of the phosphorylated Nf-kB to the nuclei leading to the increase of pro-inflammatory gene levels [
63]. Numerous studies demonstrated that PRP inhibited the translocation of NF-kB to the nucleus [
31,
64]. Between different growth factors, indeed, the HGF is described to disrupt the transactivacting activity of NF-kB, with its retention in the cytosol [
31].
Based on these results, it would be interesting to explore the mechanisms through which the PRP induces up-regulation of COX2, TP53, ER-α, ER-β and PR genes and to perform in vivo investigation on the potential application of PRP in the treatment of bovine endometritis. Indeed, considering the results obtained in our in vivo and in vitro studies, it might be possible to envisage treatment of endometritis with PRP combined with administration of exogenous P4. This combination, using intravaginal P4 devices, may improve the fertility in bovine with inadequate circulating P4 concentrations. In this way, at the same time, it would be possible to increase circulating P4 concentration and endometrial PR.