Significance of glioma-associated oncogene homolog 1 (GLI1)expression in claudin-low breast cancer and crosstalk with the nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) pathway

HMLE-EMT and control cell lines were a gift of Robert A. Weinberg (Massachusetts Institute of Technology, Cambridge, MA) and were propagated as previously described [21],[22]. MTSV1-7 lines were a gift from Joyce Taylor-Papadimitriou [23]. Claudin-low cell lines, BT549, HS578T, MDA.MB.157, MDA.MB.231, and MDA.MB.436 as well as MCF10a, were obtained from American Type Culture Collection (ATCC) and propagated according to instructions. All experiments were done on low-passage cells.

A total of 750 HMLE-shEcad cells per well were plated in 384-well plates in 20 μl of growth media and allowed to adhere overnight. The following day 10 nl of compounds from stock plates were added to each well (Table S1 in Additional file 1). The stock plates contained each agent at 16 concentrations from 10 mM to 0.3 nM. Seventy-two hours after drug addition, viability was assayed using CellTiter-Glo reagent (Promega, Madison, WI, USA). The protocol for the screen has been previously described by our laboratory [24].

For generating dose-response curves manually, 1,000 cells/well in 100 μl of media were plated in 96-well plates. Drug treatment and viability analysis was conducted as described above. Dose-response curves were generated using Graphpad Prism with Michaelis-Menten kinetics (Graphpad Software, Inc., San Diego, CA, USA).

Lysates were prepared from subconfluent cells using NP40 lysis buffer (1.0% NP40, 150 mM NaCl, 50 mM Tris-HCl pH 7.4, 5 mM EDTA, 10% glycerol) with phophatase and protease inhibitors added. Lysates were transferred to polyvinylidine fluoride membranes and blocked in 5% nonfat milk in phosphate-buffered saline (PBS) with 0.1% Tween-20 (PBST). The primary antibodies used recognize GLI1, pEGFR, and ERBB2 (Cell Signaling Technology, Danvers, MA, USA) or epidermal growth factor receptor (EGFR), glyceraldehyde phosphate dehydrogenase (GAPDH) (Santa Cruz Technology, Santa Cruz, CA, USA). Membranes were washed with PBST and incubated with horseradish peroxidase-conjugated secondary antibodies. Gli1 blots were blocked in 5% bovine serum albumin (BSA).

Analysis of published expression data (Gene Expression Omnibus: GSE18229) from 337 mammary tumors and primary tissue was conducted using the UNC337 dataset [5]. The expression level of GLI1 across the predefined subtypes was determined for each dataset following median centering using GEO2R. Results were analyzed by one-way analysis of variance (ANOVA).

The following short hairpin (sh)RNA) sense sequences were cloned into the pSIREN-RetroQ (BD Biosciences, Franklin Lakes, NJ, USA) shRNA-expressing retroviral vector: GLI1 #1: CCCAGATGAATCACCAAATTCAAGAGATTT [25] and #2: AAGCGTGAGCCTGAATCTGTG [26]. RELA: GCTGTGTTCACAGACCTGGCATCCGTCGA [27]. NFKB1: GCCAGAGTTTACATCTGA [28]. The negative control vector contains a scrambled sequence of a luciferase-directed shRNA (BD Biosciences).

For inducible shRNA-expressing viruses targeting RELA, the RHS4430-200223785 and RHS4430-200229897 GIPZ clones were purchased from Thermo Fisher Scientific (Waltham, MA, USA) and cloned in to pInducer10 via MluI and XhoI. Non-targeting sense sequence was 5′-GGATTCCAATTCAGCGGGAGCCTG-3′ [29]. Virus was produced by co-transfection of the pInducer10 constructs and packaging plasmids into 293 T cells. Virus was harvested and concentrated, and cells were infected and selected as described above. To induce expression of the hairpin, cells were treated with 1 μg/ml doxycycline for three days.

shRNA-expressing retroviruses were produced by co-transfection of the retroviral plasmids, pVSV-G and pCL-ECO (Clontech, Mountain View, CA, USA), into HEK 293 T cells (ATCC) using FuGene6 (Roche, Basel, Switzerland). Retrovirus was harvested in OptiMEM (Invitrogen) for five days, pooled, and concentrated with Centricon plus-20 columns (Millipore, Billerica, CA USA). Cells were infected at a multiplicity of infection of approximately five and selected in medium containing 0.6 μg/ml puromycin for at least three days before use.

Cells infected with retrovirus were plated in 6-well dishes in medium containing 0.6 μg/ml puromycin. Every 24 hours, one well was trypsinized and counted using a Countess tissue culture counter (Invitrogen, Carlsbad, CA, USA).

Retrovirally infected cells were selected for three days in medium containing 0.6 μg/ml puromycin, and plated in an 8.0 μm pore cell culture insert (BD Biosciences) in medium containing 1% fetal bovine serum (FBS), above medium containing 10% FBS. After 12 h, cells were scraped from the inside of the insert, and the insert was stained using Diff-Quik (Siemens, Erlangen, Germany). Cells in at least five fields of view were counted for each insert.

Retrovirally infected cells were selected for three days in medium containing 0.6 μg/ml puromycin and plated at limiting dilutions in growth medium containing 0.6 μg/ml puromycin. Colonies were grown for 12 to 14 days, stained with Diff-Quik (Siemens), and counted under light microscopy.

A total of 40,000 cells were plated on 60 mM ultra-low attachment plates (Corning, Inc., Corning, NY, USA) in 4 mL of mammosphere growth medium (mammary epithelial basal medium (Lonza Group Ltd, Basel, Switzerland) with B27 supplement (Invitrogen), EGF (20 ng/mL), bFGF (20 ng/mL), heparin (7 μg/ml), and penicillin/streptomycin with 0.5% methylcellulose, adapted from [30]). Medium was replaced every 48 hours for 12 days, and spheres were counted under light microscopy.

For secondary sphere formation, primary sphere cultures were filtered using a 70 μm nylon cell strainer, to retain spheres of larger than 70 μm in diameter. Spheres were trypsinized until they dissociated to single cells. Cells were counted, and 20,000 cells were plated on the ultra-low attachment plates, following the same conditions as listed above for primary sphere formation.

Cells were plated at 5 × 10⁴ cells/well in 6-well format and allowed to adhere overnight. The following day, cells were treated with 0.02 μM JK184 or 0.0002% DMSO vehicle control. After four days, floating cells were combined with adherent cells harvested by trypsinization and analyzed by flow cytometry using the BD Biosciences Pharmingen (San Diego, CA, USA) FITC Annexin V Apoptosis Detection Kit I. Samples were analyzed with the BD FACScaliburS flow cytometer with recording of 15,000 events per sample. Each line was treated independently and analyzed in three biological replicates. Gates were based on negative control signals, and plots generated using FlowJo 8.8.2 (Tree Star, Inc., San Carlos, CA, USA).

MDA.MB.436 cells with shGLI1 or control shRNA were trypsinized, washed twice in sterile 1 × PBS, and resuspended 1:1 in growth factor reduced matrigel (BD Biosciences). Cells were maintained on ice until injection. 2 × 10⁶ control (NT) cells were injected into the right fourth mammary fat pad of five-week-old female NOD/SCID mice (NOD.CB17-Prkdcscid/J, The Jackson Laboratory, Bar Habor, ME, USA). A contralateral injection was conducted, with 2 × 10⁶ shGLI1 cells injected into the left fourth mammary fat pad of each mouse.

Tumor growth was monitored using digital calipers, and tumor volume was calculated using the formula: W² × L × 0.5, where L is the longer dimension and W the shorter. After seven weeks, animals were sacrificed and the tumors excised and weighed.

Cells were plated on glass chamber slides. The next day cells were washed twice with PBS and fixed in 2% paraformaldehyde with 0.1% Triton-X-100 in PBS for 15’ at room temperature (RT). Cells were washed twice in PBS, and quenched in 100 mM glycine in PBS for 5’ at RT. The slides were washed in PBS and permeabilized in 0.1% Triton-X-100 in PBS for 15’ at RT with humidification, followed by blocking in 5% BSA in PBST for 30’ at 37°C with humidification. Primary antibodies against p50 and p65 (Cell Signaling Technology) were diluted 1:250 with PBST and incubated overnight at 4°C with humidity. Slides were washed thrice with PBST, and incubated with Alexa Fluor 594-conjugated secondary antibody (Invitrogen) diluted 1:1000 in PBST for 1 h at RT. Slides were washed thrice with PBST and PBS, and mounted with Prolong Gold (Invitrogen).

ChIP was performed according to published protocols with minor modifications [31]. Briefly, cells grown to 80% confluency were fixed in 1% formaldehyde for 10’ at RT, followed by 0.125 M glycine quench. Plates were rinsed twice with PBS, and adherent cells were scraped in ice-cold PBS and collected by centrifugation. Cells were lysed on ice in buffer with protease inhibitors (5 mM PIPES pH 8, 85 mM KCl, 1% v/v igepal) using a dounce homogenizer. After centrifugation, the nuclei pellet was lysed on ice in buffer containing protease inhibitors (50 mM Tris-HCl pH 8, 10 mM EDTA, 1% w/v SDS). The chromatin was sonicated on ice for 15’ with a 30″-on/30″-off cycle using a Biorupter UCD-200 (Diagenode Inc., Denville, NJ, USA) set to high. The chromatin was cleared by centrifugation, and for each ChIP from 10⁷ cells was diluted to 1 mL with buffer containing protease inhibitors (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% v/v igepal, 0.25% w/v deoxycholic acid, 1 mM EDTA, pH 8). Antibody was added (Histone H3, p65, and IgG from Cell Signaling Technology) and incubated at 4°C overnight on a rotating platform.

A total of 30 μl of magnetic protein G beads (Cell Signaling Technology) were added to each ChIP, and incubated on a rotating platform for 2 h at 4°C. Beads were washed twice with dilution buffer, three times with 100 mM Tris-HCl pH 9, 500 mM LiCl, 1% v/v igepal, 1% w/v doxycholic acid, and once with 100 mM Tris-HCl pH 9, 500 mM LiCl, 150 mM NaCl, 1% v/v igepal, 1% w/v doxycholic acid. Antibody/chromatin complexes were eluted in 100 μl buffer (50 mM NaHCO₃, 1% w/v SDS) for 1 h at RT. The samples were adjusted to 0.54 M NaCl, and incubated at 67°C overnight to reverse the crosslinks.

HMLE-shEcad cells are HMLE with E-cadherin knockdown [21], which results in EMT associated with mesenchymal-like and stem-like characteristics [7],[22]. In order to identify possible drivers of proliferation, these cells were assayed for growth inhibition by a panel of 150 compounds at 16 doses each. Overall, the HMLE-shEcad cells were more resistant to this panel of inhibitors than were the control HMLE-shGFP cells (Figure 1A and Table S1 in Additional file 1). In every case where the response between the two cell lines differed by an IC₅₀ value of more than 0.01 μM for standard of care therapies for triple-negative breast cancer, the HMLE-shEcad cell lines had a poorer response (higher IC₅₀ value) than the control cell line.

Interestingly, epidermal growth factor receptor (EGFR) inhibitors erlotinib and gefitinib profoundly inhibited the proliferation of the control cell lines, while the EMT cell lines were resistant to this treatment, with neither EGFR inhibitor approaching 50% growth inhibition at concentrations up to 10 μM (Figure S1A-C in Additional file 1). In follow-up studies we observed that despite having an intact EGFR pathway, HMLE-shEcad cells lack high levels of baseline phosphorylated EGFR, and have lower levels of EGFR overall, possibly rendering them immune to EGFR-inhibitor treatment, and suggesting that the cells do not rely on EGFR signaling for survival. ERBB2 levels do not differ between control or EMT cells (Figure S1D-F in Additional file 1). The lack of response to EGFR inhibition is in concordance with the recent finding that activation of the EMT program effects a shift from EGFR to platelet-derived growth factor receptor (PDGFR) signaling [32].

While the HMLE-shEcad cells were more resistant overall to the panel of inhibitors, there were a few compounds that selectively inhibited the growth of the EMT cells compared to controls. One such agent was the GLI1 inhibitor JK184 [33], which was more active against HMLE-shEcad cells than controls. The IC₅₀ value for JK184 was 3.5-fold lower for the HMLE-shEcad cells compared to the control HMLE-shGFP cell line (0.004 μM compared to 0.014 μM, Figure 1B). The dose-response curve for the HMLE-shEcad cells was shifted to lower doses compared to the HMLE-shGFP curve, indicating a concentration window between 0.001 to 0.1 μM in which JK184 is more effective on the EMT cells. This selective sensitivity to the GLI1 inhibitor was confirmed in another EMT cell line, HMLE-Snail [22], which was similarly more sensitive to JK184 compared to HMLE-pBP control cells (Figure 1C). Immunoblot and real-time PCR analysis indicated that both EMT cell lines have higher protein and transcript levels of GLI1 than controls, as well as elevated levels of GLI2, while the extent of GLI3 expression was consistent across the cell lines (Figures 1D and 2B).

Treatment of both EMT cell lines with the IC₂₅ and IC₅₀ doses of JK184 yielded a dose-dependent decrease in GLI1 protein and transcript levels (Figure 1D-E). GLI1 positively regulates its own transcription [34], so it is likely that the JK184-dependent decrease in GLI1 transcript and protein levels arises from decreased activity of the JK184 target GLI1. GLI2 and GLI3 are not direct targets of GLI1, and neither GLI2 nor GLI3 transcript levels were affected in JK184-treated HMLE cells (Figure S2A-B in Additional file 1).

We next determined if Gli expression is associated with a particular breast cancer subtype. Using a previously published dataset, cell lines were clustered based on CD24, CD44, E-cadherin (CDH1), and CLDN3, 4, and 7 expression status [35]. This reveals a subgroup of basal B cell lines identified as claudin-low [5],[36]. Claudin-low tumors express decreased levels of CDH1, are enriched for EMT markers, and are CD24 low/CD44 high, which are features of self-renewing breast cancer stem cells [5].

Within the basal subtype, the claudin-low cells generally express higher levels of GLI1, GLI2, and GLI3 (Figure 2A). We confirmed this expression data in several claudin-low cell lines, and found that similarly to the EMT cell lines, claudin-low cells express higher transcript levels of the Gli family of transcription factors than do MCF10a cells, an immortalized but non-tumorigenic mammary cell line (Figure 2B). Additionally, claudin-low cell lines have higher protein levels of GLI1 than do MCF10a cells (Figure 2C).

Given the elevated expression levels of GLI1 we observed in claudin-low cell lines, we determined if claudin-low tumors display similarly elevated GLI1 levels. An analysis of a published dataset of over 330 tumors, including 37 claudin-low tumors, revealed elevated GLI1 expression levels in claudin-low tumors compared to basal tumors (P = 0.001, Figure 2D). Some luminal A tumors express GLI1, which mirrors the expression data for the cell lines (Figure 2A).

Since claudin-low cell lines and tumors preferentially express GLI1 transcripts, and claudin-low cells are transcriptionally similar to the JK184-sensitive EMT cells, we determined the dose-sensitivity of claudin-low cell lines to JK184. Overall, claudin-low cell lines are more sensitive to JK184 treatment than are MCF10a, MTSV1-7, or HMLE-shGFP and HMLE-pBP cells, and JK184 induced a dose-dependent decrease in GLI1 transcript and protein levels in these cells (Figure 3A-C). GLI2 and GLI3 levels were not significantly altered with JK184 treatment (Figure S2C-D in Additional file 1). Taken together, these data establish similar patterns of GLI1 signaling and GLI1 inhibitor sensitivity in EMT and claudin-low cell lines, providing further evidence for the similarity of EMT and claudin-low cells.

Since JK184 treatment reduced cell accumulation, we identified whether there is an elevated rate of apoptosis in JK184-treated cells. Treatment with the IC₅₀ dose of JK184 enhanced the proportion of HMLE-shEcad cells that stained with Annexin-V, but were negative for propidium iodide (PI) (P <0.0001, t test; Figure 3D). This staining pattern is consistent with early-apoptotic cells, while PI-positive or dual-stained cells indicate apoptosis and/or necrosis. JK184-treated cells were sparser and less well spread than vehicle-treated counterparts (Figure 3D). JK184 treatment did not significantly affect the staining of HMLE-shGFP cells or their morphology (Figure 3D). Over four days of treatment there was increased cell death of the BT549 cells, as increased Annexin-V and PI staining were observed in treated cells, and these cells appeared rounded up compared to vehicle-treated counterparts (P = 0.001, t test; Figure 3D).

Given the markedly elevated GLI1 levels observed in the claudin-low subtype, we wanted to determine the biological importance of GLI1 in claudin-low cell lines. We investigated the effects of GLI1 knockdown on aggressive characteristics of claudin-low tumor cells, including proliferation, migration, and anoikis. GLI1 has been implicated in several of these processes in transformed cells [37] and in some breast cancer cell lines [38]. Since there did not always appear to be a direct correlation between expression levels of GLI1 and sensitivity to JK184 treatment, and to avoid possible off-target effects of JK184, we utilized a specific genetic approach to reduce GLI1 expression. Two different shRNA viruses both induced stable, specific knockdown of GLI1 protein (Figure 4A) and transcript levels (Figure 4B). Neither GLI2 nor GLI3 transcript levels were affected by GLI1 knockdown (Figure S2E-F in Additional file 1). Knockdown of GLI1 in MDA.MB.157 cells resulted in cells that appeared rounder and less elongated compared to cells with control knockdown, which maintained the long spindle shape characteristic of mesenchymal cells (Figure 4C). MDA.MB.157 cells have an extended doubling time of greater than 60 hours, so we therefore evaluated the biological effects of GLI1 knockdown in two other claudin-low cell lines with high GLI1 expression, BT549 and MDA.MB.436 cells. Knockdown of GLI1 greatly reduced the growth rates of these cell lines compared to cells expressing the non-targeting shRNA (Figure 4D-E). Proliferation of MCF10a cells, which do not express endogenous GLI1, was not significantly affected by infection with the shGLI1 retrovirus (Figure S3F in Additional file 1). The proliferation of the immortalized human mammary epithelial cell line MTSV1-7 was significantly, though slightly, impaired following GLI1 knockdown. These cells do express some GLI1 (Figure S3A-C, F in Additional file 1).

GLI1 knockdown significantly reduced the transwell migration of BT549 and MDA.MB.436 cells in response to an FBS gradient with both GLI1 knockdown constructs used (Figure 5A). The low FBS in the top chamber of the transwell (1%) and the relatively short assay time (12 h) minimized the impact of reduced proliferation resulting from GLI1 knockdown. MCF10a cells were not affected (Figure S3E in Additional file 1).

In clonogenicity assays, knockdown of GLI1 reduced colony formation of BT549 and MDA.MB.436 cells (Figure 5B), whereas MCF10a cells were largely unaffected (Figure S3D in Additional file 1). Mammospheres are derived from mammary cells grown under non-adherent conditions. They are enriched in early progenitor/stem cells and are able to differentiate along all three mammary epithelial lineages [30]. The sphere-initiating subset of mammary cells have cancer stem cell-like characteristics, including the ability to self-renew and to differentiate into mature mammary cells that lack stem cell features [16],[30]. We did not observe any significant sphere formation resulting from either the control HMLE-shGFP or HMLE-pBP cell lines, as has been previously reported [22]. We also did not achieve significant levels of spheres resulting from BT549 cells, despite their tumorigenicity [39]. Therefore, we first investigated the effects of GLI1 knockdown on the sphere-forming ability of MDA.MB.436 cells. GLI1 knockdown reduced primary and secondary sphere formation by MDA.MB.436 cells (Figure 5C). Secondary sphere formation is a measure of the self-renewal capacity of the sphere-forming cells. The ability of the cells to form secondary spheres was enhanced compared to primary sphere forming ability, producing on average 454 secondary spheres from 20,000 plated cells (0.055%), compared to the average primary sphere forming ability of 254 spheres from 40,000 plated cells (0.006%). These data, combined with the higher GLI1 transcript and protein levels we observed in spheres derived from EMT and/or claudin-low cells compared to control adherent cells (Figure 5D) indicates that GLI1 is important for formation of spheres. Elevated GLI1 levels were seen in primary mammospheres formed from normal and tumorigenic breast tissue from a published dataset (Figure 2D). Higher levels of GLI1 transcripts in mammospheres compared to differentiated mammary cells has been reported [16],[40], but we observed that GLI1 levels in mammospheres are even higher than those in EMT cells grown under adherent conditions.

We also wanted to investigate the effects of GLI1 knockdown in a basal cell line, HCC1806, which expresses elevated levels of GLI1 (Figure S3A-C in Additional file 1). Significantly fewer spheres resulted from cells in which GLI1 expression was reduced compared to controls (Figure S3G in Additional file 1). Additionally, similarly as to seen with the MDA.MB.436 cells and the EMT cell lines, there was significantly more GLI1 expression from HCC1806 cells grown as spheres compared to those grown under adherent conditions (Figure S3H in Additional file 1). This is further evidence that GLI1 is activated and functionally important in sphere-initiating and/or early progenitor cells across a spectrum of cell lines.

Having shown that GLI1 is essential for the aggressive and stem-like characteristics of claudin-low cell lines in vitro, so we next examined the effects of GLI1 knockdown in vivo. While previous studies have highlighted the ability of ectopic GLI1 expression to form tumors in vivo[15],[40], we wanted to investigate the effects of GLI1 knockdown on the tumor-forming abilities of claudin-low MDA.MB.436 cells as orthotopic xenografts. While all shGLI1 expressing cells eventually formed tumors, GLI1 knockdown tumors were smaller on average than tumors resulting from contralateral control knockdowns (Figure 5E, panel I and II). Similar results were seen for an independent biological replicate (Figure 5E, panel III, and Figure S4 in Additional file 1). These data are consistent with reports from other groups, in which knockdown of GLI1 delayed onset of tumor formation from injection of claudin-low SUM1315 cells [40], and reduced the incidence of metastasis to the lung by claudin-low MDA.MB.231 cells [41].

Whereas JK184 reduced GLI1 levels, cyclopamine, which inhibits the Hh pathway through SMO, did not affect proliferation or GLI1 levels in EMT cells (Figure 6A-C). Additionally, two other SMO inhibitors in our screen had no effect on accumulation of EMT cells (Figure 6A). The ineffectiveness of cyclopamine on GLI1 expression is consistent with published results for breast cancer cell lines including SUM149, T47D, MCF7, and MDA.MB.231 [38],[40],[42]. Taken together, these data indicate that the elevated GLI1 levels in EMT and claudin-low cell lines are not caused by classical activation of the pathway through SHH-PTCH1-SMO. Non-canonical activation of the Hh pathway can occur with activation of the Gli family, mainly GLI1, by MAPK/ERK [43], AKT [44], KRAS [45], mTOR/S6K1 [46], and more recently NRP2 [40]. The mechanisms of SMO-independent upregulation of GLI1 are poorly understood.

To determine which upstream pathways are responsible for elevated GLI1 in claudin-low and EMT cells, we screened several candidate molecules for reduction of GLI1 expression (Figure S5A-B in Additional file 1). Triptolide, an NFκB inhibitor [47]-[49] reduced GLI1 transcript and protein levels in both HMLE-shEcad and BT549 cell lines (Figure 6D-E). The activity of triptolide as an NFκB inhibitor was confirmed by means of a reporter assay (Figure S5C in Additional file 1).

Since we observed these effects without stimulation or activation of the NFκB pathway, we hypothesized that NFκB is basally activated in our cells. Normally, NFκB subunits are sequestered in the cytoplasm due to inhibitory interactions with IκB. However, we observed that both the p65 and p50 subunits of NFκB present in the nucleus of EMT cells, while they are restricted to the cytoplasm of the HMLE control cell lines (Figure 7A). p65 and p50 show a similar localization pattern for claudin-low versus MCF10a cells (Figure S6 in Additional file 1). These data suggest that NFκB is basally present in the nucleus of EMT and claudin-low cells, and active even without stimulation by a proinflammatory agent, in agreement with some earlier reports describing constitutive NFκB activity in basal cell lines [50]-[52].

The effects of triptolide on the expression levels of GLI1 suggest that NFκB could act as a transcription factor to regulate GLI1 expression. We searched the genomic region surrounding the transcription start site of GLI1 for potential κB binding sites using SABiosciences DECipherment of DNA Elements (DECODE) system which searches for predicted binding sites of transcription factors using data from the ENCODE project consortium and the UCSC Genome Browser. Six potential κB binding sites were identified that matched the consensus κB binding sequence (Figure 7B). In order to determine if NFκB binds to the GLI1 promoter we conducted ChIP experiments using primer sets designed to amplify each predicted binding site. Binding of the p65 subunit of NFκB to the first predicted κB binding site (chr12: 57851125–57851134) was enriched over the other binding sites in unstimulated HMLE-shEcad cells (Figure 7C). The binding of histone H3 to the six potential κB binding sites as well as to GAPDH serves as a positive control for the ChIP experiment (Figure 7C).

We also observed enrichment of p65 subunit binding to Site 1 in HMLE-Snail, BT549, and MDA.MB.436 cells (Figure S6B in Additional file 1). We did not detect enhanced binding of p65 subunits to Site 1 in the GLI1 promoter of HMLE-shGFP or HMLE-pBP cell lines, despite observing enriched binding of histone H3 with Site 1, which serves as a positive control for the ChIP experiment (Figure S7A in Additional file 1). Overall the ChIP data suggest that there is crosstalk between NFκB and GLI1 signaling in EMT and claudin-low cell lines.

Since the NFκB inhibitor triptolide decreased the expression level of GLI1, we determined the impact of triptolide treatment on binding of p65 to the GLI1 promoter. 1 μM triptolide treatment for six hours caused a 70% reduction in binding of p65 to Site 1 in the GLI1 promoter of HMLE-shEcad cells compared to control vehicle treatment (Figure 7D). This supports the conclusion that triptolide decreases GLI1 expression by inhibiting binding of NFκB transcriptional complexes to the GLI1 promoter.

Although triptolide has been shown to inhibit NFκB, it is not entirely specific. In order to reinforce the connection between NFκB and elevated GLI1 levels, we determined the impact of NFκB knockdown on GLI1 expression. Combined reduction of RELA of approximately 60%, and of NFKB1 by 40% reduced GLI1 expression at both the protein and transcript level in HMLE-shEcad cells (Figure 7E-F) and similar results were seen with knockdown of both NFκB subunits in MDA.MB.436 cells (Figure S7C in Additional file 1). Doxycycline-inducible knockdown of RELA of approximately 75% with two separate hairpins reduced GLI1 expression (Figure S7D in Additional file 1). Hence, GLI1 is regulated by NFκB in claudin-low and EMT cells.