Background
Urinary bladder cancer is generally accepted as the 11th most commonly diagnosed type of cancer worldwide [
1]. In the US, statistics illustrated that an estimated 74,690 cases were newly diagnosed bladder cancer, among which 15,580 were expected to die in 2014 [
2]. Although it is believed that both environmental [
3] and genetic factors [
4],[
5], such as genetic polymorphism, chromosomal anomalies and epigenetic changes, play critical roles in the development of bladder cancer, the exact mechanisms of bladder carcinogenesis are still not well elucidated. Therefore, understanding the potential carcinogenetic mechanisms of these genetic changes is important to identify novel therapeutic targets and prognostic biomarkers.
MicroRNAs (miRNAs) are small (20 ~ 23 nucleotides), endogenous, non-coding RNAs, which constitute a novel cluster of target gene regulators [
6]. They are involved in various cellular processes, including self-renewal, proliferation, metabolism and apoptosis, by inducing post-transcriptional gene repression via accelerating the degradation and/or blocking the translation of their target mRNAs [
7]. The miRNA genes were observed to be specifically deleted in leukemia initially illustrated the important role of miRNA in carcinogenesis [
8]. Subsequent researches have demonstrated that the expression of specific miRNAs is altered in many types of cancer, which is associated with carcinogenesis and cancer progression [
9]-[
13]. Meanwhile, accumulating evidences illustrated that the development and progression of bladder cancer is closely related to the aberrant expression of miRNAs [
14]. The initial study of miRNA expression in bladder cancer was reported by Gottardo in 2007 and 10 up-regulated miRNAs were detected [
15].
Previous miRNA microarray analysis illustrated that miR-320 is down-regulated in breast cancer, acute myelogenous leukemia and colon cancer, revealing that miR-320 could probably act as a tumor suppressor in prohibiting the behavior of cancer [
16]-[
18]. It was reported that miR-320 could inhibit prostate cancer cell proliferation by down-regulating the Wnt/beta-catenin signaling pathway [
19]. Additionally, miR-320a/c/d could inhibit the migration and invasion of hepatocellular cancer via targeting GNAI1, a crucial protein of multiple cellular signal transduction pathways [
20]. Moreover, Iwagami et al. showed that miR-320c regulated the resistance of pancreatic cancer cells to gemcitabine via SMARCC1 (a core subunit of the switch/sucrose nonfermentable), suggesting that miR-320c could be a potential therapeutic target in pancreatic cancer [
21]. Nevertheless, the potential mechanism of miR-320c in bladder cancer has not been well elucidated.
In our present study, we further testified miR-320c expression pattern in bladder cancer tissue. Additionally, for the first time, we detected that miR-320c could suppress growth and motility of the human bladder cancer cell line T24 and UM-UC-3. The tumor inhibitive role and potential mechanisms of miR-320c on bladder cancer were determined.
Methods
Reagents
The miR-320c mimic (named as miR-320c) and the negative control duplex (named as NC) lacking any significant homology to all known human sequences were used for transient gain of function research. For colony formation assay, the 2′-O-Methyl modified duplexes of both miR-320c and NC were used. 2′-O-Methyl modified miR-320c inhibitor (named as miR-320c-Inh) and NC inhibitor (named as Inh-NC) were used for observing the reversed effect of over-expression of miR-320c. The small interference RNA targeting human CDK6 mRNA (named as siCDK6) was synthesized as described previously [
22], which targeted nucleotides 1424–1442 according to Genbank accession NM_001145306.1. All RNA duplexes were chemically synthesized by GenePharma Corporation (Shanghai, China). All the applied sequences were listed in Table
1.
Table 1
The oligonucleotides used in this study
miR-320c mimics (sense) | AAAAGCUGGGUUGAGAGGGU |
NC (sense) | ACUACUGAGUGACAGUAGA |
miR-320c inhibitor | ACCCUCUCAACCCAGCUUUU |
microRNA inhibitor NC | CAGUACUUUUGUGUAGUACAA |
siCDK6 (sense) | CUGGAAAGGUGCAAAGAAAdTdT |
miR-320c F | AAAAGCTGGGTTGAGAGGGT |
U6 F | TGCGGGTGCTCGCTTCGGCAGC |
CDK6 F | GGATAAAGTTCCAGAGCCTGGAG |
CDK6 R | GCGATGCACTACTCGGTGTGAA |
GAPDH F | AAGGTGAAGGTCGGAGTCA |
GAPDH R | GGAAGATGGTGATGGGATTT |
CDK6-Wt F | cAATCAATGCAAGAGTGATTGCAGCTTTATGTTCATTTGTTTGTTTGTTg |
CDK6-Wt R | tcgacAACAAACAAACAAATGAACATAAAGCTGCAATCACTCTTGCATTGATTgagct |
CDK6-Mut F | cAATCAATGCAAGAGTGATTGgtcgaaatTGTTCATTTGTTTGTTTGTTg |
CDK6-Mut R | tcgacAACAAACAAACAAATGAACAatttcgacCAATCACTCTTGCATTGATTgagct |
Tissue samples
Paired bladder cancer tissues and para-carcinoma bladder mucosal tissues were acquired from patients receiving radical cystectomy. The samples were gained between Jan 2011 and June 2011 from the First Affiliated Hospital, School of Medicine, Zhejiang University (Hangzhou, P.R. China) with informed consent and Ethics Committee's approval. The clinical data of the patients were listed in Table
2. All tissue samples were stored in liquid nitrogen before use.
Table 2
Clinical data of the patients
1 | M | 62 | T2N0M0 | III |
2 | M | 60 | T1N0M0 | I |
3 | M | 53 | T1N0M0 | III |
4 | M | 86 | T1N0M0 | III |
5 | M | 55 | T1N0M0 | II |
6 | F | 74 | T2N0M0 | III |
7 | M | 56 | T2N0M0 | III |
8 | F | 76 | T3N0M0 | III |
9 | M | 65 | T2N0M0 | II |
10 | F | 69 | T2N0M0 | II |
11 | M | 72 | T3N0M0 | III |
12 | M | 78 | T1N0M0 | II |
13 | M | 76 | T3N0M0 | III |
Cell culture and transfection
The human bladder cancer cell lines UM-UC-3, T24, and non-tumor urothelial cell line SV-HUC-1 (Shanghai Institute of Cell Biology, Chinese Academy of Sciences) were cultured in RPMI1640 medium (Gibco) containing 10% heat-inactivated fetal bovine serum (Gibco), 50U/ml penicillin and 50 μg/ml streptomycin under a humid atmosphere including 5% CO2 at 37°C. Cells were plated to 60–70% confluency in medium without antibiotics 1 day before transfection. Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA) was selected for transfection under the guide of the instruction.
RNA isolation and real-time PCR
Expression level of miR-320c and CDK6 in tissues and cell lines was calculated by quantitative real-time RT-PCR. Small RNA was extracted from both frozen samples and cell lines with RNAiso Kit for Small RNA (TaKaRa, Japan) and subsequently reverse transcribed into cDNA with One Step PrimeScript miRNA cDNA Synthesis Kit (TaKaRa, Japan). Meanwhile, total RNA from cell lines UM-UC-3, T24, and SV-HUC-1 was extracted using RNAiso plus (TaKaRa, Japan) and transcribed into cDNA using PrimeScript RT reagent Kit (TaKaRa, Japan). The resulting cDNA of miR-320c and CDK6 was quantified by SYBR Premix Ex Taq (TaKaRa, Japan) via an ABI 7500 fast real-time PCR System (Applied Biosystems, Carlsbad, USA). Moreover, the cycle threshold (Ct) value was used for our analysis (ΔCt), and we determined the expression of small nuclear RNA U6 and GAPDH mRNA as internal controls to calculate the relative expression levels of miR-320c and CDK6 via the 2
-ΔΔCt (delta-delta-Ct algorithm) method. All the primers were listed in Table
1.
Cell viability assay
Each well of 96-well plate was plated with 4000 cells (UM-UC-3 or T24). After 24 h incubation, the cells were transfected with RNA duplexes (25 100nM). After 48 h incubation, medium in each well was removed before cell counting solution (WST-8, Dojindo Laboratories, Tokyo, Japan) was added to it and incubated for another 2 h. The absorbance of the solution was measured spectrophotometrically at 450 nm with MRX II absorbance reader (Dynex Technologies, Chantilly, VA, USA).
UM-UC-3 and T24 cells were incubated for 24 h after transfected with 2′-O-Methyl modified duplexes (50nM). Five hundreds of transfected cells were seeded in a new six-well plate and cultivated continuously for another 10 days. Cells were subsequently treated with methanol and 0.1% crystal violet for fixing and staining. The colony formation rate was calculated via the following equation: colony formation rate = (number of colonies/number of seeded cells) × 100%.
Cell migration and invasion assay
The 24-well Boyden chamber with 8 μm pore size polycarbonate membrane (Corning, NY) was used for evaluating the cell motility. Matrigel was used to pre-coat the membrane to simulate a matrix barrier for invasion assay. Four thousands of cells were seeded on the upper chamber with 200 μl serum-free medium after transfected with RNA duplex for 48 h. 600 μl medium with 20% serum, served as a chemoattractant, was added to the lower chamber. After 24 h incubation, the membranes were fixed with methanol and stained with 0.1% crystal violet. Five visual fields (×200) were randomly selected from each membrane, and the cell numbers were counted via a light microscope.
Cell cycle analysis by flow cytometry
After 48 h transfection, UM-UC-3 and T24 cells were washed with PBS and fixed in 75% ethanol at −20°C. After 24 h fixation, the cells were washed with PBS and treated with DNA Prep Stain (Beckman Coulter, Fullerton, CA) for 30 min. Cell cycle analysis was conducted by BD LSRII Flow Cytometry System with FACSDiva software (BD Bioscience, Franklin Lakes, USA). The cell cycle distribution was illustrated as the percentage of cells in G1, S, and G2 populations and data was evaluated by ModFit LT software package.
Protein extraction and Western blotting analysis
After 48 h transfection with RNA duplexes, UM-UC-3 and T24 cells were lysed in cell lysis buffer and concentration of total protein in every lysate was quantified using the BCA Protein Assay kit (Pierce). Equivalent amounts (30–50 μg) of protein were separated by 10% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes. Membranes were blocked for 1 h with 5% non-fat milk and then incubated at 4°C overnight with specific primary antibody at appropriate dilutions according to the instructions. After washed three times in TBS-Tween, the membranes were incubated with the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h and detected by an enhanced chemi-luminescence (ECL) system (Pierce Biotechnology Inc., Rockford, IL). The primary immunoblotting antibodies used were: anti-GAPDH, anti-CDK6 (Epitomics, Burlingame, CA).
Luciferase assays
In order to construct the luciferase reporter vectors, the 3′-UTR (untranslated region) of CDK6 was designed (Sangon, Shanghai, China), which contained putative target region for miR-320c (sequence set in Table
1). The synthesized oligonucleotide pair was annealed at 90°C for 3 min and then transferred to 37°C for another 15 min to form a duplex before inserted into pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, USA) between the SacI and SalI sites. Additionally, the mutant miR-320c putative target region was also designed, annealed and inserted into pmirGLO Dual-Luciferase Vector in the same way (sequence set in Table
1). Both insertions were verified by sequencing (Sangon, Shanghai, China).
HEK 293 T cells were cultivated in a 24-well plate for 24 h before co-transfected with 50nM of either miR-320c mimic or NC oligos and 200 ng reporter plasmid containing wild type (Wt) or mutant type (Mut) of CDK6 3′-UTR. After 48 h transfection, the relative luciferase activity was calculated by Dual-Luciferase Reporter Assay System (Promega, USA).
miR-320c inhibitor experiments
To further verify the function of miR-320c, the antisense inhibitor (miR-320c inhibitor) experiments were performed to see whether the reverse effects to over-expression could be observed. The cells were co-transfected with either miR-320c mimics or NC oligos with miR-320c inhibitor or NC inhibitor [
23]. After 48 h of transfection, colony formation assay, flow cytometry and transwell assay (cell migration and invasion assay) was used to analyze the cell proliferation, cell cycle and cell motility. Besides, expression level of miR-320c and CDK6 was calculated by quantitative real-time RT-PCR. In addition, the CDK6 expression was further determined by Western blotting.
CDKrescue experiments
The pTarget-CDK6 plasmid was constructed via inserting the human CDK6 coding sequence without the 3′-UTR into the pTarget vector (GeneCopoeia, USA), and verified by sequencing. The T24 cells were co-transfected with either miR-320c mimics or NC oligos with pTarget-CDK6 (pCDK6) or empty pTarget vector (pNull). After 48 h of transfection, colony formation assay, flow cytometry and transwell assay was used to evaluate the cell proliferation, cell cycle and cell motility. Additionally, the CDK6 expression was determined by Western blotting.
Statistical analysis
All the statistics were expressed as mean ± standard deviation (SD) of three independent experiments. GraphPad Prism version 5 for Windows was used to conduct all the relative analyses via either the student’s t-test or Two-way ANOVA. P < 0.05 was considered to be statistically significant.
Discussion
During the past decades, effective targeted therapies of bladder cancer contributing to improved prognosis were the highlight of researches [
27]. In recent years, a growing number of researches illustrated that abnormal expression of miRNAs was considered to be a key regulator in carcinogenesis [
28],[
29]. Moreover, aberrant expression profiles of miRNA in cancer detected by microarray analysis provided deeper insights into the molecular passages of carcinogenesis [
17],[
18],[
30]. A previous systematic review summarized the dysfunction of miRNAs in bladder cancer, which would help to establish a mature system in diagnosis and therapy using miRNAs in the future [
14]. However, limited studies were focused on the regulative functional role of miRNAs in bladder cancer. The impact of specific miRNAs in bladder was still poorly understood. Thereafter, our institution performed some researches to elucidate the potential relationship between bladder cancer and miRNAs [
31],[
32].
To the best of our knowledge, we initially detected a decreased expression pattern of miR-320c in human bladder cancer tissue compared with its normal adjacent tissue in the study, Recent miRNA microarray analyses demonstrated that miR-320 was down-regulated in many types of cancer, including breast cancer, acute myelogenous leukemia and colon cancer, indicating that miR-320 could act as a tumor suppressor in cancer, which was similar to our results [
16]-[
18]. Furthermore, previous studies also revealed that miR-320c could inhibit the motility of hepatocellular cancer and regulate the resistance of pancreatic cancer cells to gemcitabine [
20],[
21]. However, owing to unique genetic background in different types of cancer, the biological function of miR-320c in bladder cancer was not well elucidated. Therefore, this is the first study to determine the functional role of miR-320c in bladder cancer. Considering both of our tissue samples and cell lines are from patients with muscle-invasive bladder cancer, the outcome of this study is probably more meaningful in muscle-invasive or recurrent cancer.
Our study illustrated that miR-320c was down-regulated in bladder cancer tissues compared with normal adjacent tissues, though the sample size was relatively small. Similar result was detected in 4 bladder cancer cell lines compared with non-tumor urothelial cell line SV-HUC-1, which further strengthened the conclusion that miR-320c was down-regulated in bladder cancer. A gain-of- function study was further conducted in bladder cancer cell lines. When both UM-UC-3 and T24 cells were transfected with miR-320c, we observed that miR-320c could suppress bladder cancer cell viability and inhibit clone formation. In addition, flow cytometry indicated that miR-320c could trigger G1-phase arrest, which could be the potential mechanism of miR-320c-regulated proliferation inhibition. Moreover, cell motility assay demonstrated that over-expression of miR-320c impaired bladder cancer cells migration and invasion ability.
To elucidate the possible mechanism responsible for the anticancer behaviors triggered by miR-320c, we conducted a computerized analysis for the potential target. Therefore, we identified CDK6 as a new target of miR-320. A previous study illustrated that CDK6 was over-expressed in bladder cancer tissue [
26]. In our present study, similar expression pattern of CDK6 was observed in the human bladder cancer cell lines, which suggested the oncogenic role of CDK6 in bladder cancer. PCR and Western blot study indicated that miR-320c could dramatically inhibit CDK6 expression and luciferase assay further confirmed that CDK6 was a downstream target of miR-320c via directly binding to the 3′-UTR.
To better verify the function of miR-320c, the antisense inhibitor (miR-320c inhibitor) experiments were performed. We confirmed that miR-320c-Inh could reverse the effects to over-expression of miR-320c. miR-320c-Inh could partially reverse the effect of miR-320c on cell cycle arrest and suppressing cell proliferation and motility.
As a critical cell cycle regulator, CDK6 induces an important cascade of events in G1-phase. It can modify Rb phosphorylation efficiently together with CDK4 and cyclin D1, and is considered to a primary sensor for driving cells through the R point to enter a new round of replication. Therefore, CDK6 has been regarded as a possible target for cancer therapy [
33]. The knock-down of CDK6 via RNAi technique illustrated the G1-phase arrest, which phenocopied the cell cycle arrest effect of miR-320c over-expression.
Therefore, CDK6 is another important mediator in miR-320c induced G1/S phase transition arrest and cell proliferation suppression.
As we mentioned before, the knock-down of CDK6, generally accepted as a cell cycle mediator, also yielded an inhibitory effect on cell mobility, which was confusing. Previous studies also indicated that knock-down of CDK6 could inhibit cell invasion and migration in gastric and Ewing's Sarcoma [
34]. However, the accurate mechanisms were still unknown. A recent study indicated that CDK6, as a key protein, coordinated cell proliferation and migration in breast cancer mainly dependent on the expression of estrogen receptor [
35]. Furthermore, various oncogenic signaling pathways, including c-Myc, Ras, and Neu (ErbB2), have been described to converge on cell cycle proteins cyclinD1, CDK4/6 expression [
36]. The data presented in our study also identified a novel role for cell cycle protein CDK6 in bladder cancer through the coordination of cell cycle, migration and invasion.
Ectopic over-expression of CDK6 (without the 3′-UTR) significantly abrogated the miR-320c-induced G1 arrest of bladder cancer cells and promoted cell proliferation and motility in vitro. To sum up, these results suggested that miR-320c inhibited the proliferation and motility of bladder cancer cells via, at least in part, directly targeting the 3′-UTR of CDK6. Thus, our current study revealed what we believed to be a novel upstream regulatory mechanism of CDK6 in cancer cells.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
All authors declare that they have no competing interests.
Authors' contributions
XW, YWL, ZL and SQL performed and participated in analysis of laboratory experiments data. XW, JW and LPX participated in the design of experiments. XW, XXL, XX and YZ acquired, preserved clinical samples. YWL, XYZ and LPX provided administrative support and funded experiments. XW, JW and ZHH drafted the manuscript. All authors have contributed and approved the final manuscript.