Background
Since voltage-gated sodium channel (VGSC) is necessary in the initiation and propagation of action potentials in neurons, it is a valuable therapeutic target for neurological disorders, such as epilepsy and chronic neuropathic pain [
1‐
3]. Recent studies have now expanded the role of sodium channels in multi-neurological diseases including autism, migraine and multiple sclerosis [
2,
4,
5]. A prospective study reported that Alzheimer's disease (AD) have an increased risk of developing seizures and epilepsy [
6]. A recent study reported that over activity of hippocampus might contribute to AD-related cognitive decline [
7] and antiepileptic drug was demonstrated to reverse cognitive deficits and diminished the anxiety phenotypes in AD mice [
8]. And electrical imbalance may contribute to cognitive deficits in AD and serve as a target for clinical intervention [
9,
10]. These studies together suggest that dysfunction of VGSC may share the common phenotype between AD and epilepsy.
Voltage-gated Na
+ channels (VGSCs) are macromolecular protein complexes, which are composed of α-subunits (Nav1.1–Nav1.9) and β-subunits (Navβ1, Navβ1B, Navβ2, Navβ3 and Navβ4), in which α-subunits are necessary for forming a functional ion-selective channel and β-subunits affect ion channel gating and trafficking to regulate the voltage-dependency and density of VGSC on the cell membrane. It has been reported that mutation of Nav1.1, a remarkable feature of Dravet syndrome, could induce higher seizure activity and cognitive dysfunction [
11]. Interestingly, Nav1.1 retained inside the cells while its expression reduces markedly in
BACE1-transgenic mice, accompanied with disturbed Navβ2 [
12]. And restoring Nav1.1 level could reduce memory deficits in human amyloid precursor protein (
hAPP) transgenic mice [
13]. Furthermore, elevated cell surface Nav1.2 expression contributes to the epileptic behaviors in
BACE1-null mice [
14]. These studies indicated that the abnormal Nav1.1/Nav1.2 trafficking may be involved in dementia. Navβ2 plays a key role in the trafficking of α-subunits from cytoplasm to cell membrane [
15‐
17], and keeping the steady-state stabilization of VGSC complexes at the plasma membrane [
18]. Interestingly, Navβ2 is also one substrate for beta-secretase (
BACE1) in
BACE1-deficient or over-expressing mice [
19], and the increased Navβ2 cleavage contributes to aberrant neuronal activity and cognitive deficits in amyloid precursor protein (
APP) mice [
20]. However, the mechanism remains largely unclear.
Chronic brain hypoperfusion (CBH)-mediated chronic cerebral ischemia and consequent cognitive impairment [
21,
22] is most likely to precede dementia [
23,
24]. It has been reported that CBH not only induces the accumulation of beta-amyloid (Aβ) [
21,
24] and cell death [
25], but also reduces dendritic arborizations as well as synaptic contacts [
26]. And acute cerebral ischemia by the occlusion of right middle cerebral artery downregulates the total Nav1.1 protein expression from 6 h to 2 days, which was further increased from 3 to 7 days [
27]. However, whether and how CBH influences the expression or trafficking of Nav1.1/Nav1.2 has not been reported.
MicroRNAs are small non-coding RNA, which regulate protein synthesis. MicroRNA-9 (miR-9), enriched in central nerve system (CNS) [
28], contributes likely to multi-pathological processes including the neurogenesis [
29], proliferation [
30], migration and differentiation of neural progenitor cells [
31], drug adaption [
32], adult brain plasticity [
33], neural cell fate [
34], the migration and proliferation of glioma cells [
35], axon extension and branching [
36], spinal motor neuron development [
37] under physiological status. Importantly, miR-9 expression has been downregulated in the brain of patients with Huntington's disease [
38] and upregulated in the patients with Alzheimer's disease [
39], suggesting that abnormal expression of miR-9 may be involved at least partially in the processes of neurodegenerative diseases. Therefore, whether and how miR-9 participates in the abnormal expression or trafficking of Nav1.1/Nav1.2 induced by CBH is worth to be explored.
In this study, our data provide strong evidence that miR-9 regulates Nav1.1/Nav1.2 trafficking by post-transcriptional regulating SCN2B gene under CBH status.
Discussion
In this study, our observations have demonstrated, for the first time that CBH induces the trafficking defects of Nav1.1/Nav1.2 in hippocampi and cortices areas in 2VO rats, leading to the decrease in the expression of Navβ2 protein. Further study has shown that the increased miR-9 negatively regulated the expression of Navβ2 protein by binding to the target in CDS region of SCN2B gene. This observation provides a novel mechanism to modify the reduction in Nav1.1/Nav1.2 membrane trafficking, and careful monitoring the changes in miR-9 level and the expression for Nav1.1/Nav1.2 and targeted gene are considerably necessary during CBH.
Molecular identity and trafficking characters of Nav1.1/Nav1.2 in rat brain after CBH
It has been known that Nav1.1, Nav1.2, and Nav1.6 are abundant in the central nervous system, whereas Nav1.3 is mostly present during embryonic stage [
44]. Nav1.6 is concentrated in the axon initial segment (AIS) nodes of Ranvier and in proximal dendrites in many types of neurons [
45]. Since cell surface levels of Nav1.1 and Nav1.2 subunits dramatically decrease in the brains of
BACE1-trangenic mice although total Nav1.1 and Nav1.2 levels are elevated [
12,
14], and that the axonal and surface levels of Nav1.2 are significantly increased in hippocampal neurons from
BACE1-null mice [
7]. In the present study, the expression of Nav1.1 and Nav1.2 of both surface and total protein were detected in hippocampi and cortices of rat following CBH and our data showed that CBH could induce trafficking defects of Nav1.1/Nav1.2 with significant increase in total protein levels of Nav1.1/Nav1.2 and the marked decrease in surface protein levels of Nav1.1/Nav1.2. The results are consistent with previous study performed using
BACE1-trangenic mice [
12].
Previous studies have demonstrated that Navβ2 subunit, an auxiliary subunit of Nav channel, participates in channel trafficking, re-localization, and interaction of both Nav1.1 [
46,
47] and Nav1.2 [
45]. Importantly, a recent study has also shown that the abnormal Navβ2 cleavage mediated by
BACE1 affects Nav1.1 and Nav1.2 surface trafficking differentially [
48]. Furthermore, in AD status, the intracellular domain of Navβ2 functionally regulates the α-subunit of VGSCs and the elevated
BACE1 activity leading to decrease in surface levels of Nav1.1 in neuronal cells [
49]. Interestingly, here we found that CBH not only impaired Nav1.1/Nav1.2 trafficking in rat hippocampi and cortices, but also downregulated the expression of Navβ2, suggesting Navβ2 may be more likely involved in the abnormal trafficking of both Nav1.1 and Nav1.2 induced by CBH. Of noted, previous studies have demonstrated that 2VO provokes chronic brain hypoxia and triggers spatial memory impairment in rats accompanied with elevation of
APP and
BACE1 expression [
24,
41]. Whether the impaired trafficking of Nav1.1/ Nav1.2 in the present study is associated with CBH induced high level of
APP and
BACE1 is unknown and need to be elucidated further.
Negative regulation of miR-9 on Navβ2 protein-mediated trafficking disturbance of Nav1.1/Nav1.2 in vitro
As far as we know, microRNAs are newly discovered and commonly considered as modulators of protein expression at post-transcriptional level, which are associated with the pathogenesis in multiple kinds of diseases [
50‐
53]. In the present study, our observations have shown that the mRNA level for Navβ2 unaltered in hippocampi and cortices of 2VO rat but its targeted protein expression significantly decreased (Fig.
2b), indicating that the post-transcriptional regulation must be existed to modify Navβ2 expression. It has been documented in the literature that miR-9 is elevated in hippocampus [
39] and temporal lobe cortex [
54] of AD patients, whereas, the opposite observation is also presented in AD patients [
55] from others,which was then demonstrated downregulation of miR-9 due to overexpression of Aβ in hippocampal cultures [
56]. The discrepancies imply that the changes in miR-9 in AD depend presumably upon the variants inducers. In the present study, The major finding is that miR-9 is significantly up-regulated under CBH conditions in animal model (Fig.
2d).
Our study provides strong evidences that miR-9 increases in both hippocampi and cortices, and inhibited the expression of Navβ2, which in turn blocked the trafficking of Nav1.1 and Nav1.2 from cytoplasm to plasma membrane (Figs.
3,
4 and
5). However, why the total Nav1.1/Nav1.2 protein levels increase in cultured neuron following miR-9 treatment and how 2VO triggers Nav1.1/Nav1.2 total protein up-regulation remain unclear. The possible explanation may be due at least partially to a unknown mechanism increasing protein synthesis to compensate the trafficking defect-mediated the decrease in surface expression of Nav1.1/Nav1.2. But the detailed mechanism needs to be further studied.
In addition, our important finding here is that miR-9 regulates endogenous Navβ2 expression by targeting its coding sequence (CDS) region rather than not 3’UTR of SCN2B (Fig.
4). Additionally, another evidence collected from the current inverstigation demonstrate that the microRNA-mediated regulation is not limited to the 3’UTR, the functionality of target sites in the CDS also confirmed by previous studies [
57‐
59], such as miR-24 [
58], miR-296, miR-470, miR-134 [
60], miR-126 [
43], miR-181a [
59], miR-148 [
57] and miR-519 [
61] that target sequences within the mRNA coding region have been reported to repress the biosynthesis of the encoded proteins in similar way. Our results provided another evidence that, microRNA-mediated regulation is not limited to target on the 3’UTR of genes, the functionality of target sites is also located in the CDS domain.
Negative regulation of miR-9 on Navβ2 protein-mediated trafficking defects of Nav1.1/Nav1.2 in vivo
More importantly, our in vivo study supports the data collected from our in vitro observations that the upregulation of miR-9 induced by both CBH and lenti-pre-miR-9 could also disturb the trafficking of both Nav1.1/Nav1.2 by downregulation of Navβ2 expression. On the contrary, lenti-pre-AMO-miR-9 injection into hippocampus markedly prevents the abnormal trafficking of both Nav1.1 and Nav1.2 following either CBH or lenti-pre-miR-9 treated normal rats accompanied by increased Navβ2 expression. These results combination with our in vitro data suggested that the inhibition of miR-9 in hippocampi and cortices in CBH model rats would be a way to prevent sodium channel dysfunction after CBH. An understanding of miR-9-Navβ2-Nav1.1/Nav1.2 trafficking pathway could yield to the potential therapeutic targets for the prevention of abnormal electrical activation induced by CBH.
Limitation and prospect
In the present study, though we have demonstrated the regulation effect of miR-9 on the trafficking of Nav1.1/Nav1.2 by inhibiting the expression of Navβ2 both in vitro and in vivo, we did not provide evidence whether these changes could induce abnormal sodium channel currents and its dynamics characteristics in hippocampi and cortices of 2VO rats. These need to be studied further.
Methods
Animals
Male Sprague–Dawley rats (weight 220–260 g, obtained from the Animal Centre of the Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang Province, China) were housed at 23 ± 1 °C with 55 ± 5 % of humidity and maintained on 12 h dark–light artificial cycle (lights on at 07:00 A.M.) with food and water available ad libium. Rats used for operation of permanent, bilateral common carotid artery occlusion (2VO) and stereotaxic injection of the lentiviral vectors were anesthetized with chloral hydrate (300 mg/kg, intraperitoneal) and maintained by administrating 0.5-1.0 % isoflurane. The depth of anesthesia was monitored by detecting reflexes, heart rate and respiratory rate. Samples for qRT-PCR, and Western blot assay were obtained from the hippocampi and cortices of rats after anesthetized with chloral hydrate (500 mg/kg, intraperitoneal) following by confirmation of death by exsanguination. Tissues for primary neuron culturing were from neonatal SD rats after administration of 20 % isoflurane and confirmation of death by cervical dislocation. All animal procedures were approved by the Institutional Animal Care and Use Committee at Harbin Medical University (No.HMUIRB-2008-06) and the Institute of Laboratory Animal Science of China (A5655-01). All procedures were conformed to the Directive 2010/63/EU of the European Parliament.
Permanent, bilateral common carotid artery occlusion (2VO) in the rat
The method for preparation of 2VO rat was according to the previous study [
24,
62]. Briefly, after the rats were anaesthetized, the bilateral common carotid arteries of rats were exposed via a midline ventral incision, carefully separated from the vagal nerves, and permanently ligated with 5–0 silk suture. The wound was then closed and rats were allowed recovering from anesthesia before being returned to the animal facility.
Primary hippocampal and cortical neuron culture
The hippocampi and cortices regions were removed from the postnatal day 0 (P0) rat pups. After tissues were dissected and triturated, they were plated onto cell plates precoated with 10 μg/mL poly-D-lysine (Sigma, St Louis, MO, USA) and cultured in the culture media containing neurobasal medium (Gibco, USA) with 2 % B27 supplement (Invitrogen, USA) and 10 % fetal bovine serum (FBS, HyClone, Logan, UT). After 3 days, the neurons were treated with 5 μM cytosine arabinoside (Sigma, St Louis, MO, USA) to inhibit astrocyte proliferation. For all experiments, the neurons were used at 14 days after plating [
24].
Synthesis of miR-9, AMO (anti-microRNA antisense oligodeoxyribonucleotide)-miR-9 and other various oligonucleotides
MiR-9 mimics (sense: 5’-UCUUUGGUUAUCUAGCUGUAUGA-3’; antisense: 5’-AUACAGCUAGAUAACCAAAGAUU-3’) and AMO-miR-9 (5’-UCAUACAGCUAGAUAACCAAAGA-3’) were synthesized by Shanghai GenePharma Co., Ltd (Shanghai, China). AMO-9 contains 2’-O-methyl modifications at every base and a 3’ C3-containing amino linker. Additionally, a scrambled RNA was used as a negative control (sense: 5’-UUCUCCGAACGUGUCACGUAA-3, and antisense: 5’-ACGUGACACGUUCGGAGAAUU-3’). The Navβ2-masking antisense oligodeoxynucleotides (ODNs) were synthesized by Shanghai Sangon Biological Engineering Technology and Service Co., Ltd. Navβ2 masking antisense-ODN-1 was 5’-ATGCCTTCGTCTTCTAGCTGC-3’, which masks the binding sites of miR-9, located in the position 336–358 of SCN2B CDS (coding sequence) region; Navβ2 masking antisense-ODN-2 was 5’TCCTCTTCGGTCTTCAGGTCA-3’ , which masks the binding sites of miR-9, located in the position of 575–597 of SCN2B CDS region. Five nucleotides or deoxynucleotides at both ends of the antisense molecules were locked by a methylene bridge connecting between the 2’-O- and the 4’-C atoms.
Transfection procedures
Thirty pmol/mL miR-9 and/or AMO-9, ODNs or NC siRNAs were transfected into neonatal hippocampal and cortical neurons with X-treme GENE siRNA transfection reagent (Cat.#04476093001, Roche, USA) according to the manufacturer’s instructions. Forty-eight hours after transfection, cells were collected for total RNA isolation or protein purification.
Construction of lentivirus vectors
Using the BLOCK-iT polII miR-RNAi expression vector with the EmGFP kit from invitrogen, three single-stranded DNA oligonucleotides were designed as follows: (1) pre-miR-9 (“top strand” oligo: TGCTGTcTTTggTTaTcTagcTgTaTgaGTTTTGGCCACTGACTGACTcaTacagagaTaaccaaaga) and its complementary chain (“bottom strand” oligo: CCTGTcTTTggTTaTcTcTgTaTgaGTCAGTCAGTGGCCAAAACTcaTacagcTagaTaaccaaagaC); (2) pre-AMO-miR-9 (“top strand” oligo: TGCTGTcaTacagcTagaTaaccaaagaGTTTTGGCCACTGACTGACTcTTTggTTcTagcTgTaTga) and its complement (“bottom strand” oligo: CCTGTcaTacagcTagaaccaaagaGTCAGTCAGTGGCCAAAACTcTTTggTTaTcTagcTgTaTgaC); (3) negative control (“top strand” oligo: tgctgAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT) and its complement (“bottom strand” oligo: cctgAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTc). We then cloned the double-stranded oligonucleotides (ds oligo) generated by annealling the top and bottom strand oligos into the pcDNA™6.2-GW/± EmGFP-miR vector and transformed the ligated mixture into competent E. coli. After colony was purified and identified as the correct expression clone, the pre-microRNA expression cassette was transferred to other Gateway® adapted destination vectors utilizing PolII promoters and formed a new miRNA expression clone containing attR substrates. The vector was identified after analyzing the plasmid sequence (Invitrogen, USA). The titers of the vectors used for experiments were 9.25 × 108 transducing U/ml. Virus suspensions were stored at −80 °C until use and were briefly centrifuged and kept on ice immediately before injection.
Stereotaxic injection of the lentiviral vectors
After anaesthetized, rats were placed onto a stereotaxic frame (RWB Life Science Co. Ltd, China) described as previous study [
24]. Injection coordinates relative to the bregma were as follows: AP (anteroposterior), −4.52 mm; ML (mediolateral), ±3.2 mm; DV (dorsoventral), −3.16 mm below the surface of dura using coordinates derived from the atlas of Paxinos and Watson. Two microliters (10,000 Tu/μl) lenti-pre-miR-9 and/or Lenti-pre-AMO-miR-9 were injected into CA1of the hippocampus using a 5 μl Hamilton syringe with a 33-gauge tip needle (Hamilton, Bonaduz, Switzerland). The needle was then maintained in the place for another 2 min after injection and then withdrawn very slowly to prevent the solution backflow.
Dual luciferase reporter assay
Before the luciferase activity assay, plasmid design and construction was shown as in the below figure: a 707 bp fragment from the coding region of SCN2B containing the putative binding sequences for miR-9 (position 336–358 and position 575–597 of SCN2B CDS) was amplified by PCR, cloned into the pSICHECK-2-control vector.
Mutagenesis nucleotides were carried out using direct oligomer synthesis for the CDS region of Navβ2-binding site 1 and Navβ2-binding site 2. Point mutations were introduced into a possible miR-9 binding site located in the coding region of SCN2B (position 336–358 and position 575–597 of SCN2B CDS). MutSCN2B-1 represents that “GACGAAGG” was mutated “ATCGATCG” in the position 336–358 of SCN2B CDS, MutSCN2B-2 represents that “GACCGAAG” was mutated “ATCGATCG” in the position 575–597 of SCN2B CDS. MutSCN2B-1&2 represents that both sites were mutated. All constructs were sequence verified. Rat SCN2B CDS and mutSCN2B CDS sequences were shown as following: SCN2B CDS sequences (bold nucleotide showed the putative binding sequences for miR-9): ATGCACAGGGATGCCTGGCTACCTCGCCCTGCCTTCAGCCTCACGGGGCTCAGTCTGTTTTTCTCTTTGGTGCCCTCGGGGCGGAGCATGGAAGTCACAGTCCCCACCACTCTTAGTGTCCTCAACGGGTCTGATACCCGCCTGCCCTGTACCTTCAACTCCTGCTATACCGTGAACCACAAGCAGTTCTCTCTGAACTGGACTTACCAGGAGTGTAGCAATTGCTCAGAGGAGATGTTCCTCCAGTTCCGAATGAAGATCATCAACCTGAAGCTGGAGCGGTTTGGAGACCGCGTAGAGTTCTCGGGGAACCCCAGTAGTACGACGTGTCAGTGACTCTAAAGAA(CGTGCAGCTAGAAGACGAAGGC)ATTTACAACTGCTAATCACCAACCCTCCAGACCGCCACCGTGGCCATGGCAAGATCTACCTGCAGGTCCTTCTAGAAGGCCCCCAGAGCGGGACTCCACGGTGGCAGTCATCGTGGGTGCCTCAGTGGGGGGTTTCCTGGCTGTGGTCATCTTGGTGCTGATGGTGGTCAAATGTGTGAGGAGGAAAAAAGAGCAGAAGCTGAGC(ACGGATGACCTGAAGACCGAAGA)GGAAGGCAAGACGGATGGCGAGGGCAACGCGGAAGATGGCGCCAAGTAACCGGAAGCTTGCCCTGAAGCCCCTTCCTGTGTCCTGTCTCCTCTCACTCTCTGCCCTGT; mutSCN2B CDS (bold nucleotide): ATGCACAGGGATGCCTGGCTACCTCGCCCTGCCTTCAGCCTCACGGGGCTCAGTCTGTTTTTCTCTTTGGTGCCCTCGGGGCGGAGCATGGAAGTCACAGTCCCCACCACTCTTAGTGTCCTCAACGGGTCTGATACCCGCCTGCCCTGTACCTTCAACTCCTGCTATACCGTGAACCACAAGCAGTTCTCTCTGAACTGGACTTACCAGGAGTGTAGCAATTGCTCAGAGGAGATGTTCCTCCAGTTCCGAATGAAGATCATCAACCTGAAGCTGGAGCGGTTTGGAGACCGCGTAGAGTTCTCGGGGAACCCCAGTAAGTACGACGTGTCAGTGACTCTAAAGAA(CGTGCAGCTAGAAATCGATCGC)ATTTACAACTGCTACATCACCAACCCTCCAGACCGCCACCGTGGCCATGGCAAGATCTACCTGCAGGTCCTTCTAGAAGTGCCCCCAGAGCGGGACTCCACGGTGGCAGTCATCGTGGGTGCCTCAGTGGGGGGTTTCCTGGCTGTGGTCATCTTGGTGCTGATGGTGGTCAAATGTGTGAGGAGGAAAAAAGAGCAGAAGCTGAGC(ACGGATGACCTGAAATCGATCGA)GGAAGGCAAGACGGATGGCGAGGGCAACGCGGAAGATGGCGCCAAGTAACCGGAAGCTTGCCCTGAAGCCCCTTCCTGTGTCCTGTCTCCTCTCACTCTCTGCCCTGT
The sequence of miR-9 mimic is 5’-UCUUUGGUUAUCUAGCUGUAUGA-3’ (synthesized based on the sequence of rno miR-9 (miRBase Accession No. MIMAT0000781)); that of miR-NC is 5’-UUCUCCGAACGUGUCACGUAA-3’; the sequence of the antisense 2’-O-methyl (2’-O-Me) oligonucleotide for miR-9 is 5’-UCAUACAGCUAGAUAACCAAAGA-3’, that of inhibitor-NC is 5’UUCUCCGAACGUGUCACGUTT-3’; HEK293T cells (plated at 40 % ~ 50 % confluence) were transfected with 20 μmol/l miR-9, AMO-miR-9, or negative control siRNAs (NC) as well as 0.5 μg of psi-CHECKTM-2-target DNA (firefly luciferase vector) and 1 μl blank plasmid using lipofectamine 2000 (Invitrogen,USA) transfection reagent according to the manufacturer’s instructions. After 48 h of transfection, Firefly and renilla luciferase activities, as indicated by relative luminescence units (RLU) were determined using luciferase assay kits (Cat.#E1910, Promega, USA) and luminometer (GloMaxTM 20/20, Promega, USA) according to the manufacturer's instructions.
Quantitative real-time PCR- (qRT-PCR)
Total RNA was purified with the Trizol Reagent (Invitrogen, USA), according to the manufacturer’s instructions as described previously [
24].
MiR-9 level was quantified by the TaqMan® MicroRNA Reverse Transcription Kit (Cat.# 000583, ABI, Roche, Branchburg, NJ) and the TaqMan® Gene Expression Master Mix (Cat.# 1108123, Applied Biosystems). The TaqMan qRT–PCR probes and primers for
miR-9, were designed by Applied Biosystems [
63]. U6 was used as an internal control. The SYBR Green PCR Master Mix Kit (Applied Biosystems, Cat#4309155) was used for real-time PCR to quantify the SCN2B mRNA in our study. β-actin was used as an internal control. Primers are as following:
SCN2B forward: CTCTCTGAACTGGACTTACC and
SCN2B reverse: GGTTGGTGATGTAGCAGTTG; β-actin forward: GGAAATCGTGCGTGACATTA and β-actin reverse: AGGAAGGAAGGCTGGAAGAG. All reactions were performed in triplicate, and the expressions of microRNAs data were shown as Delta-Delta Ct method.
Western blot
Both the total protein and surface protein samples were extracted from hippocampi and cortices of rats or primary cultured neurons for immunoblotting analysis. For the total protein analysis, frozen tissue was homogenized with 1000 μl solution contained 40 % SDS, 60 % RIPA and 1 % protease inhibitor in each 200 mg brain tissue. The homogenate was then centrifuged at 13,500 rpm for 30 min and the supernatants (containing cytosolic and membrane fractions) were collected. The method of surface protein extraction was using Mem-PER Eukaryotic Membrane Protein Extraction Reagent Kit (Cat# 89826, Pierce Biotechnology, USA) according to the manufacturer's instructions. Protein concentrations were measured spectrophotometrically using a BCA kit (Universal Microplate Spectrophotometer; Bio-Tek Instruments, Winooski, VT, USA). Protein samples were fractionated by SDS-PAGE (10 % polyacrylamide gels for sodium channels) then transferred to PVDF membrane. The primary anti-Nav1.1, Nav1.2, Navβ2 antibodies (Cat# ASC-001,1:200, RRID:AB_2040003; Cat# ASC-002,1:200, RRID:AB_2040005; Cat# ASC-007, 1:200, RRID:AB_2040011, Alomone Labs, Jerusalem, Israel) were used and β-actin (Kangcheng, Shanghai, China) β-actin (Kangcheng, Shanghai, China) was selected as an internal control of total proteins, mouse anti-human transferrin receptor (TfR) (Cat# 13–6800, RRID:AB_2040011, Invitrogen, USA) was selected as an internal control of surface proteins. Western blot bands were captured on the Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE, USA) and quantified with Odyssey v1.2 software by measuring the band intensity (area × OD) in each group and normalizing to the internal control.
Immunocytochemistry staining
The cultured neonatal rat neurons were transcardially perfused by 4 % buffered paraformaldehyde, pH7.4. After blocking, cultured neonatal rat neurons were incubated with the anti-β-Tubulin III (neuronal) antibody (Cat no. T8578; 1:5000; Sigma, Saint Louis, USA) or anti- Nav1.1, Nav1.2, Navβ2 antibodies (Alomone Labs, Jerusalem, Israel) overnight at 4 °C, and then the cultured neonatal rat neurons were washed and incubated with the secondary antibodies conjugated to Alexa Fluor 488 and Alexa Fluor 594 (Molecular Probes, Eugene, OR, USA) for 1 h at room temperature.
Statistical analysis
Data were described as mean ± s.e.m for experimental data. The two-tailed Student’s t-test was applied for comparisons between the two groups. Multi-group’s comparisions were performed by One-way ANOVA. SPSS19.0 software was used for all statistical analyses. P < 0.05 was considered significant.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
LHS, JA conceived and designed the experiments, performed experiments, were involved in drafting and editing the manuscript, and interpreted primary data. XLH, MLY, LWP, HC, YNB, FG, TL, XC performed the experiments. RZ, TB, NW edited the manuscript. HLL, XH contributed reagents. All authors read and approved the final manuscript.