Background
Non-small cell lung cancer (NSCLC) is associated with considerably high mortality worldwide [
1]. Surgery can ensure local disease control in patients with early stages of disease, and patients unsuitable for surgery at diagnosis, primarily those with advanced stage disease, receive chemotherapy or targeted therapy as a first line of treatment. Epidermal growth factor receptor tyrosine kinase inhibitor (EGFR-TKI) and echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion tyrosine kinase inhibitor (EML4-ALK-TKI) exert substantial therapeutic effects in lung adenocarcinomas with specific commonly occurring mutations [
2‐
5]. Platinum-based treatment regimens remain the standard of care recommended by the lung cancer guidelines for squamous lung cancer or adenocarcinoma with undefined mutation status [
6]. Recently, studies [
7,
8] have revealed that a nedaplatin-based treatment regimen is associated with a favorable response in patients with squamous cell lung cancer. Platinum-based drugs are defined as DNA adduct-forming agents that exert antineoplastic effects by inducing the formation of double-stranded DNA cross-links, thus resulting in irreversible DNA damage [
9]. Accumulating DNA damage eventually leads to apoptosis [
10,
11].
Nuclear-factor (NF)-E2-related factor 2 (NRF2) is a core transcription factor involved in the cellular response to oxidative stress [
12]. Under basal conditions, NRF2 forms a complex with Kelch-like ECH-associated protein-1 (KEAP1), which is targeted for ubiquitination. Upon exposure to stress or electrophilic regents, NRF2 evades the ubiquitination process and translocates from the cytoplasm to the nucleus [
13]. By binding to antioxidant responsive element (ARE), NRF2 increases the transcription of multiple cytoprotective enzymes [
14] such as heme oxygenase-1(HO1), NAD (P) H dehydrogenase (quinone) 1 (NQO1), and glutamate-cysteine ligase modifier (GCLM) [
15].
In urethane-induced lung carcinogenesis model, NRF2 activation suppresses tumorigenesis, but somatic activation of NRF2 in cancer cells enhanced growth of tumors [
16]. Studies have demonstrated that NRF2 activation contributes to chemo-resistance [
17‐
19] or radio-resistance [
20] in lung cancers. Investigators have also focused on the relationship between NRF2 activity and platinum treatment in NSCLC cell line [
21,
22]. However, studies designed to observe and compare NRF2 signaling response under different platinum treatment are rarely reported [
23]. In this study, we sought to elucidate the role of NRF2 in platinum-based chemotherapy for NSCLC, and we identified KEAP1 mutation as a key factor contributing to platinum sensitivity.
Methods
Chemicals and cell culture
Unless otherwise stated, all chemicals were purchased from Sigma-Aldrich (Shanghai, China). Antibodies against NRF2 (ab62352) were purchased from Abcam; antibodies against HO1 (#5853) and NQO1 (#3187) were purchased from Cell Signaling Technology; and antibodies against KEAP1 (10503-2-AP), GCLM (14241-1-AP), and β-actin were purchased from Proteintech.
The A549 (human lung adenocarcinoma), H292 (human mucoepidermoid carcinoma), H460 (human large cell lung cancer), and SKMES-1 (human squamous lung cancer) cell lines were obtained from the Cell Resource Center, Peking Union Medical College. The cells were cultured in RPMI-1640, with the exception of SKMES-1 cells, which were cultured in MEM. All media were supplemented with 10 % fetal bovine serum (GIBCO, NY, USA). No antibiotics were added to the media.
Plasmid and siRNA design
The wild-type KEAP1 coding sequence (CDS) was cloned into the pEnter shuttle plasmid. The Fast Mutagenesis system (Transgene, Beijing, China) was used to introduce the G333C and D236H mutations. The primers used were:
-
G333C-forward, TGATCTACACCGCGGGCTGCTACTTCCGACAGTC
-
G333C-reverse, AGCCCGCGGTGTAGATCAGGCGGCCCACC
-
D236H-forward, AGCCCGCGGTGTAGATCAGGCGGCCCACC
-
D236H-reverse, GGTCCCGGCTGATGAGGGTCACCAGTTGG
-
The small interfering RNAs used to silence NRF2 were:
-
Sense, GGUUGAGACUACCAUGGUUTT
-
Antisense, AACCAUGGUAGUCUCAACCTT
Transfection was conducted with Lipofectamine 2000 (Invitrogen) according to a previously published method [
24].
Real-time PCR analysis
Total messenger RNA (mRNA) was extracted from cells using TRIzol according to the manufacturer’s protocol (Takara, Japan). Seven hundred fifty-nanogram total mRNA was used to synthesize first strand complementary DNA (cDNA) using the cDNA synthesis kit (ThermoFisher Scientific). Quantification reactions were performed with the ABI 7900 HT platform. Each reaction consisted of 5 μl SYBR Green/ROX qPCR Master Mix (ThermoFisher Scientific), 1 μl cDNA, 1 μl 10 μM forward and reverse primer mix, and 3 μl ddH
2O. Cycling conditions were as follows: 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 60 s. Cycle thresholds were calculated as the expression fold-changes according to the 2
−△△CT algorithm. The primers used for real-time PCR are:
-
NRF2, forward, TCCAGTCAGAAACCAGTGGAT
-
Reverse, GAATGTCTGCGCCAAAAGCTG
-
HO1, forward, AAGATTGCCCAGAAAGCCCTGGAC
-
Reverse, AACTGTCGCCACCAGAAAGCTGAG
-
NQO1, forward, GAAGAGCACTGATCGTACTGGC
-
Reverse, GGATACTGAAAGTTCGCAGGG
-
GCLM, forward, TGTCTTGGAATGCACTGTATCTC
-
Reverse, CCCAGTAAGGCTGTAAATGCTC
KEAP1 mutation sequencing
Total RNA was extracted and used to synthesize the first chain cDNA according to the procedure described in the real-time PCR analysis description. cDNA was used as a template to synthesize six segments of the KEAP1 gene using the following cycling conditions: initial denaturing step at 94 °C for 5 min followed by 30 cycles at 94 °C for 40 s, 60 °C for 40 s, and 72 °C for 55 s. Products were separated on 1 % agarose gels, and bands were visualized with ethidium bromide. The products were sequenced using the ABI3730 XL DNA Analyzer (Applied Biosystem Japan, Tokyo, Japan) and analyzed with Chromas 2.4.3 software. Primers used to amplify the KEAP1 gene fragments were:
-
Fragment 1, forward AGAGGTGGTGGTGTTGCTTAT
-
Reverse TGGAGATGGAGGCCGTGTA
-
Fragment 2, forward CAGGTCAAGTACCAGGATG
-
Reverse GATGAGGGTCACCAGTTG
-
Fragment 3, forward ATCGGCATCGCCAACTTC
-
Reverse AGGTAGCTGAGCGACTGT
-
Fragment 4, forward CAGAAGTGCGAGATCCTG
-
Reverse GCTCTGGCTCATACCTCT
-
Fragment 5, forward GCCCTGGACTGTTACAAC
-
Reverse GTCTCTGTTTCCACATCGTA
-
Fragment 6, forward GCTGTCCTCAATCGTCTC
-
Reverse AGTTCTGCTGGTCAATCTG
-
NRF2 exon2, forward TCGTGATGGACTTGGAGCTG
-
Reverse AGCATCTGATTTGGGAATGTG
Sections were spliced together after manual inspection and compared with the reference sequence with BLAST to identify potential mutations.
Western blot analysis
Cytoplasm and nuclear protein were extracted by using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (ThermoFisher Scientific). For total protein extraction, we used standard protocols for protein isolation and antibody detection, as previously described [
24,
25]. Cells were washed twice with ice-cold PBS and then lysed with RIPA buffer. Each sample was denatured in 100 °C boiling water in the presence of SDS and DTT. A total of 20 μg of protein from each sample was loaded onto a 10 % SDS-PAGE gel for separation by electrophoresis. A tank system was used to transfer proteins from gels to PVDF membranes. The membranes were blocked with nonfat milk for 1 h and incubated with primary antibodies overnight. All primary antibodies were used at a dilution of 1:1000, with the exception of anti-β-actin (1:5000) and anti-NQO1 (1:3000). Blots were sufficiently washed in 0.1 % Tris-buffered saline and Tween20 (TBST) four to six times for at least 5 min per wash. Washed membranes were incubated with secondary antibodies at a dilution of 1:5000 for 1 h at room temperature. After incubation with secondary antibodies, the membranes were washed three times for at least 5 min per wash. SuperSignal West Pico Chemiluminescent Substrate (ThermoFisher Scientific) was applied for exposure using Syngene G: BOX F3 Fluorescence Imaging System. All images of the blots were processed in Photoshop without gray value modification and spliced in Microsoft PowerPoint.
Immunofluorescence staining
Immunofluorescence was performed as previously reported with some modifications [
26]. Cells were seeded onto a 24-well plate until they reached a confluence of 50~60 % and were treated with the indicated reagents. After treatment, cells were fixed in 4 % paraformaldehyde at 4 °C for 10 min. The cells were then washed in PBS for 5 min and permeabilized and blocked with 0.1 % Triton X-100 and 1 % bovine serum albumin PBS for 20 min. Cells were incubated with primary antibody against HO1 at a dilution of 1:200 at 4 °C overnight. The cells were then washed in PBS three times for 5 min per wash. Cells were incubated with Alexa Fluor 488® secondary antibody (Invitrogen) at a dilution of 1:1000 for 1 h at room temperature. DAPI solution was added after incubation with secondary antibody. Cells were washed three times for 5 min per wash before imaging. Fluorescence images were captured using a Leica digital microscope (Leica Microsystems, Wetzler, Germany). Images were merged using Adobe Photoshop CS6, and no other modifications were made.
Cytotoxic assay
Cellular proliferation was evaluated using a Cell Count Kit-8 (CCK-8) with some modifications [
27]. Lung cancer cell lines were seeded onto 96-well plates for attachment for a minimum of 12 h in a 37 °C incubator. Nedaplatin or cisplatin dissolved in phosphate-buffered saline (PBS) was added to the medium at a concentration gradient of 30–150 μM. After 24 h of exposure, the medium was completely removed. Then, a medium with 10 % (
v/
v) CCK-8 was added to each well. Absorbance at 490 nm was measured after a 2-h incubation at 37 °C. Cell survival was calculated as the ratio between the treated group and control groups. Ratios were graphed in line charts with Graphpad Prism 6 software.
Public database analysis
Expression data from The Cancer Genome Atlas (TCGA) squamous lung cancer patients was retrieved using the package TCGA-Assembler (
http://www.compgenome.org/TCGA-Assembler/) in an R program. KEAP1 mutation status was defined as previously described [
28]. Specimens with a confirmed KEAP1 mutation status were included for evaluation of relative gene expression values.
Statistical methods
Parametric tests were used to evaluate data with a normal distribution. Non-parametric tests were used to evaluate data with unknown distribution patterns. mRNA fold-changes were compared using Student’s t tests. Survival comparisons were conducted using paired t tests. Comparisons between the mutant and wild-type KEAP1 groups were conducted using Mann-Whitney tests. Significance was set at P < 0.05.
Discussion
A large genomic study has demonstrated that multiple oncogenic and tumor suppressor pathways are involved in the initiation and progression of lung cancer [
29]. In addition to the well-known oncogenic pathways, such as those mediated by retrovirus-associated DNA sequences (RAS), epidermal growth factor receptor (EGFR), and anaplastic lymphoma kinase (ALK), novel signaling pathways continue to be identified, such as those mediated by NOTCH [
30,
31] and DACH1 [
26,
32]. Targeted drugs already serve as a first-line therapy for NSCLC patients with specific mutations. However, for the many NSCLC patients with an unknown mutation status or with no gene mutations, platinum-based regimens remain the standard of care proposed by NCCN guideline. Previous studies [
20,
33] have revealed that NRF2 and its downstream genes play pivotal protective roles in NSCLC chemotherapy. A recent genomic analysis has revealed that disruptions in the KEAP1/NRF2 pathway are observed in nearly 30 % of squamous lung cancer patients [
28]. KEAP1 mutations were more common in smoked NSCLC. Research by Takahashi et al. [
34] demonstrated all four KEAP1 mutated lung cancer patients were heavy smoker with a mean pack year value of 79.0, while no KEAP1 mutation was detected in no-smoked patients. Platinum-induced DNA damage and cellular response to stress might be associated with the efficacy of chemotherapy and might contribute to resistance [
10,
12,
35].
Functional KEAP1 represses NRF2 activity by recruiting the NRF2 protein to the actin cytoskeleton [
36]. Sequencing experiments revealed that the A549 cell line harbors a mutation (glycine 333 to cysteine) in the Kelch domain and that the H460 cell line harbors a mutation (aspartic acid 236 to histidine) in the intervention region of KEAP1. No mutations in exon 2 of the NRF2 gene, the site associated with most NRF2 mutations [
37], have been identified in sequencing analysis. We observed increased basal levels of NRF2 downstream target genes in the NSCLC cell lines harboring KEAP1 mutations compared with the wild-type KEAP1 NSCLC cell lines. Interestingly, an increased protein level of cytoplasm NRF2 in squamous cell lung cancer cell line SKMES-1 was observed. But the high cytoplasm NRF2 protein did not lead to increased NRF2 nuclear accumulation and expression of NRF2 downstream target genes, suggesting that NRF2 function is tightly regulated by wild-type KEAP1. Our findings provide a visual profile of the functional and aberrant KEAP1-NRF2 interactions observed in NSCLC.
After exposure to cisplatin, the KEAP1 mutant cell lines A549 and H460 exhibited considerably increased levels of NRF2 signaling, whereas when the KEAP1 wild-type cell lines H292 and SKMES-1 exhibited no changes or only mild changes. Cisplatin is a weak inducer of ARE in the MCF-7 human breast cancer cell line (without KEAP1 mutation [
38]) and induces a 1.3-fold change in ARE expression levels after 24 h of exposure [
15], consistently with our observations in wild-type KEAP1 NSCLC cells. Interestingly, in KEAP1 mutant cell lines, two platinum drugs induced different level of increasing extents of NRF2 signaling. That is less than 2.5-fold induction for NRF2 by nedaplatin and more than 3.5-folds by cisplatin were observed. This phenomenon was mostly seen on HO1 gene. HO1 blots in Fig.
2g, h demonstrated that nedaplatin induced lower while cisplatin induced higher elevation of HO1 gene in A549 and H460. Reactive oxygen species (ROS) play a role in cisplatin induced and activated by a variety of signals [
39,
40]. KEAP1 perceives cellular ROS levels via its multiple amino acid domains [
38,
41,
42]. KEAP1 mutations disrupt the interaction between KEAP1 and NRF2 [
22]; however, the kinetics of this interaction in KEAP1 mutant cells exposed to cisplatin have not previously been described. Our findings suggest that NRF2 signaling is upregulated in NSCLC cells harboring KEAP1 mutations.
However, nedaplatin induces only weak activation or no activation of NRF2 signaling. The antineoplastic activity of nedaplatin, a cisplatin derivate developed in 1983 [
43], might be mediated by mechanisms distinct from those of p53-dependent early apoptosis [
44]. Several studies have demonstrated that a nedaplatin-based treatment regimen [
45‐
47] for squamous cell lung cancer is superior to a cisplatin or carboplatin-based regimen [
48]. Our work provides a potential rationale for nedaplatin as the optimal choice for NSCLC patients with KEAP1 mutations. Platinum-based drugs are capable of binding DNA [
49], explaining why we observed a decrease in the expression of NRF2 downstream genes during early phases (3 h) of platinum exposure in wild-type KEAP1 H292 cell line.
An early study by Devling et al. [
50] has revealed that inhibition of KEAP1 function markedly enhances endogenous levels of NRF2. Our results demonstrated that transfection of wild-type KEAP1 potently attenuated NRF2 signaling and sensitized A549 and H460 cells to platinum-based treatment. In addition, expression of G333C and D236H mutant KEAP1 increased the expression of NRF2 downstream genes at the mRNA and protein levels and resulted in increased cell survival after exposure to platinum-based drugs. Most KEAP1 mutations enhance the nuclear localization of NRF2, thereby leading to the constitutive activation of downstream gene expression [
51]. Although nedaplatin induced lower activation of NRF2 signal in KEAP1 mutant cell line, its sensitivity can be influenced by intervention on NRF2 activity. As NRF2 upregulate a series of detoxification genes and protect cancer cells against insults, our results demonstrated that the sensitivity of nedaplatin may be influenced by other NRF2 downstream genes, including but not limited to AKR1C3, GST, and PSAT1 [
52]. In addition, in Fig.
4c, d, Keap1 mutation in H292 cell line conferred indeed less resistance to nedaplatin than cisplatin. But this superiority for nedaplatin was not that significant in SKMES-1 cells (Fig.
4g, h). The underneath mechanism requires validation. In summary, we demonstrated that KEAP1 mutations influence NRF2 signaling and platinum sensitivity in NSCLC cells.
NRF2 activity is involved in chemosensitivity in breast cancer [
20] and ovarian cancer [
33]. Clinical evidence [
53,
54] has also suggested that NRF2 signaling confers chemo-resistance in NSCLC. We found that siRNA knockdown of NRF2 or NRF2 activation significantly disrupted NRF2 signaling in vitro and led to sensitization or resistance of NSCLC cells to platinum-based drugs. It demonstrated again that NRF2 signals had a significant impact on platinum sensitivity in H292. We expected to see that NRF2 activity have no impact on nedaplatin sensitivity, but repeated experiment demonstrated a minor but significant effect of NRF2 on nedaplatin sensitivity (paired
t test
p value 0.0116). This effect was also observed in Fig.
6g (paired
t test
p value 0.0218). We speculated that under siRNA intervention or activator treatment, some other pathways such as NF-kappa B and BACH1 are compensatorily involved in the process [
55]. Our work provides some new insights into the relationship between NRF2 signaling and platinum-based chemotherapy.
To confirm the significance of KEAP1 mutation in vivo, we evaluated public gene expression data from the publically available TCGA consortium. As expected, KEAP1 mutation did not significantly change alter the mRNA expression of NRF2 and KEAP1. However, mRNA levels of NRF2 downstream target genes were significantly higher in patients with KEAP1 mutations compared with patients with wild-type KEAP1, suggesting that KEAP1 and NRF2 interact primarily at the protein level and that KEAP1 mutations strongly affect NRF2 signaling (Fig.
7f). The association of clinical response with these mutations was not well defined before. One mentioned study evaluated the impact of KEAP1 alteration on NSCLC patients’ survival [
34]. In this study, KEAP1 mutation predicted a worse overall survival. As to disease-free survival, this study demonstrated a vague trend toward significance.