Background
Tumor microenvironment has a close relationship with tumor development and metastasis [
1]. A complex milieu of non-malignant cells compose tumor microenvironment, contributing to tumor progression by interactions with tumor cells and/or with each other [
2]. Mesenchymal stem cells (MSCs) are an important component of these cells. MSCs are defined as multipotent stem cells that have the capacity to give rise to adipocytes, osteoblasts, and chondrocytes [
3]. They can be isolated from a number of tissues including bone marrow, adipose tissue, and umbilical cord blood. Although the function of naïve MSC in tumor remains controversial, the tumor-supporting roles of tumor associated mesenchymal stem cells have been acknowledged [
4]. This may be attributed to a long-time “education” by tumor cells.
Tumor cells can modulate tumor stromal cells through intercellular communications. This process can be mediated through direct cell contact or through secreted signaling factors (cytokines, chemokines, and growth factors) and microvesicles. Exosomes, one kind of membrane vesicles containing proteins, mRNA, miRNAs, and DNAs, can be produced by tumor cells as well as other various cell types [
5]. Recently, exosomes in tumor microenvironment are attracting more and more attention. They are shown to be small particles but big players in cancer progression and metastasis [
6‐
8] as cancer cells could reprogram surrounding stromal cells into tumor supportive myofibroblasts through secreted exosomes. Data showed that exosomes from ovarian and breast cancer cells can convert adipose-derived MSCs (AMSC) into myofibroblast-like cells [
9,
10]. Bone-marrow MSC (BMSC) could also be triggered to differentiate into pro-angiogenic and pro-invasive myofibroblasts by prostate cancer cell-derived exosomes [
11]. Exosomes released by chronic lymphocytic leukemia cells could induce the transition of stromal cells into cancer-associated fibroblasts [
12].
While most studies concentrate on reprogramming MSCs into tumor-supportive myofibroblasts by various cancer cell-derived exosomes, few studies have paid attention to the immuno-phenotype changes of MSCs after incubation with tumor cells derived exosomes. Tumors are regarded as chronic injuries that are difficult to heal [
13], and inflammation plays an important role in tumorigenesis, tumor progression, and metastasis [
14]. Besides, MSCs are known for its immunomodulatory capacity through secreting related factors such as cytokines [
15]. Thus, there is an urgent need to dictate the immuno-phenotype changes of MSCs in tumor microenvironment.
Previous research about MSCs immuno-phenotype changes often use pre-conditioned MSCs with inflammatory factors. Results show that long-term stimulation with TNF-α, IFN-γ, and other factors could upregulate the expression of various pro-inflammatory genes in MSCs [
16]. The team of Yufang Shi noticed TNFα-pretreated BM-MSCs mimicked lymphomas-MSCs in their chemokine production profile and ability to promote tumorigenesis of lymphoma, melanoma, and breast carcinoma [
17]. Therefore MSCs that have elevated secretion of inflammatory factors show great relevance with tumor progression.
In the present study, we will investigate whether exosomes from lung tumor cells could affect immuno-phenotype of AMSCs and try to reveal the molecular mechanisms involved in this process. Since few studies have elucidated the mechanisms by which lung cancers influence AMSC through exosomes and lung cancer is one of the leading causes of cancer-related death which incline to transfer to other sites such as bone through tumor-stromal interactions in late stage [
18], it is meaningful to explore this question.
Discussion
Exosomes, first considered as “garbage” released from cells, are now exerting starring roles in intercellular communication. Research about exosomes focuses on three areas: disease biomarker in early stage, membrane vesicles as conveyors of immune responses, and roles in cancer [
25]. Here, we focus on exosomes in tumor microenvironment. MSCs can be recruited into tumors and form a major component of the tumor microenvironment. Emerging evidence show that tumor cells could modulate MSCs through exosomes including prostate cancer, melanoma, cancer and so on [
26,
27]. Although many cancer cells could modulate MSCs into myofibroblasts, the molecular mechanisms involved are not the same. One group reported that the tumorigenic reprogramming of MSCs in prostate cancer was associated with exosomal oncogenic factors such as H-ras and K-ras transcripts, oncomiRNAs, miR-125b etc. [
28] Another group suggested that prostate cancer cells could trigger differentiation of fibroblasts into myofibroblasts through exosomal TGF-β [
26]. Breast cancer-derived exosomes induced the myofibroblastic phenotype and functionality in AMSCs via the SMAD-mediated signaling pathway [
10].
Here, we found that MSCs could be educated by lung cancer cell-derived exosomes into pro-inflammatory phenotype and therefore got tumor supportive characteristics. Different from the current research tendency which focuses on the transition from MSCs to myofibroblast caused by tumor cell-derived exosomes, we emphasize on the inflammation phenotype of MSCs. Our results were consistent with previous clinical findings that MSCs require pro-inflammatory cytokines to induce their immunosuppressive function [
29,
30]. This indicates the importance of pro-inflammatory MSCs in tumors progression.
However, few studies have elucidated mechanisms about which signal pathways trigger pro-inflammatory phenotype changes in MSCs. Jerome Paggetti reported that exosomes released by chronic lymphocytic leukemia could induce an inflammatory phenotype in stromal cells through activating AKT, ERK1/2, CREB, and GSK3α/β signaling pathways [
12]. Several related research explained how tumor cell-derived exosomes cause inflammation in immune cells. Sanchita Bhatnagar et.al found that exosomes released from bacteria-infected macrophages stimulated a pro-inflammatory response in a toll-like receptor—and myeloid differentiation factor 88 (MyD88)—dependent manner [
31]. Fanny Chalmin demonstrated that mice tumor-derived exosomal HSP72 induce IL-6 production by MDSCs through activation of TLR2 and its adaptor MyD88, leading to Stat3 phosphorylation and the promotion of MDSC immunosuppressive functions [
32]. Some others thought stress-induced Hsp72 activates macrophages, dendritic cells, and neutrophils by binding to surface bound TLR4 and induce the secretion of pro-inflammatory cytokines [
33]. Alexzander Asea et al. [
34] also illustrated that HSP70 utilized both TLR2 and TLR4 to transduce its pro-inflammatory signal in a CD14-dependent fashion.
These studies suggested the involvement of HSP proteins in exosome-associated inflammation. There remains a question—whether pro-inflammatory properties are unique to cancer-derived exosomes or are an intrinsic feature of all exosomes. We hypothesized that exosomes have a common determinant, HSP70, which is one of the inducers of P-MSCs. However, other protein components of exosomes may also be involved in this process [
35]. These determinants need to be further characterized.
In our study, we found that HSP70 on the surface of A549 cell-derived exosomes could activate NF-κB signaling through TLR2 on MSCs. However, TLR2 neutralizing antibody could partially reduce the effects of exosomes, suggesting that TLR4, which also can interact with HSP proteins, may serve as a substitute for TLR2.
Additionally, we should consider the role of RNA component in exosomes in our future study. We noticed the decreased expression of inflammatory factors after pre-treating exosomes with Rnase A (data not shown), which implied the involvement of exosomal RNAs. It has been shown that acute stressor exposure modified plasma exosome-associated Hsp72 and microRNA (miR-142-5p and miR-203) [
36]. Exosomal miRNAs can affect cells of the tumor microenvironment [
37] both in a canonical (mRNA-targeting) and non-canonical (receptor-binding) manner. Tumor exosomal miR-21 and miR-29a can function by binding as ligands to receptors of the TLR family in immune cells, triggering a TLR-mediated prometastatic inflammatory response that ultimately leads to tumor growth and metastasis [
38].
Considerable evidence suggests that pro-inflammatory pathways drive self-renewal of cancer stem-like cells. HSPs are key players during inflammation besides their chaperone and cytoprotective functions. Interest in HSP70 inhibitors is increasing as potential anticancer agents in recent years [
39,
40]. By reprogramming pro-inflammatory MSCs in tumor microenvironment using HSP70 inhibitors, tumor progression may be controlled. But there is still a lot of “dark matter” to reveal before the welcome of light for cancer patients.
Methods
Exosome isolation
Exosome extraction was performed as previously described [
41]. Briefly, A549 cells were cultured in serum-free DF12 medium for 24 h. Then, the culture medium was collected and centrifuged at 800
g for 5 min and additional 2000
g for 10 min to remove lifted cells. The supernatant was subjected to filtration on a 0.1-mm-pore polyethersulfone membrane filter (Corning) to remove cell debris and large vesicles, followed by concentration by a 100,000 Mw cutoff membrane (CentriPlus-70, Millipore). The volume of supernatant was reduced from approximately 250–500 mL to less than 5 mL. The supernatant was then ultracentrifuged at 100,000
g for 1 h at 4 °C using 70Ti rotor (Beckman Coulter). The resulting pellets were resuspended in 6 mL PBS and ultracentrifuged at 100,000
g for 1 h at 4 °C using 100Ti rotor (Beckman Coulter).
Transmission electron microscopy
Purified exosomes were fixed with 1 % glutaraldehyde in PBS (pH 7.4). After rinsing, a 20-uL drop of the suspension was loaded onto a formvar/carbon-coated grid, negatively stained with 3 % (w/v) aqueous phosphotungstic acid for 1 min, and observed by transmission electron microscope.
Isolation and culture of MSCs from adipose tissue
Human adipose tissue was obtained from liposuction aspirates with informed consent of the donors and was performed according to procedures provided by the Ethics Committee at the Chinese Academy of Medical Sciences and Peking Union Medical College. The isolation and culture procedures were described as previously reported [
42]. hAMSCs were resuspended in 12 ml culture medium and seeded at a density of 2 × 10
6 cells in a 75-cm
2 culture flask. Cell cultures were maintained at 37 °C in a humidified incubator with 5 % CO
2 and passaged with trypsin/EDTA when cells were confluent. Passage 3 cells were used for following experiments.
Quantitative real-time polymerase chain reaction
Cultured cells were lysed by TRIzol (Invitrogen, USA), and RNA was extracted according to the manufacturer’s instruction. One microgram of total RNA from each sample was reverse transcribed using M-MLV (Takara) in a final volume of 20 uL. The polymerase chain reaction (PCR) amplification was carried out using the Step-one System (Bio-Rad) with SYBR Green Mastermix (Takara). All quantitative real-time PCR (qRT-PCR) results were carried out in duplicate and normalized to GAPDH. The primer of the related gene list is found in Table
2.
Table 2
Primers for RT-PCR
ALP
| CCACGTCTTCACATTTGGTG; AGACTGCGCCTGGTAGTTGT |
RUNX2
| TGTCATGGCGGGTAACGAT; AAGACGGTTATGGTCAAGGTGAA |
OCN
| GGCGCTACCTGTATCAATGG; GTGGTCAGCCAACTCGTCA |
PPAR γ
| CCTATTGACCCAGAAAGCGATT; CATTACGGAGAGATCCACGGA |
LPL
| ACAAGAGAGAACCAGACTCCAA; AGGGTAGTTAAACTCCTCCTCC |
C/EBPβ
| CTTCAGCCCGTACCTGGAG; GGAGAGGAAGTCGTGGTGC |
IL-6
| ACTCACCTCTTCAGAACGAATTG;CCATCTTTGGAAGGTTCAGGTTG |
IL-8
| ACTCCAAACCTTTCCACCCC; TTCTCAGCCCTCTTCAAAAACTTC |
MCP-1
| CAGCCAGATGCAATCAATGCC; TGGAATCCTGAACCCACTTCT |
IL-1β
| AGCTACGAATCTCCGACCAC; CGTTATCCCATGTGTCGAAGAA |
TNF-α
| CCTCTCTCTAATCAGCCCTCTG; GAGGACCTGGGAGTAGATGAG |
IFN-α
| GCCTCGCCCTTTGCTTTACT; CTGTGGGTCTCAGGGAGATCA |
IFN-β
| GCTTGGATTCCTACAAAGAAGCA;ATAGATGGTCAATGCGGCGTC |
IFN-γ
| TCGGTAACTGACTTGAATGTCCA; TCGCTTCCCTGTTTTAGCTGC |
ACTA2
| CGATGCTCCCAGGGCTGTTT; TTCGTCACCCACGTAGCTGTCTTT |
TLR1
| CCACGTTCCTAAAGACCTATCCC; CCAAGTGCTTGAGGTTCACAG |
TLR2
| ATCCTCCAATCAGGCTTCTCT; GGACAGGTCAAGGCTTTTTACA |
TLR3
| TTGCCTTGTATCTACTTTTGGG; TCAACACTGTTATGTTTGTGGGT |
TLR4
| AGACCTGTCCCTGAACCCTAT; CGATGGACTTCTAAACCAGCCA |
TLR5
| TCCCTGAACTCACGAGTCTTT; GGTTGTCAAGTCCGTAAAATGC |
TLR6
| TGAATGCAAAAACCCTTCACC; CCAAGTCGTTTCTATGTGGTTGA |
TLR7
| CACATACCAGACATCTCCCC; CCCAGTGGAATAGGTACACAGTT |
TLR8
| ATGTTCCTTCAGTCGTCAATGC; TTGCTGCACTCTGCAATAACT |
TLR9
| CTGCCACATGACCATCGAG; GGACAGGGATATGAGGGATTTGG |
TLR10
| GGTTCTTTTGCGTGATGGAATC; GTCGTCCCAGAGTAAATCAAC |
GAPDH
| GGTCACCAGGGCTGCTTTTA; GGATCTCGCTCCTGGAAGATG |
Western blotting
After washing twice with cold PBS, cells were lysed in RIPA lysis buffer (Beyotime, Shanghai, China) with 1 mM PMSF and protease inhibitor cocktail on ice for 30 min, manually scraped from culture plates and then quantified using the BCA Protein Assay Kit (Beyotime). Proteins were separated on 10 % sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gels, electroblotted onto a polyvinylidene difluoride (PVDF) membrane (0.22 μm, Millipore, Billerica, MA, USA). The membranes were blocked with 5 % BSA and incubated with specific antibodies overnight at 4 °C and then were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h at room temperature. The primary antibodies were as follows: IKKα/β, phosphorus IKKα/β, p65, phosphorus p65, JNK, phosphorus JNK, phosphorus p38 (1/1000, Cell Signaling Technology, USA), CD63, HSP70 (1/1000, Abcam), GAPDH (1/1000, Santa cruz), and β-actin (1/1000, Zhongshan, Beijing China). Secondary (HRP)-conjugated antibodies were purchased from NeoBioscience. Antibody and antigen complexes were detected using chemiluminescent ECL reagent (Millipore, USA).
siRNA transfection
Three pairs of siRNA of TLR2 were designed and synthesized (Gene Pharma, Inc., Shanghai, China). The synthetics were transfected into AMSCs at the final concentration of 200 nM using lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions. The whole transfection process was proceeded in a non-serum medium named opti-mem (Gibco, USA) for 6 h at 37 °C in a humidified environment containing 5 % CO2. After transfection, the medium was changed into DF12 medium with or without cancer exosomes.
Cytokine analysis
Culture supernatants were collected after treatment with or without exosomes for 24 h. The concentrations of all cell cytokines in supernatants were measured using ELISA kits (BD Technologies).
Immunofluorescence staining
The cultured cells were fixed at 4 °C in ice-cold methanol for 10 min, washed three times in phosphate-buffered saline (PBS), and then permeabilized in 0.1 % Triton X-100/PBS for 10 min at room temperature. Nonspecific binding was blocked with 0.5 % Tween-20/PBS containing 1 % bovine serum albumin (BSA) for 30 min. The primary antibodies were incubated at 4 °C overnight. The secondary antibodies incubated for 1 h at room temperature. The incubated cells were washed in PBS, and Hoechst 33342 (Sigma-Aldrich) was used to visualize nuclei. p65 antibody (10745-1-AP) was purchased from Proteintech.
Animal experiments
All nude mice were purchased from the Laboratory Animal Center of the Chinese Academy of Medical Sciences (Beijing, China). All mice were bred and maintained under specific pathogen-free conditions. Animal use and experimental procedures were approved by the Animal Care and Use Committee of the Chinese Academy of Medical Sciences. All nude mice received a subcutaneous injection of 2 × 106 A549 cells. One group received a subcutaneous injection of 2 × 105 PMSCs. The other group received a subcutaneous injection of 2 × 105 MSCs. The last group only received an injection of A549 cells. The tumor volume was measured after 2 weeks. The tumor tissues were fixed with 10 % PFA and the peripheral blood were collected for C-flow analysis. Each group was treated with HE, Ki67, and F4/80 staining. Ki67 antibody was purchased from Proteintech (19972-1-AP). F4/80 antibody was purchased from Abcam (ab6640).
Statistical analysis
Data are presented as mean ± SD. Comparisons between groups were analyzed via Student’s t test. Differences were considered statistically significant at *P < 0.05, **P < 0.01, and ***P < 0.001.
Acknowledgements
This study was supported by grants from the National Natural Science Foundation of China (No. 81370466), the National Science and Technology Major Projects for “Drug Research and Development” (2014ZX09101042), Key Program for Beijing Municipal Natural Science Foundation (No.7141006), National Collaborative Innovation Program (for Biotherapy), Beijing Science and Technology Project (Z151100001615063).
Competing interests
All authors declare that they have no competing interests.
Authors’ contributions
XL performed and analyzed the experiments and wrote the manuscript. SW designed and analyzed the experiments and critically revised the drafting of the manuscript. RZ and HL analyzed the data and provided helpful suggestions in the drafting of the manuscript. QH performed the cell immunofluorescence staining and helped design the experiment. RCZ designed the experiment. All authors have read and approved the final manuscript.