Background
The high-risk human papillomavirus (HR-HPV) causes cervical cancer [
1], and this infection is also associated with precancerous lesions of the cervix [
2,
3]. In addition, other molecular events such as genetic and epigenetic abnormalities also contribute to the transformation and immortalization of epithelial cells infected with HR-HPV [
4].
The miRNAs can regulate 60 to 90 % of the protein-encoding genes and a single miRNA can regulate, directly or indirectly, the expression of hundreds of target mRNAs [
5‐
7]. The aberrant expression of miRNAs has been associated with the maintenance of the undifferentiated state of cancer cells [
8].
miRNA biogenesis is highly regulated by multiple processes. Approximately 40 % of human miRNAs are organized in conserved clusters, with distances of at least 5000 bp between them [
9], and these miRNAs are co-transcribed as discrete polycistronic pri-miRNAs [
6,
10]. Although the miR-23b gene is encoded in the human chromosome 9q22.32 in a cluster that includes miR-24-1 and miR-27b, the mature sequences of each miRNA are differentially expressed [
11,
12].
The altered expression of miR-23b has been found to be associated with many types of cancer. In breast cancer, the overexpression of miR-23b is correlated with cell proliferation and metastasis, and is thus recognized as an oncogene [
13]. In contrast, the expression of miR-23b in breast cancer increases the formation of focal adhesions and cell-cell junctions, thereby indicating a metastatic suppressor role for this microRNA [
14]. Furthermore, the expression of miR-23b has been found to be decreased in castration-resistant prostate cancer tissue, while its overexpression suppresses migration and invasion. Thus, miR-23b is also recognized as a metastatic suppressor in this type of cancer [
6,
7,
9].
The expression of miR-23b is decreased in HR-HPV positive cervical cancer tissue and cell lines [
15], and it is associated with the overexpression of the urokinase-type plasminogen activator (uPA), which is target gene of this miRNA [
16]. uPA has been directly associated with migration and invasion in cervical cancer [
17]. Although it is proposed that the E6 oncoprotein of HR-HPV regulates the expression of miR-23b in cervical cancer, this mechanism has not been fully elucidated.
A significant number of miRNAs are embedded in CpG islands and that they are targets of epigenetic regulation [
8,
17‐
19]. In human neoplasia, hypermethylation of CpG sites is associated with transcriptional silencing of tumor suppressor genes and genes that encode miRNAs [
20]. There is evidence that miR-23b is subjected to epigenetic silencing in glioblastoma and prostate cancer [
7,
8]. Interestingly, it has been suggested that, HPV16 E6 increases the levels of DNA methyltransferase 1 (DNMT1) by degradation of p53 in cervical cancer, causing hypermethylation of miRNA genes, among others [
21].
Is proposed that in cervical cancer the inhibition of p53 expression by HR-HPV E6 contributes to the decreased expression of miR-23b. The presence of CpG sites in the promoter sequence of miR-23b allows the regulation of this miRNA by methylation. It is known that epigenetic silencing of miRNAs is associated with processes of invasion and metastasis. Identifying the mechanism by which the expression of miR-23b is regulated in cervical cancer will provide useful information to increase the understanding of this pathology and to create therapies targeting specific epigenetic modifications.
The objective of this research was to evaluate the potential role of methylation in the silencing of miR-23b in cervical cancer cell lines and to determine the pattern of expression of this microRNA in cervical tissues of patients without squamous intraepithelial lesion (Non-SIL), with precursor lesions and HPV16 cervical cancer. In this study, we found decreased expression of miR-23b in cervical tissue with premalignant lesions in cervical cancer and in cervical cancer cell lines. Treatment with 5′-aza-2-deoxycytidine restored the expression of miR-23b in C33A, HeLa and CaSki cells.
Discussion
Although cervical cancer is one of the most widely studied tumor models, the role played by epigenetic factors such as the expression of miRNAs and DNA methylation in tumorigenesis is not yet fully understood.
The most significant findings of this study were as follows: 1) the miR-23b promoter is methylated in cervical cancer cell lines; 2) the expression of miR-23b is low in cervical cancer cell lines; 3) the expression of miR-23b increases significantly in HeLa, SiHa, CaSki and C33A cells after treatment with 5′-Aza-CdR; 4) the expression of miR-23b is higher in LSIL than in HSIL and cervical cancer, that is, it decreases as the grade of the lesion increases; 5) in biopsies positive for HPV16 cervical cancer, the expression level of miR-23b is similar to that found in HeLa, SiHa, CaSki and C33A cell lines, and 6) the expression of uPa, c-Met and Zeb1, which are likely targets for miR-23b, is different among cervical cancer cell lines.
Our results on the methylation of miR-23b in cervical cancer cell lines are consistent with those found by Majid et al., in prostate cancer cell lines and tumor tissues. In cervical cancer, it is likely that the expression of miR-23b is also regulated by dinucleotides methylation in the CpG islands located upstream of the TSS within of its promoter.
Corresponding to the methylation level of the miR-23b promoter, which is close to 100 %, the expression of miR-23b was found to be low in cervical cancer cell lines, suggesting that methylation is the mechanism of regulation of the expression of miR-23b in these cells. Interestingly, we found that in CaSki and HeLa cells, which have a greater number of integrated viral copies, the expression of miR-23b was decreased more than in the SiHa cells with fewer integrated copies. While in C33A cells, which are HPV-negative, the lowest expression of miR-23b was detected. The difference in the expression level of miR-23b in the cervical cancer cell lines can be explained by the functional characteristics of each cell line and by the different molecular events as follows: a) tissue origin of each cell line; b) expression of miR-23b transcription factors; and c) multiple mechanisms of regulation for genetic expression.
In cells untreated with 5′-Aza-CdR, the miR-23b expression was higher in SiHa cells than in HeLa, CaSki and C33A cells, which can be explained, at least in part, by the differential expression of transcription factors that modulate the expression of miR-23b. SiHa cells express functional p53 protein at higher levels than in HeLa, CaSki and C33A cells [
24]. p53 is a transcription factor [
24] that modulates the expression of various genes. Bisio
et al. found that miR-23b contains a consensus sequence with low-affinity binding for p53 upstream of the TSS. The authors concluded that cis regulation by p53 partially modulates the expression of miR-23b [
22]. In SiHa cells, Au Yeung
et al. found that p53 expression correlates with miR-23b expression when the HPV16 E6 oncoprotein is silenced [
25]. The higher miR-23b expression level in SiHa cells can be a consequence of the p53 expression level.
In C33A cells, p53 is expressed at normal levels but is not functional because it has a point mutation at codon 273 in an evolutionarily conserved domain. This mutation results in the substitution of an arginine with a cysteine [
24]. It is likely that mutated p53 is unable to transactivate miR-23b, which would explain the low levels of this miRNA in HPV-negative cervical cancer cells. Other factors that may be influencing the expression of miR-23b and other microRNAs are as follows: the HPV type; the number of viral genome copies integrated into the cell genome [
2,
26]; genetic polymorphisms or mutations in the promoter of the transcription factors that modulate the expression of miR-23b [
27,
28]; defects in the molecular machinery responsible for the biogenesis of miR-23b [
29,
30]; and the degree of methylation of miR-23b [
7,
8].
We found that the expression of miR-23b is higher in LSILs than in HSILs and cervical cancer, that is, the expression of this miRNA decreased as the grade of the lesion increased. The decreased expression of miR-23b in biopsies from patients with cervical cancer positive for HPV-16 was similar to that found in HeLa, SiHa, CaSki and C33A cells. miR-23b overexpression in LSILs suggested that miR-23b in cervical carcinogenesis is a tumor suppressor.
The significantly lower miR-23b expression in biopsies of cervical cancer than in LSILs and HSILs, may be the result of gradual miR-23b promoter methylation and alterations of other gene expression regulatory mechanisms that are frequent in carcinogenesis. During tumorigenesis, cells undergoing epithelial-mesenchymal transition (EMT) are subject to metaplasia, which is characterized by the loss of E-cadherin (CDH1) expression [
31,
32]. In hepatocellular carcinoma cell lines, decreased levels of miR-23b are correlated with the loss of expression of CDH1 [
31,
32]. In endometrial carcinosarcoma, miR-23b inhibits the expression of mesenchymal markers [
33]. Evidence indicates that CDH1 expression is downregulated by the snai1 and zeb1 transcription factors, which are molecular targets of miR-23b [
31‐
33].
The low miR-23b expression in cervical scrapes can be explained by the origin of the sample, which determines the type and features of the cells present in the scrape. Cervical scrapes were obtained from the cell transformation zone (TZ). The transformation zone contains highly undifferentiated normal cells, such as metaplastic cells that generally lose cell-cell junctions due to the decreased expression of CDH1 [
31,
32]. In endothelial cells, miR-23b expression is negatively associated with genes that regulate the cell cycle. During the cell cycle, phosphorylated pRb induces G1/S cell-cycle transition [
34]. Low miR-23b expression is associated with the phosphorylation status of pRb and indirectly with increased E2F expression, thus promoting the proliferation of endothelial cells [
35]. In metaplastic cervical cells, the decreased miR-23b expression may be correlated with continuous pRb activity and cell proliferation.
The similarity in miR-23b expression levels between cervical scrapes and biopsies of cervical cancer may be the result of the phenotypic similarity of squamocolumnar junction cells (also known as TZ) with cancer cells and HSIL cells. The subset of cuboidal cells in the squamocolumnar junction, which give rise to cancer, and the cancerous tissue maintain a common partial profile of gene expression [
36,
37]. A high percentage of LSIL and HSIL disappear spontaneously [
37] and is highly likely that in such cases the expression level of miR-23b is increased compared with Non-SIL. Thus, the expression level of miR-23b in SILs and cervical cancer agree with a tumor suppressor gene.
Evidence indicates that uPa, c-Met and Zeb1 are important promoters of tumor phenotype. uPA is a serine protease that modulates the turnover of the extracellular matrix and is related to metastatic tumor phenotypes [
38]. c-Met is recognized as a factor that induces cell migration, and Zeb1 is recognized as a factor that promotes epithelial-mesenchymal transition [
32]. In highly malignant cervical cancer tissue, the expression of uPA, the loss of expression of CDH1 and nuclear expression of snai1 and zeb1 are strongly associated with advanced stages of cervical cancer and lymph node metastasis [
32,
39].
In this study, the mRNA expression levels of uPa, c-Met and Zeb1, which are likely targets of miR-23b, were compared in HeLa, SiHa, CaSki and C33A cells with and without exposure to 5′-Aza-CdR. The expression levels of
uPa decreased in CaSki and C33A cells after treatment. These findings partially agreed with those reported by Au Yeung
et al., who demonstrated that the overexpression of miR-23b decreases the expression of uPa in SiHa and CaSki cells. The increase in the expression of miR-23b after treatment with 5′-Aza-CdR may not be sufficient to inhibit the expression of uPa in SiHa and HeLa cells. In contrast, uPa expression is also influenced by the level of expression and activity of its transcription factors [
40] as well as by methylation of its promoter region [
41]. In cervical cancer tissue, the HR-HPV infection and subsequent alteration of miRNA expression contribute to deregulate the expression of uPa [
25]. However, there is still insufficient evidence to state that miR-23b directly regulates the expression of uPa in this tissue.
The expression level of
c-Met was significant lowest in HeLa cells after treatment with 5′-Aza-CdR, which agreed with data reported by Salvi
et al. [
38], who proposed that miR-23b is a regulator of c-Met expression. Although
zeb1 is a direct target of miR-23b in bladder cancer [
42], there are no current studies that support this theory in cervical cancer. We found that the expression levels of
Zeb1 decrease significantly in C33A and CaSki cells after being treated with 5′-Aza-CdR, suggesting that miR-23b is involved in regulating the expression of
Zeb1 in these cells. Interestingly, in SiHa cells, the hypomethylating treatment resulted in increased expression of
uPa, c-Met and
Zeb1, thereby suggesting that other molecular mechanisms affected by changes in the levels of DNA methylation independent of miR-23b are involved in regulating these genes in SiHa cells.
To explain the differential expression of uPa, c-Met and Zeb1 in cervical cancer cell lines, it should be noted that miRNAs repress or stimulate gene expression in response to specific cellular conditions, sequences and cofactors. The biological outcome of the miRNA-mRNA interaction is influenced by the following factors: the percentage of base pairing between the miRNA and target site; the number and relative position of target sites for the same miRNA; accessibility of the site; sequences flanking the target site; and the mRNA secondary structure, which may influence the hybridization sequences [
43]. Moreover, Vasudevan and Steitz reported that the gene repression mediated by a miRNA may be reversible [
44]. Thus, the expression of uPa, c-Met and Zeb1
, which are likely targets of miR-23b, can be the result of specific features of each cell type, but it is also likely that some of these mRNAs were translated into protein at the time of RNA collection. More detailed studies are needed to determine if uPa, c-Met and Zeb1 are genes regulated by miR-23b in cervical cancer.
Material and methods
Culture of cervical cancer cell lines
The following cell lines were used: HeLa (50 copies of integrated HPV 18), SiHa (1–2 copies of integrated HPV16), CaSki (450 to 600 copies of integrated HPV16) and C33A (HPV-negative). The cells were cultured in Dulbecco′s modified Eagle medium (DMEM) supplemented with fetal bovine serum (10 %) and penicillin/streptomycin (1 %) (Invitrogen, Carlsbad, CA, USA). The cells were incubated at 37 °C in humidified atmosphere with 5 % CO
2 [
15,
45].
Treatment of cell lines with 5′-Aza-2-deoxycytidine (5-Aza-CdR)
Cells were seeded in 6-well plates (25 × 10
3 cells/well) and cultured for 72 h before treatment. The cells were treated with 10 μM 5-Aza-CdR dissolved in DMSO and added to fresh culture medium. The cultures were incubated at 37 °C in 5 % CO
2 for 24 h. The treatment was then repeated, and the incubation was continued for an additional 24 h under the same conditions [
46,
47]. The assay was performed in triplicate for each cell line. Untreated cells were included as a control [
45].
Patients and cell or cervical tissue samples
We studied 54 biopsies from women with cytopathological and histopathological diagnosis of squamous intraepithelial lesions (SILs) or cervical cancer with infection by HPV16. Of these biopsies, 19 were of low-grade squamous intraepithelial lesions (LSILs), 7 were of high-grade squamous intraepithelial lesions (HSIL) and 28 were of cervical cancer. The samples were obtained during routine screening for detection of premalignant lesions or cervical cancer at the State Cancer Institute “Dr. Arturo Beltran Ortega” in Acapulco, Guerrero. We included 18 cervical scrapings from women who had cervical cytologies without squamous intraepithelial lesions (non-SILs) and who were infected with or without HPV16. These women attended the Immunohistochemistry and Cytopathology Laboratory of the Autonomous University of Guerrero (Chilpancingo, Guerrero, Mexico) for timely detection of cervical cancer.
Before sampling, all women signed an informed consent to participate in the study.
Extraction and purification of nucleic acids
Extraction of total RNA and DNA from the cell lines before and after treatment with 5-Aza-CdR as well as from cervical samples was performed with TRIzol reagent according to the manufacturer’s instructions. The integrity of both nucleic acids was determined by electrophoretic shift in a 1 % agarose gel [
48]. The DNA was stored at −20 °C, and the RNA was stored at −70 °C.
Detection and typing of HPV16
Detection and typing of HPV was performed using the INNO-LiPA genotyping extra kit (Innogenetics, Barcelona, Spain) according to the manufacturer’s instructions.
Methylation analysis of miR-23b by RT-PCR
The methylation status of the promoter region of miR-23b was determined using the Human cancer miRNA EpiTect Methyl II Signature PCR Array® (QIAGEN Sciences, Maryland, USA) following the manufacturer’s instructions. Briefly, this assay was based on the digestion of methylated and unmethylated DNA using methylation-sensitive and methylation-dependent restriction enzymes. The DNA that remained after digestion was added to the matrix. The ABI 7500 system for real-time PCR was used to read the plates. The relative amount of methylated and unmethylated DNA was calculated using the standard ∆Ct method, normalizing the amount of DNA in each digestion against the total amount of input DNA in a null digestion using an Excel spreadsheet provided by the manufacturer.
Quantitative analysis of miR-23b expression by RT-PCR
The expression of miR-23b was determined using the ABI 7500 system for real-time PCR (Applied Biosystems, Foster City, CA). Reverse transcription was performed using 10 ng of total RNA. The expression of miR-23b (000400, AUCACAUUGCCAGGGAUUACC) was measured using TaqMan microRNA assays following the manufacturer’s instructions (Applied Biosystems). The expression of miR-92a (000431, UAUUGCAUUGUCCCGGCCUGU) was used as an internal reference for the expression of miR-23b. The relative expression of both miRNAs was analyzed by the comparative Ct method.
Quantitative polymerase chain reaction (qPCR) assays of upa, c-met and zeb1
The qPCR assays were performed according to the manufacturer’s instructions with a One-Step qRT-PCR kit (KAPA SYBR® FAST, Boston, Massachusetts, USA). Using qPCR assays, we assessed mRNA expression levels of the following genes: uPa (5′-GTCGTGAGCGACTCCAAAGGCA-3′ and 5′- GGGCAGTTGCACCAGTGAATGT-3′), c-Met (5′-TATTTCCCAGATCATCCATTGCA-3′ and 5′- AATGTAGGACTGGTCCGTCAAAA-3′) and Zeb1 (5′- GCACCTGAAGAGGACCAGAG-3′ and 5′- TGCATCTGGTGTTCCATTTT-3′). We used GAPDH (5′ GGTGAAGGTCGGTGTGAACG-3′ and 5′ CTCGCTCCTGGAAGATGGTG-3′) as the internal reference. The thermal cycling profile was as follows: cDNA synthesis step was performed using 200 ng of total RNA at 42 °C for 5 min, followed by an inactivation RT step at 95 °C for 5 min, and 40 cycles of a denaturation step at 95 °C for 3 s, an annealing/extension step at 60 °C for 30 s, and a dissociation step according to the instrument guidelines. The qPCR assay was independently repeated three times using the StepOne system for real-time PCR (Applied Biosystems, Foster City, CA). The relative expression of uPa, c-Met and Zeb1 was analyzed by the comparative Ct method.
Data analysis
Using the STATA statistical package (version 9.2), we determined the frequency of methylation of the promoter region of miR-23b, and the same statistical package was used to determine the expression changes of miR-23b, uPa, c-Met and Zeb1 between cells treated with 5′-Aza-CdR and untreated cells. Fisher’s exact test was used to compare the differences between the two conditions. The median and interquartile range of the miR-23b expression was determined, and the difference between groups was calculated by the Mann-Whitney’s test. The association between the expression of miR-23b and the presence of cervical cancer was determined by logistic regression with a confidence level of 95 %. A value of p < 0.05 was considered statistically significant.
Competing interest
The authors declare no conflict of interest.
Authors’ contributions
GFT, HJW conceived and designed the experiments and coordinated the study and wrote the draft; GECV performed the experiments and wrote the paper; GTA, DSF contributed to performed the experiments; LdelCAR, MAJL did the cytological and histopathological diagnosis; DHS, OPZ made the donation of cell lines. and contributed with reagents/materials; BIA contributed with molecular diagnosis of HPV and reagents/materials. All authors have been reading and approved the final manuscript.