Background
Esophageal cancer is the eighth most frequently diagnosed cancer and the sixth most common cause of cancer-related death in the world [
1,
2]. Radiation therapy (RT) plays a crucial role in the treatment of esophageal cancer [
3]. Although complex multidisciplinary treatment, especially the concurrent chemoradiotherapy, has recently become a common practice, the rate of local recurrence and distant metastasis remains high [
4,
5]. Acquired radioresistance during radiotherapy has been considered as one of the most important reasons for treatment failure [
6].
Epithelial to mesenchymal transition (EMT) is a fundamental biological process during which epithelial cells lose their polarity and change to a mesenchymal phenotype [
7]. The roles of EMT in tumor invasion, metastasis, chemotherapy resistance and cancer stem cells have been investigated intensively [
8-
11]. Emerging evidence suggests that EMT plays an important role in cancer radiation resistance [
12,
13]. Many radioresistant cancer cells demonstrated epithelial-mesenchymal transition (EMT), which was believed to link to adaptation to hypoxia, enhanced DNA repair ability and activated growth factor pathways [
14-
17]. However, the role of EMT in radioresistant acquirement during the radiotherapy of esophageal cancer remains unclear.
Previously, we found that the Wnt/β-catenin pathway may be the most important signaling pathway involved in this process based on cDNA microarray analysis of the KYSE-150R cell line [
18,
19]. In this study, we tested the hypothesis that EMT was involved in the acquired radioresistance of esophageal cancer cells via Wnt/β-catenin pathway. Our results indicated that KYSE-150R cell line displayed obvious radiation resistance and demonstrated an EMT-like phenotype together with the abnormal activation of Wnt/β-catenin signal pathway compared with parental cell line. Using the β-Catenin/Tcf inhibitor FH535, the expression of Wnt/β-catenin pathway proteins as well as EMT phenotypes were reduced, and at the same time, radiosensitivity was greatly increased.
Methods
Cell culture and reagents
Human esophageal squamous cancer cell line KYSE-150 were purchased from the American Type Culture Collection (Manassas, VA). Radioresistant cell line KYSE-150R was previously established in our department with gradient dose irradiation [
18,
19]. Both KYSE-150 and KYSE-150R were cultured in RPMI-1640 (Gibco, Life Technologies Inc., Grand Island, NY) with 100 unit/ml of penicillin, 100 mg/ml of streptomycin, and 10% fetal bovine serum at 37°C in a humidified incubator containing 5% CO
2. The cell lines were sub-cultured every 2 to 3 days following digestion at room temperature with 0.5 ml trypsin/EDTA per well (Sigma-Aldrich Ltd, UK). The viability was reported as the percentage of the viable cells number to the total cells number. There was an average viability of over 95% determined by Trypan Blue staining. FH535 was purchased from Calbiochem (merck), and dissolved in DMSO at a concentration of 10 mM.
Western blotting
Total proteins were extracted from the two cells groups (KYSE-150 and KYSE-150R) in the exponential growth phase using the cell lysis buffer, which containing 20 mM Tris (pH 7.5), 150 mM NaCl, 1% Triton X-100, 1 mM EGTA, 1 mM EDTA, 1 mM PMSF, and protease inhibitor cocktail (Merck Millipore, Darmstadt, Germany). Nuclear and cytoplasmic proteins were isolated using Nuclear and Cytoplasmic Protein Extraction Kit (Sangon Biotech, Shanghai, China). Protein content was measured using the Bradford protein assay. Samples were denatured at 100°C for 10 minutes. Thirty microgram proteins were separated by 8% or 10% SDS polyacrylamide gels and transferred to nitrocellulose membrane (0.45 μm; Bio-Rad). Incubation with 5% nonfat dry milk in TBS-Tween 20 (TBST) for 2 h at room temperature was conducted to block nonspecific binding sites. Subsequently, membranes were incubated with rabbit antibodies against β-catenin (H-102) (1:500) (ab2365, Cambridge, Mass., USA), Beta-Catenin Phospho (pS33/S37) (1:1,000) (9561 s, Cell Signaling Technology Danvers, USA), GSK3β (1:1,000) (1561–1, Epitomics, Inc., Burlingame, Calif., USA). P-GSK3β (1:1,000) (2435–1, Epitomics, Inc., Burlingame, Calif., USA)., Slug (1:1,000) (T0587, Epitomics, Inc., Burlingame, Calif., USA).E-Cadherin (1:1,000) (ab53033, Cambridge, Mass., USA), Vimentin (R28) (1:1,000) (#3932, Cell Signaling Technology Danvers, USA) and Cyclin D1 (1:1,000) (#2922, Cell Signaling Technology Danvers, USA) overnight at 4°C. Incubation with mouse antibodies against β-actin (1:10,000) (ab8226, Cambridge, Mass., USA) and GAPDH (1:4,000) (sc-32233, Santa Cruz, Calif., USA) were conducted for normalization control. After washing, membranes were again incubated with HRP-conjugated secondary antibodies (anti-mouse and anti-rabbit, 1:5,000) for 1 hour at room temperature. Membranes were then treated with enhanced chemiluminescence (ECL, Pierce, Thermo, USA) after washing. Proteins were visualized with ECL and Kodak film exposed for one minute without light. The relative band intensity was determined by Gel-Pro Analyzer 3.1 software (Media Cybernetics).
Quantitative real-time RT-PCR analysis
Total RNA was extracted from the two cell groups (KYSE-150 and KYSE-150R) using Trizol Reagent (Invitrogen) according to the manufacture’s protocol and reversely transcribed into cDNA using Revert Aid First Strand cDNA Synthesis Kit (Fermentas, Thermo Scientific, USA). SYBR Green (ABI) PCR was performed in triplicate using the ABI PRISM 7300 Sequence Detection System. All samples were normalized to the signal generated from β-actin and GAPDH (Sangon Biotech, Shanghai, China). Primer sequences of Wnt pathway and EMT associated genes were presented in Table
1 Data was shown as fold change (2
−ΔΔCt) and analyzed initially using Opticon Monitor Analysis Software V2.02 (MJ Research, Waltham, MA, USA). Triplicates were run for each sample in three independent experiments.
Table 1
Primer sequences of Wnt pathway and EMT associated genes
β-actin | AAAGACCTGTACGCCAACAC | GTCATACTCCTGCTTGCTGAT |
GAPDH | TCCCATCACCATCTTCCAGG | GATGACCCTTTTGGCTCCC |
Cyclin D1 | GCATCTACACCGACAACTCCA | GGCACAGAGGGCAACGA |
E-cadherin | GAGAACGCATTGCCACATACA | GCGATGGCGGCATTGTA |
Vimentin | CCAGATGCGTGAAATGGAA | TGGGTATCAACCAGAGGGAGT |
Snail | CCCAATCGGAAGCCTAACTAC | AGCCTTTCCCACTGTCCTCA |
Slug | TCCTGGTCAAGAAGCATTTCA | GGAGCAGCGGTAGTCCACA |
Twist | CATGTCCGCGTCCCACTAG | CCACGCCCTGTTTCTTTGA |
GSK3β | TGGCTACCATCCTTATTCCTCC | CCACGGTCTCCAGTATTAGCATC |
FZD1 | AAACAGCACAGGTTCTGCAAAA | TGGGCCCTCTCGTTCCTT |
FZD2 | TCCATCTGGTGGGTGATTCTG | CTCGTGGCCCCACTTCATT |
FZD3 | GCCTATAGCGAGTGTTCAAAACTCA | TGGAAACCTACTGCACTCCATATCT |
FZD4 | GCCCCAGAACGACCACAA | GGGCAAGGGAACCTCTTCAT |
β-catenin | GCCAAGTGGGTGGTATAGAGG | GCGGGACAAAGGGCAAGA |
Immunofluorescence staining and confocal microscopy
KYRE-150R Cells were grown on covered slips and treated with 20 μM FH535 (purchased from Calbiochem and dissolved in DMSO) for 24 h. After washing three times with PBS, cells were fixed in 4% paraformaldehyde (Solarbio, Beijing, China) for 20 min at room temperature. The fixed cells were permeabilized with PBS containing 0.3% Triton X-100 (Solarbio, Beijing, China) for 20 min. Then, the cells were soaked in 10% normal goat serum (Solarbio, Beijing, China) with PBS for 30 min. The cells were then incubated with various primary antibodies (β-catenin, E-cadherin, Vimentin,1:200 dilutions) overnight at 4°C. After rinsing in PBS, the cells were then incubated with Alexa Flura® 488 conjugated, goat anti-rabbit IgG (H + L) (Thermo Scientific, Waltham, USA) at 1: 1000 dilution for 1 hr at 37°C at a dark condition. The nuclei were visualized by 1 μg/ml DAPI (Beyotime, Shanghai, China) and incubate for 5 min at room temperature. Images were obtained using a DM4000B Automated Upright Microscope System (Leica, Wetzlar, Germany).
Cell viability assay
KYSE-150R cells, 1x10E3 cells/well, were seeded in a 96-well plate. After an overnight incubation, the cells were subcultured in three groups including: FH535 treated in different concentrations (5 μM, 10 μM, 15 μM, 20 μM), DMSO treated with the same volume as FH535 for 24 hours, and irradiation treated with a dose of 8 Gy high energy X-ray from a linear accelerator (Vairan 2300C/D, Salt Lake, USA). Cell counting kit-8 (CCK-8) assays (Dojindo) were performed following the protocol of the kits. Results were measured according to the absorbance at 450 nm using a microplate reader (Thermo Scientific Varioskan Flash, USA).
Clonogenic assay
KYSE-150R cells, 1 × 103 cells/well, in the exponential growth period were seeded in a 6-well plate for 24 h. FH535 was added with a concentrations of 20 μM for the following 24 hours. Then, the radioresistant KYSE-150R cells were irradiated by doses of 0, 2, 4, 6, 8, or 10 Gy with X-ray from a linear accelerator (Vairan 2300C/D, Salt Lake, USA) at an average dose rate of 100 cGy/min. Immediately following the irradiation, the cells were incubated for 10 days at 37°C in a 5% CO2 environment to allow the colony formation and then fixed with pure ethanol. Visible colonies consisting of at least 50 cells were stained with 0.5% crystal violet (Sigma, Germany) and counted. The surviving fraction (SF) were estimated.
Comet assay
Neutral comet assay method was used to detect the DNA fragmentation associated with apoptosis. KYSE-150R cells were seeded at 2 × 105 cells/well into 6-well plates and incubated overnight. From the three cell samples, two samples were then treated with 20 μM FH535 and DMSO for 24 hours, respectively. The other KYSE-150R sample were treated with 8 Gy irradiation. The Cells were collected and suspended in PBS with a concentration of 5 × 105 cells/mL. To prepare the slide, the cell suspension (10 μl) was mixed with 90 μl of 0.75% low temperature melting agarose (LMA) in PBS at 37°C and pipetted onto fully frosted slides, which precoated with a layer of 100 μl 1% normal temperature melting agarose (NMA) in PBS. After gelling for 10 minutes at 4°C, the coverslip was gently removed. All the processes were conducted at a dark condition. The slides were placed in precooled lysis solution (2 M NaCl, 30 mM Na2EDTA, 10 mM Tris, 1% N-Lauroylsarcosine Sodium Salt, pH 8.2-8.5, supplemented with 10% DMSO and 1% Triton X-100) at 4 °C for 2 hours, and then placed in TBE (0.4 mM Na2EDTA, 18 mM Tris, 18 mM boronic acid, pH 8.2-8.5) at 4°C for 30 minutes twice. Electrophoresis was performed for 20 minutes at 25 V (10 mA) in TBE solution after unwinding. Slides were stained with propidium iodide (PI) (5 ug/ml) for 10 minutes and covered with a coverslip. Microscopic analysis were conducted using a fluorescence microscope (Leica DM2500, Germany) equipped with a CCD camera. Non-overlapping cells were captured at 400 magnification. At least 100 cells per slide were analyzed using the Comet Assay Software Project (CASP). A measurement of olive tail moment (OTM) was used to quantify the extent of DNA damage.
Statistical analysis
The results were described as mean plus standard deviation (SD) for triplicate measurements. Statistically significant differences between groups were estimated by Student’s t test using SPSS (13.0). P < 0.05 was considered statistically significance.
Discussion
In this study, the roles of EMT and Wnt/β-catenin signaling pathway in radioresistance were investigated in a radioresistant esophageal cancer cell line (KYSE-150R) that showed a decrease in growth rate and significantly increase in clonogenic survival compared to its parental cells after irradiation. Phenotypic changes similar to EMT and activation of the Wnt/β-catenin signaling pathway were observed in KYSE-150R cells compared to its parental cells.
EMT-like phenotype and its close relationship with radioresistance have been investigated in breast carcinoma and lung carcinoma cells [
15,
16,
20]. It has also been reported that radioresistance associated with EMT and enhanced cancer stem cell phenotypes in prostate cancer [
21]. Consistently, in the present study, EMT-like phenotype was also discovered in the radioresistant esophageal cancer cells (KYSE-150R) with irregular shape and a loss of cell-cell adhesion. Further RT-PCR results with the significant decrease of E-cadherin and increase of snail and twist expressions confirmed the presence of EMT.
Wnt family proteins consist of two subfamilies based on downstream intracellular signaling. The canonical Wnt pathway stabilizes β-catenin and activates target genes via TCF/Lef transcription factors. Wu et al. demonstrated that the increase of Wnt3 promoted a partial epithelial-to-mesenchymal transition presenting with increased N-cadherin, Twist, Slug and decreased E-cadherin [
22]. Knockdown of Wnt3 by siRNA decreased the EMT markers, increased E-cadherin expression, and inhibited the cell invasiveness [
22]. Zhao et al. discovered that overexpression of HIF-1α, which stimulated the invasion potency of human prostate carcinoma cells through EMT and Wnt/β-catenin signaling pathway, might be a necessary endogenous signal [
23]. In this study, significantly up-regulated expressions of Wnt1, FZD1-4, GSK3β, CTNNB1 and Cyclin D1, as well as increase in phosphorylation of GSK3β and decrease of β-catenin were observed in the radioresistant esophageal cancer KYSE-150R cells, implicating the activation of the Wnt/β-catenin signaling pathway. Similarly, several studies suggested that aberrant activation of canonical Wnt/β-catenin signaling after long-term exposure to fractionated irradiation was associated with the development of radioresistance in many human cancers [
24,
25].
In the present study, a reversible Wnt pathway inhibitor, FH535, was used to further investigate the relationship between the activation of the Wnt/β-catenin signaling pathway and EMT phenotype change in esophageal cancer radioresistance. Previous studies have shown that FH535 is a synthetic inhibitor of the canonical Wnt/β-catenin signaling pathway [
26]. It significantly inhibits the growth of the cells of breast cancer, colon cancer, lung cancer, and hepatocellular carcinoma, but not normal fibroblasts [
27]. Consistently, the expression of Wnt/β-catenin pathway protein as well as EMT phenotypes in KYSE-150R cells were reduced with the treatment of FH535 in this study. At the same time, radiosensitivity of KYSE-150R cells was greatly increased. These results indicated that radioresistance in KYSE-150R cells can be reverted via EMT reversal and down-regulation of Wnt/β-catenin pathway with FH535 treatment.
Recent studies have shown that several small molecular inhibitors can enhance radioresistivity by interfering the Wnt/β-catenin pathway, such as GDK-100017. GDK-100017 is a small inhibitor that can reduce TCF/LEF dependent transcriptional activity and possesses potential anti-cancer activity against human non-small cell lung cancer (NSCLC) by inhibiting the Wnt/β-catenin pathway to enhance the radiosensitivity [
28]. Interestingly, in our study, FH535 not only acted as a potential radiosensitizer by blocking the Wnt/β-catenin pathway, but also effectively suppressed EMT. This mechanism was also observed in NSCLC in which FH535 could reverse the phenotype of TGF-b1-induced EMT, which is a potential treatment target for EMT reversal [
29].
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
CX contributed experimental design; HS, YF, LZ, XZ and LS performed the biological experiments; CX and XJ provided administrative support and funded experiments; HS, BL, HP, LL and CL analysis of data; HS, XJ and CX drafted the manuscript. All the authors have read and approved the final manuscript.