Background
α7 nicotinic acetylcholine receptors (nAChRs) are widely distributed throughout the central nervous system (CNS) and periphery [
1]. Within the CNS, these receptors are expressed in neurons and glial cells and are actively involved in learning, memory, and attention [
2]. Observations from neuronal cell lines, primary neuron cultures, and transgenic mice with deleted α7 nAChR indicate that agonists of these receptors, including galantamine (an allosteric modulator), PNU-282987, TC-1698, and GTS21 (3-[2,4-dimethoxybenzylidene]anabaseine), provide neuroprotection against toxicity induced by various insults such as amyloid-beta, glutamate, okadaic acid, and ethanol which are reversed by α7 nAChR antagonists such as methyllycaconitine (MLA) or α-bungarotoxin [
3‐
10]. Therefore, α7 nAChRs are of great interest as potential therapeutic target in various neurodegenerative diseases.
While the neuroprotective role of α7 nAChRs is well characterized, limited evidence exists regarding the potential anti-inflammatory properties of these receptors in astrocytes. Functional α7 nAChRs are reported to be present on astrocytes, which upon activation increase intracellular calcium levels [
11]. Some preliminary data point towards potential anti-inflammatory effects mediated through α7 nAChRs expressed in astrocytes. Liu et al. demonstrated that activation of astroglial α7 nAChRs may provide protection against degeneration of dopaminergic neurons by inhibition of MPTP (in vivo)- and MPP+- or LPS (in vitro)-induced astrogliosis in Parkinson’s disease [
12]. However, the molecular mechanism of the observed anti-inflammatory response of α7 nAChR and resultant neuroprotection has not been studied. In non-neuronal cells such as monocytes and macrophages, anti-inflammatory properties of α7 nAChRs are reported to be mediated through inhibition of the NF-κB pathway [
13,
14]. More recently, it has been demonstrated that activation of α7 nAChRs in glial cells leads to blocking of the NF-κB pathway and a consequent reduction in neuroinflammation [
15]. Another emerging mechanism that may explain α7 nAChR-mediated neuroprotection is the Nrf2 pathway. Nrf2 is a member of the NF-E2 family of basic region leucine-zipper transcription factors and responds to oxidative and electrophilic stress by regulating antioxidant responsive genes. Recent evidence from rat organotypic hippocampal slice culture suggests that α7 nAChR agonists induce heme oxygenase 1 via the Nrf2 pathway in a brain ischemic model, which provides neuroprotection [
16].
Evaluating the potential role of astroglial α7 nAChRs is critical because astrocytes are the most abundant cell type in the brain, representing 20–40% of the brain cells. Astrocytes are increasingly being recognized as important mediators of neuroinflammation and consequent cognitive impairment [
17,
18]. Therefore, targeting astroglial α7 nAChRs for their neuroprotective properties may be important in guiding development of disease modifying treatments for various neurodegenerative diseases. Thus, we used in vitro and in vivo models of neuroinflammation to elucidate the molecular mechanism for anti-inflammatory and antioxidant properties of α7 nAChRs activation in astrocytes, based on the hypothesis that the crosstalk between the NF-κB and Nrf2 pathways mediates these effects.
Methods
Cell culture
Astrocytes were purified from cortices of postnatal day 2 C57BL/6 mouse pups using a shaking method described by McCarthy and de Villis [
19]. Briefly, we first dissected the cortical tissues and then removed the meninges. The tissues were then centrifuged and washed with cold Hank’s Balanced Salt Solution (HBSS). Tissue dissociation was performed using Papain-based Neural Tissue Dissociation Kit (Miltenyi Biotec, Inc.).Tissues were further incubated with DNAse and mixed until well dissociated. After dissociation, cells were filtered, centrifuged, and resuspended in DMEM supplemented with 20% fetal bovine serum (FBS), penicillin, and streptomycin. Finally, cells were counted and plated in poly-D-lysine coated T-75 cm
2 flasks. Medium was replaced after 4–5 h and then every 3 days. After 8 days in culture, flasks were shaken on an orbital shaker for 18–20 h at 200 rpm to release microglia and oligodendrocytes from the mixed cultures. Purified astrocytes were then trypsinized and replated for assay.
Neurons were isolated from embryonic day 16–18 mouse brains. Brains were first collected in a 100-cm petri dish filled with cold HBSS. Next, the brainstem and meninges were removed using a dissecting microscope. Then, cortices were dissected and collected in 15 ml conical tube with HBSS. Cortical tissues were washed with cold sterile HBSS twice followed by addition of trypsin. Tissues were incubated with trypsin at 37 °C for 20 min. After incubation, DNAse I was added to tissue for 30 s. To meet the special cell culture requirements of pre-natal and embryonic neuronal cells, dissociated cells were filtered and plated in neurobasal medium (Gibco, catalog no. 21103, with 2% B27 (Gibco, catalog no. 17504-044), 1% glutamax (Gibco, catalog no. 35050), and 10 units/ml penicillin streptomycin (Gibco, catalog no. 15140-148).
Astrocyte treatment paradigm
Astrocytes were plated in 24 well plates at the density of 100,000 cells/well in DMEM with 20% FBS medium for 24 h. Cells were serum starved before adding compounds. Cells were then stimulated with or without 60 ng/ml LPS (Sigma, L6529) in the presence or absence of different doses of GTS21 (Sigma) to measure cytokine levels.
α7 nAchR gene knockdown with short hairpin RNA
Astrocytes were transduced with either lenti short hairpin (sh)-RNA for α7 nAchR or scrambled shRNA in 6-well plate for 7 days. Two different sequences of 29mer α7 nAchR-specific shRNA were used (GCCAACGACTCGCAGCCGCTCACCGTGTA, CTTGGAATAACTGTCTTACTTTCTCTGAC) to maximize knockdown efficiency. Knockdown efficiency was determined using qRT-PCR with TaqMan probes specific for α7 nAchR (Assay ID; Mm01312230_m1). Next, the cells were treated with LPS (60 ng/ml) in the presence or absence of 30 μm GTS-21. After treatment, RNA was isolated from each condition and TNF levels were measured.
Measurement of secreted TNF-α and IL-6 using enzyme-linked immunosorbent assay (ELISA)
TNF-α secretion was measured in purified astrocyte cultures treated with LPS in the presence or absence of GTS21. GTS21 pretreatment was done for 1 h followed by 24 h of LPS treatment. Following the treatment, cell-free culture medium was collected and TNF-α and IL-6 were measured using a commercially available mouse colorimetric ELISA assay (eBiosciences) following the manufacturer’s protocol.
Immunocytochemistry
For immunofluorescence, purified astrocytes were plated for 24 h and fixed with 4% paraformaldehyde for 15 min and washed three times with PBS. After fixation, cells were permeablized with 1× GDB buffer (Gelatin Solution, 0.3% Triton X-100, Phosphate Buffer, NaCl). Cells were then incubated with anti-GFAP antibody (Sigma, G6171) and anti- NF-κB antibody (Abcam, ab16502) overnight at 4 °C, followed by washing three times with PBS and 1 h incubation of Alexa-488 or 594 conjugated secondary antibody (Thermofisher). DAPI (Thermofisher) was used as nuclear stain.
For α-bungarotoxin labeling, primary astrocytes were plated in 96-well plate at 20,000 cells per well for 24 h. Thereafter, cells were pretreated with 200 μm nicotine for 15 min followed by treatment with Alexa Fluor 488-conjugated α-bungarotoxin (B13422, Thermofisher Scientific) at 4 °C for 15 min. Immediately following incubation, these cells were washed with PBS three times and then fixed for 15 min in 4% paraformaldehyde at room temperature. After fixation, cells were washed twice with PBS and examined under a fluorescent microscope.
Immunostaining quantitation
Images were captured and analyzed using Cellomics ArrayScan XTI high-content analysis system. This system contains high-resolution photometrics X1 CCD, 14 bit camera used for automated image acquisition. The Cellomics Target Activation bioapplication was used for processing and analyzing the images to quantitate the percentage purity of astrocytes within a well, and the spot detection bioapplication was used to quantitate the percentage of NF-κB nuclear translocation and caspase 3/7 fluorescence within a well.
Total RNA was extracted from astrocytes using RNeasy miniprep plus kit from Qiagen according to the manufacturer’s instructions. Genomic DNA was eliminated using the genomic DNA eliminator column provided with the RNA isolation kit. Purified RNA was quantified using a NanoDrop® ND-1000 UV-Vis Spectrophotometer. The quality of RNA was determined by using OD 260/OD 280 and OD 260/OD 230 which were approximately 1.8–2. Total RNA was reverse transcribed into DNA using a high capacity cDNA reverse transcription kit (Applied Biosystems) using the manufacturer’s protocol.
RNA extraction from frozen tissues was performed using QIAzol extraction method. Frozen tissues were collected in an RNase free deep-well plate (96-well plate from Corning, 3961). A 2.3 mm stainless steel bead was added to each of the frozen tissues. Tissues were then disrupted by adding QIAzol reagent followed by subjecting the block to Mini-Beadbeater for 4 cycles of 45 s each. This resulted in efficient disruption of the tissues. The aqueous layer was collected after mixing with chloroform. An equal volume of 70% ethanol was added to the aqueous layer, mixed thoroughly, and applied to RNeasy 96 plates (Qiagen). Purification of RNA was done according to the manufacturer’s protocol.
Real-time polymerase chain reaction (rt-PCR)
Target gene primers along with 6-FAM™ dye-labeled TaqMan micro groove binder probe for quantitative PCR analysis were obtained from Applied Biosystems (assay IDs Mm00516005_m1 for heme oxygenase 1 (HO1), Mm00443675_m1 for thioredoxin reductase (TXNRD1), Mm00802655_m1 glutamate-cystein ligase catalytic subunit (GCLC), and Mm00660947_m1 for oxidative stress-induced growth inhibitor (OSGIN1)). Each reaction contained 100 ng of DNA, 900 nM each of forward and reverse primers, and 250 nM TaqMan probe. Temperature conditions consisted of a 10 min cycle at 95 °C, followed by 40 cycles of 95 °C for 0.15 min and 60 °C for 1 min using Stratagene Mx 3005P. All samples were measured in at least duplicates along with GAPDH as a normalizing gene, and the no-template control was negative for all runs. The final analysis was done using comparative CT method.
Gene expression analysis
The TaqMan® OpenArray® Gene Expression platform was used to perform a transcriptomic analysis to comprehensively evaluate inflammatory responses upon α7 nAchR activation in an in vitro inflammation model using LPS. Total RNA extracted from astrocytes treated with LPS alone and LPS in the presence of GTS21 was reverse transcribed into cDNA. The cDNA was then loaded to a TaqMan® OpenArray® Mouse Inflammation Panel plate (Thermofisher, 4475393) consisting of 632 gene targets selected for their involvement in inflammatory responses. The QuantStudio 12K Flex Real-Time PCR System (Thermofisher) was used to perform real-time PCR and quantitative gene expression. Fold changes (RQ) in expression of inflammatory genes were calculated using comparative CT method. A corrected p value of 0.05 was used to identify differentially expressed genes.
Next, based on these differentially expressed genes, a gene set enrichment analysis was conducted using the software package Generally Applicable Gene-set Enrichment (GAGE) in R Bioconductor [
20]. This software provides a list of Kyoto Encyclopedia of Genes and Genomes (KEGG) mouse pathways that are enriched by the differentially expressed genes. We aimed to identify pathways that are significantly downregulated upon treatment with GTS21. The R package, Pathview, was used to visualize maximally enriched KEGG pathways.
Nitrite assay
We used the Griess reagent (Promega) to evaluate the production of nitrite (NO2
−), which is a breakdown product of nitric oxide (NO). Astrocytes were pretreated with GTS21 followed by LPS treatment for 3 days in DMEM in the absence of phenol red. After the treatment, cell-free conditioned medium was collected for the assay. First, the medium was incubated with reagent A containing sulfanilamide followed by incubation with reagent B, N-1-napthylethylenediamine dihydrochloride. This resulted in the formation of colored compound, which was measured at 540 nm using a microplate reader.
Neuronal survival assay
For this assay, we added LPS-treated astrocyte conditioned medium in the presence or absence of α7 nAchR agonist GTS21, in cultured neurons for 24 h. Caspase-3 activation was measured using The CellEvent® Caspase-3/7 green detection reagent (Thermofisher). Images were captured and analyzed using Cellomics ArrayScan XTI high-content analysis system, and spot detection bioapplication was used for processing and analyzing the images to quantitate the percentage of caspase-3 activation within a well.
Protein isolation and western blot analysis
Cells were scraped in 1× lysis buffer from Cell Signaling Technology (catalog no. 9803) with protease and phosphatase inhibitors and 0.5% SDS, followed by sonication with F60 Sonic Dismembrator (Fisher Scientific). The amount of protein in each sample was quantified using Pierce BCA Protein Assay Kit. All samples were diluted to the same concentration. For western blot analysis, samples were boiled at 95 °C for 5 min and 20 μg of total protein was loaded on Criterion™ TGX™ precast gels (BioRad Laboratories). Gels were run for 1 h at 150 V followed by transferring proteins onto a nitrocellulose membrane using an iBlot system (Invitrogen). Five percent non-fat dried milk in tris-buffered saline, tween 20 was used to block the membranes for 1 h. After blocking, primary antibodies against GCLC (Abcam), NQO1 (Abcam), HO1 (Abcam), TXNRD1 (Abcam), ACTB (MP Biomedical), Phospho-IκBα (Abcam), and GAPDH (Abcam) were incubated overnight at 4 °C, followed by washing with 1× tris-buffered saline, tween 20 for 30 min. Secondary antibodies were then incubated at room temperature for 45 min. After washing the membranes for 30 min, Super Signal West Femto Substrate was added to detect horseradish peroxidase on the membranes. Chemiluminescence was measured and quantified using the Syngene gel imaging system.
Animals
All procedures involving animals were approved by the Biogen Institutional Animal Care and Use Committee, which is accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International. Eight- to 12-week-old NF-κB luciferase reporter mice were used for in vivo experiments [
21]. Four groups of five mice were used. In the first group, mice were administered with phosphate buffer saline (PBS) intraperitoneally twice; in the second group, mice were first administered with PBS followed by LPS (1.7 mg/kg) intraperitoneally; in the third group, mice were first administered with GTS21 (5 mg/kg) followed by LPS (1.7 mg/kg) intraperitoneally; and in the fourth group, mice were first administered with GTS21 (25 mg/kg) followed by LPS (1.7 mg/kg) intraperitoneally. At 4 h, mice were euthanized using CO
2 asphyxiation method for ex vivo brain imaging and tissue collection.
NF-κB luciferase brain ex vivo imaging
Brain ex vivo NF-κB luciferase signals were evaluated in images acquired on the IVIS Spectrum instrument (Perkin Elmer, Hopkinton, MA), using the Perkin Elmer proprietary software, Living Image (v4.3.1). Luciferin was injected intraperitoneally at 150 mg/kg for ex vivo brain imaging, which was conducted after euthanizing the animal and harvesting the brain. One hemisphere of the brain was imaged, and the other half was collected for RNA analysis.
Data analysis
Experimental results were analyzed using GraphPad Prism software. Data are expressed as mean (+/− standard deviation). Differences in means for continuous dependent variables were compared using unpaired Student t tests (for two groups) or one-way ANOVA with adjustment for multiple comparisons (for more than two groups). Tukey’s test was used for multiple comparisons when considering all pairwise comparisons and Dunnett’s test was used when comparing multiple groups to a common control. Two-tailed p values of less than 0.05 were considered as statistically significant.
Discussion
In this study, treatment of astrocytes with α7 nAChR agonist GTS21 [
26] reduced LPS-mediated inflammatory cytokines in a dose-dependent manner and this effect was reversed by both pharmacological and genetic inhibition of α7 nAChR expression. Further, α7 nAChR activation blocked LPS-mediated NF-κB nuclear translocation in astrocytes indicating that the observed anti-inflammatory effect may be mediated through the NF-κB pathway. We also demonstrated that treatment with α7 nAChR agonist upregulated canonical Nrf2 antioxidant genes and proteins suggesting antioxidant properties of α7 nAchR. Using an astrocyte conditioned media approach, we demonstrated a reduction in neuronal apoptosis with GTS21 treatment. Finally, in an in vivo neuroinflammation model using LPS in NF-κB luciferase reporter mice, we demonstrated reduction in LPS-induced NF-κB activity in the brains of animals treated with GTS21 using bioluminescent imaging. We also observed a reduction in the expression of pro-inflammatory cytokine downstream of the NF-κB pathway and an increase in Nrf2 target genes in brain tissues with GTS21 treatment.
α7 nAChRs have been recognized as a target with therapeutic relevance in neurodegenerative diseases because of their neuroprotective effects and potential association with cognitive enhancement [
27,
28]. A distinct feature of these receptors is that they are widely expressed in neuronal and non-neuronal cells, including astrocytes, which are emerging as important players in neuroinflammation and cognitive impairment [
17,
18]. However, the specific role of astroglial α7 nAChRs in neuroprotection has only been evaluated in a couple of prior investigations from a single laboratory. In one study, Liu et al. demonstrated that activation of astroglial α7 nAChRs may provide protection against degeneration of dopaminergic neurons by inhibition of MPTP (in vivo)- and MPP+- or LPS (in vitro)-induced astrocyte activation in PD [
12]. In a second study, Liu et al. demonstrated that activation of α7 nAChRs resulted in a reduction in H
2O
2-induced apoptosis of astrocytes and expression of glial cell-derived neurotrophic factor [
29]. Both of these studies point towards a critical role of astrocytes in neuroprotection conferred by α7 nAChR activation. The results from our study provide additional evidence for anti-inflammatory and antioxidant effects of astroglial α7 nAChR activation.
Further, our study also provides an explanation of the molecular mechanism of action for the observed anti-inflammatory effects of astroglial α7 nAChR activation. In LPS-treated astrocyte cultures from Nrf2 knockout mice, we not only observed a robust reduction of the antioxidant response of α7 nAchR activation but also the anti-inflammatory response in the in vitro inflammation model; suggesting that the Nrf2 and NF-κB pathways may work in concert to mediate the observed anti-inflammatory response of astroglial α7 nAchRs. Previous investigations have proposed multiple mechanisms by which the Nrf2 and NF-κB pathways may interact. First, the activation of the Nrf2 pathway leads to dissociation of Nrf2-Keap1 complex and increased free Kelch-like ECH-associated protein 1 (Keap1) in the cytosol. Keap1 is reported to bind with IKKβ, which may in turn prevent the phosphorylation of IκBα and p65 NF-κB subunit nuclear translocation leading to diminished NF-κB signaling [
30]. On the other hand, Keap1 is also reported to be capable of binding directly with the p65 subunit of NF-κB [
31]. Therefore, upon activation of the NF-κB pathway, this interaction may result in higher nuclear translocation of Keap1 and consequent functional inactivation of Nrf2, in turn exaggerating the inflammatory response. Another potential interaction between the two pathways involves CREB-binding protein (CBP), which is a transcription co-activator capable of binding to both Nrf2 and the phosphorylated p65 subunit of NF-κB [
32]. Since Nrf2 and NF-κB compete for CBP, knocking out Nrf2 results in higher binding of NF-κB/p65 to CBP and consequently higher transcription of inflammatory genes, leading to a more potent inflammatory response. Our observation of decreased anti-inflammatory response of α7 nAChR activation in astrocytes from Nrf2 knockout mice is consistent with this hypothesis.
The Nrf2 pathway has received increasing recognition as a major player in glial α7 nAChRs-mediated neuroprotection. Parada et al. reported that cell death and ROS production were reduced upon treatment with α7 nAChR agonist PNU282987 in organotypic hippocampal slice cultures under oxygen and glucose deprivation conditions, and these effects were reduced substantially upon immunotoxic depletion of microglial cells [
33]. In vivo, these significantly diminished antioxidant and neuroprotective effects were noted upon α7 nAChR activation in HO1 knockout mice, suggesting active involvement of the Nrf2 pathway in neuroprotection against brain ischemia. Findings from our study confirm these observations regarding the importance of the Nrf2 pathway in glial α7 nAChR-mediated neuroprotection. Aditionally, our study critically notes that the Nrf2 pathway is not only involved in α7 nAChR-mediated antioxidant effects, but may also interact with the NF-κB pathway to reduce pro-inflammatory cytokine secretion.
Activation of functional α7 nAChRs expressed on astrocytes has been demonstrated to produce rapid currents and increase intracellular calcium levels [
11]. After an initial influx of calcium through astroglial α7 nAChR channels, further modulation of calcium signaling occurs through calcium-induced calcium release from intracellular store [
34]. Increase in intracellular calcium in astrocytes is reported to regulate synaptic transmission and plasticity [
35,
36]. Astrocytes reside in close proximity to neurons and are key components of neural circuits. Recent evidence suggests that calcium signaling cascades in astrocytes result in increased extracellular glutamate levels, thereby shifting the local neural circuit to a slow oscilation state of synchronized neuronal firing critical in memory consolidation and sleep [
37]. Taken together, these studies suggest that activation of astroglial α7 nAChRs may play a role in enhancement of cognitive function. Our results showing anti-inflammatory and antioxidant properties of astroglical α7 nAChRs suggest that in pathological states such as neurodegenerative diseases, targeting these receptors can provide additional benefits through neuroprotection.