SAXS Analysis of CYT-18 and Its CTD

First, we used SAXS to investigate the conformational changes of CYT-18 and the position of its CTDs in the absence and presence of a group I intron RNA. Scattering data were collected for three CYT-18 constructs: CYT-18*, a wild-type protein truncated to delete most of the non-essential C-tail in order to simplify modeling and analysis; CYT-18 NTDs, which contains the N-terminal catalytic and α-helical domains, but lacks both the CTD and C-tail; and CTD, the isolated C-terminal anticodon-binding domain (Figure 1C). CYT-18* is fully active in tyrosyl-adenylation, which measures the number of TyrRS active sites, and it functions similarly to full-length CYT-18 both in aminoacylation of Escherichia coli tRNA^Tyr, a standard substrate for this protein, and in splicing the N. crassa mt large subunit rRNA (Nc mt LSU) intron, which requires a functional CTD (Figure S1). The CYT-18 NTDs construct is also fully active in tyrosyl-adenylation, but cannot aminoacylate tRNA^Tyr as expected because of the lack of the CTD (Figure S1A and S1B) [30].

Figure 2 shows SAXS curves for all three proteins, and Table 1 summarizes size parameters calculated from the SAXS curves, including the protein molecular weight; the maximum dimension of the particle (D_max); and the radius of gyration (R_g), which is the root mean square distance to the center of mass of a particle and provides an estimate of the overall particle size [42]. For all three proteins, Kratky plots of the SAXS data show a bell shape curve with a distinct peak, indicative of a folded globular protein (Figure S2).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 2. SAXS analysis of the CYT-18 protein constructs.

(A) Scattering curves for the CYT-18 NTDs, CTD, and CYT-18*. The plots show the log of the scattering intensity (I, arbitrary units [a.u.]) as a function of momentum transfer (q = 4πsin(θ)/λ) and are displaced along the y-axis for visualization. The top and middle curves for CYT-18 NTDs and CTD show the SAXS data (black) overlaid with the expected scattering profiles calculated by CRYSOL from the CYT-18 NTDs crystal structure (blue, PDB:1Y42; χ = 1.9) or a CYT-18 CTD homology model based on the A. nidulans mtTyrRS CTD NMR structure (red, PDB:2KTL; χ = 2.8), respectively. The bottom curve for CYT-18* shows the SAXS data (black) overlaid with the calculated scattering profile for the CORAL model of this protein (gray; χ = 1.8). (B) Normalized pair distance distribution functions (P(r)) calculated from the scattering profiles by AUTOGNOM for CYT-18 CTD (red), CYT-18 NTDs (blue), and CYT-18* (gray). The P(r) curves for the CYT-18 NTDs and CTD are single peaks with a short tail, consistent with an elongated protein shape. (C–E) Ab initio models built by DAMMIN with the fit of the SAXS envelope to the corresponding high-resolution structure (CYT-18 NTDs), homology model (CYT-18 CTD), or CORAL model (CYT-18*) superimposed by SUPCOMB shown below the model [85]. The χ values shown in parentheses in the figure indicate the fit of the ab initio models to the scattering data.

https://doi.org/10.1371/journal.pbio.1002028.g002

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 1. Size parameters determined from SAXS data.

https://doi.org/10.1371/journal.pbio.1002028.t001

Focusing first on the CYT-18 NTDs protein, the scattering curve overlays well (χ = 1.9) with a theoretical scattering curve calculated from the previous CYT-18 NTDs crystal structure [33] by using the program CRYSOL (Figure 2A, top curve) [43]. The SAXS curve gave an estimated molecular weight of 84.4 kDa and R_g and D_max values of 35.6 and 123 Å, respectively, in good agreement with the molecular weight calculated from protein sequence (89.6 kDa) and with R_g and D_max values calculated from the crystal structure using CRYSOL (35.2 and 125 Å, respectively) (Table 1). The distance distribution function P(r) for the CYT-18 NTDs displays a single peak with a tail (Figure 2B), a pattern indicative of a protein having an elongated structure [44]. Ab initio models of the CYT-18 NTDs protein were built from the SAXS data by simulated annealing of either dummy atoms by DAMMIN or a chain-like ensemble of dummy residues by GASBOR (Figures 2C and S3, respectively) [45],[46]. The DAMMIN and GASBOR models show good fits to the experimental SAXS curve (χ = 1.8 for both models) and are similar in shape to each other and to the high-resolution structure as shown by the superposition of the crystal structure within the SAXS model envelopes. The final DAMMIN and GASBOR models are the result of analyzing multiple solutions and either averaging the models (DAMMIN) or picking the most representative one (GASBOR). The normalized spatial discrepancy (NSD) value, which describes the similarity between the different models produced by the programs, is low for both the DAMMIN and GASBOR models (0.63±0.03 and 1.10±0.02, respectively), indicating that the multiple solutions built by the programs are similar to each other (Table 2). Taken together, these results indicate that the conformation adopted by CYT-18 NTDs in solution is similar to that in the crystal structure [33].

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Table 2. χ and NSD values for protein ab initio models.

https://doi.org/10.1371/journal.pbio.1002028.t002

The SAXS data for the isolated CTD overlays well with a theoretical scattering curve calculated from a homology model of CYT-18's CTD constructed from the NMR structure of the A. nidulan CTD using I-TASSER (χ = 2.8) (Figure 2A, middle curve) [47]. The molecular weight of 13.3 kDa estimated from the scattering data (Table 1) indicates that the CTD is monomeric in solution. The R_g and D_max values for the CTD calculated from the SAXS data (17.7 and 62 Å, respectively) are in good agreement with those for the I-TASSER model (17.0 and 55.9 Å, respectively) (Table 1). The DAMMIN and GASBOR models of the CYT-18 CTD (χ = 1.7 and 2.2, respectively) also superpose well with the homology model (Figures 2D and Figure S3, respectively). Thus, the SAXS analysis indicates that the CYT-18 CTD folds independently of the remainder of the protein and that the I-TASSER model provides a good representation of the structure of the CYT-18 CTD in solution. The latter finding validates the use of the I-TASSER model in building high-resolution structures of CYT-18* from the SAXS data (see below).

CYT-18* is the first CYT-18 protein to be investigated structurally that contains both the NTDs and CTD. The molecular weight for this protein estimated from the SAXS data is 119 kDa, confirming that CYT-18* is a dimer in solution (Table 1). The R_g and D_max values from the CYT-18* scattering data are 46.9 and 170 Å, respectively, both larger than that for the CYT-18 NTDs, as expected. Ab initio models of the CYT-18* homodimer indicate an open conformation with both CTDs extending outward from the NTDs (χ = 1.5 and 2.1 for the DAMMIN and GASBOR models, respectively) (Figures 2E and S3). A rigid-body model of CYT-18* was also built by CORAL, which constructs models that fit the SAXS data by combining high-resolution models of individual components, in this case the crystal structure of the CYT-18 NTDs and the I-TASSER model of the CTD (see above), with different conformations of flexible dummy residue linkers [48]. The CORAL model overlays well with the scattering curve (χ = 1.8) (Figure 2A, bottom curve) and superposes well into the SAXS envelopes of the ab initio models (Figures 2E and S3). These findings indicate that in the absence of intron RNA, CYT-18* adopts an S-shaped configuration with the two CTDs of the homodimer extending outward in opposite orientations.

CYT-18 Forms a Compact Structure When Bound to a Group I Intron RNA

The co-crystal structure of the CYT-18 NTDs bound to Twort intron RNA indicated that the RNA binds asymmetrically across the dimer interface and that the structure of the NTDs does not change substantially upon binding the intron RNA [22]. To elucidate interacting regions and conformational changes of the CTDs upon binding to the intron RNA, we obtained SAXS data for complexes of both the CYT-18 NTDs and CYT-18* bound to the same Twort group I intron RNA. The experimental scattering curve of the CYT-18 NTDs+Twort RNA complex overlays reasonably well with the scattering curve calculated from the co-crystal structure (χ = 4.4) (Figure 3A, top curve), and gave R_g and D_max values (39.2 and 137 Å, respectively) in agreement with those calculated from the co-crystal structure (39.1 and 134 Å, respectively) (Table 1). Likewise, a rigid-body model of the CYT-18 NTDs+Twort RNA complex built using CORAL shows a good fit to the experimental SAXS curve (χ = 2.2) (Figure 3B; top curve) and is similar in shape to the co-crystal structure (Figures 3A and 3B, compare insets above the top curves). These findings indicate that the CYT-18 NTDs+Twort RNA co-crystal structure is similar to the structure of the complex in solution and can be used as a component for structural modeling of the CYT-18*+Twort RNA complex from the SAXS data.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 3. SAXS analysis and rigid-body modeling of CYT-18 proteins bound to the Twort ribozyme.

(A, B) Scattering profiles of the CYT-18 NTDs and CYT-18* bound to the Twort ribozyme displaced along the logarithm axis for visualization. (A) shows CRYSOL fits of the SAXS curves (black) to theoretical scattering curves calculated from the CYT-18 NTDs+Twort co-crystal structure (blue; χ = 4.4) and CYT-18+Twort RNA model structure based on biochemical data [37] (gray; χ = 8.8). The CYT-18 NTDs+Twort RNA co-crystal structure and CYT-18+Twort RNA biochemical model structure are shown alongside the plots together with the R_g values calculated from the SAXS data and the structures. (B) shows fits of the SAXS curves (black) to the CORAL models of the CYT-18 NTDs+Twort (blue; χ = 2.2) and CYT-18*+Twort (gray; χ = 3.2). The CORAL models are shown alongside the plots together with the radii of gyration (R_g) calculated from the SAXS data and the models. (C, D) CORAL and biochemical models of the CYT-18+Twort RNA complex, respectively. Three views of the models are shown with the CYT-18 NTDs colored blue and the two CTDs of the homodimer colored red. The unmodeled flexible linkers in the biochemical model are shown as dashed lines. The Twort group I intron RNA is depicted in gray cartoon representation with the P4–P6 domain in orange and the P3–P9 domain in cyan. Parts of intron RNA regions P2, P4–P5, P6–P6a, P8, and P9 are near and potentially interact with the CTDs.

https://doi.org/10.1371/journal.pbio.1002028.g003

Finally, the scattering data for the Twort RNA complex with CYT-18*, which contains both the NTDs and CTD, gave R_g and D_max values of 41.9 Å and 146 Å, respectively (Figure 3A, bottom curve; Table 1). The relatively small difference between these values and those for the CYT-18 NTDs+Twort complex (R_g and D_max values of 39.2 Å and 137 Å, respectively; Table 1) suggests that CYT-18* forms a compact complex with the RNA in which the CTDs make a smaller than expected contribution to the overall particle dimensions. This conclusion was supported by ensemble optimization analysis using the program EOM, which generates a large random pool of conformations and picks an optimized ensemble that best fits the scattering data (see Materials and Methods). This optimized ensemble pool displayed a smaller, tighter range of R_g and D_max values than a random pool of protein-RNA conformations consistent with a compact rigid complex (Figure S4).

A rigid-body model of the CYT-18*+Twort RNA complex built using CORAL indicates that both CTDs are positioned near the Twort intron (Figure 3C). This CORAL model can be compared to a previous model of CYT-18*+Twort built using biochemical data (Figure 3D) [37]. While both the CORAL and biochemical models show that both CTDs are located near the intron RNA, the CORAL model better fits to the scattering data than does the biochemical model (χ = 3.2 and 8.8, respectively). In both models, the CTD of one subunit of the CYT-18 homodimer is close to and may interact with P2, P6–P6a, and P8 of the intron RNA, while the CTD of the other subunit is close to and may interact with P4–P5, and P9 of the intron RNA (Figure 3C and 3D). Considered together, the SAXS analyses indicate that upon binding a group I intron RNA, CYT-18* forms a compact complex in which both CTDs of the CYT-18 homodimer clamp down to interact with opposite ends of the group I intron RNA.

The CYT-18 CTD Is a Non-specific RNA Binding Domain

To investigate how the RNA-binding properties of CYT-18's CTD enable it to interact with the two structurally distinct ends of a group I intron RNA, we analyzed the interaction of the CYT-18 NTDs and the isolated CTD with various RNAs by equilibrium-binding assays at 25°C and 37°C (Figures 4 and S5, respectively). The RNAs compared were three group I introns (the N. crassa mt large ribosomal subunit-ΔORF intron (Nc mt LSU); the N. crassa NADH dehydrogenase subunit 1-ΔORF intron (Nc ND1m); and the Twort intron RNA); a group II intron RNA (Lactococcus lactis Ll.LtrB-ΔORF; Ll.LtrB); and poly(U)₃₀, which presumably lacks higher-order structure.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 4. Equilibrium binding of CYT-18 NTDs and the CTD to various RNAs.

Binding assays of CYT-18 NTDs (blue) or CTD (red) to the (A–C) N. crassa mt LSU (Nc mt LSU), N. crassa ND1m (Nc ND1m), and Twort ribozyme group I intron RNAs, respectively; (D) L. lactis Ll.LtrB group II intron RNA; and (E) poly(U)₃₀. For the binding assays, ³²P-labeled RNAs were incubated with increasing concentrations of protein at 25°C for 30 min, a time verified to be sufficient to reach equilibrium (see Materials and Methods). The plots show the fraction of RNA bound to a nitrocellulose filter as a function of protein concentration with the CYT-18 NTDs-group I intron binding data fit to hyperbolic curves and the CYT-18 NTDs-Ll.LtrB and all CYT-18 CTD-RNA binding data fit to sigmoidal curves. Dissociation constant (K_d) or K_1/2 values and Hill coefficient (n) are shown in (A–E) and are the mean for three experiments with the error bars indicating the standard deviation. Equilibrium-binding assays for the same proteins and RNAs at 37°C are shown in Figure S4.

https://doi.org/10.1371/journal.pbio.1002028.g004

The binding curves for the CYT-18 NTDs to the Nc mt LSU, Nc ND1m, and Twort group I intron RNAs were best fit by hyperbolic functions with K_ds ranging from 200 to 590 nM at 25°C (Figure 4A–4C) and 440 to 740 nM at 37°C (Figure S5A–S5C). The K_d values for the Nc ND1m intron are substantially higher than that calculated from previous k_off measurements, which assumed that the k_on of the construct lacking the CTD is the same as that for the wild-type protein (71±24 pM) [30]. This difference suggests that the CTD might make a major contribution to k_on by mediating the initial interaction with intron RNA substrates. At both temperatures, the strongest binding group I intron RNA was the Nc ND1m intron and the weakest was the Nc mt LSU intron, consistent with previous findings that the CTD is required for tight binding and splicing of the Nc mt LSU, but not the Nc ND1m intron [30]. At 25°C, the CYT-18 NTDs bound the Ll.LtrB group II intron RNA with a K_1/2 = 240 nM, within the range of K_ds for group I intron RNAs, but the binding curve was sigmoidal, with n = 1.6, suggesting cooperative and possibly non-specific binding (Figure 4D), whereas at 37°C, binding of the group II intron RNA was weaker (K_d = 440 nM) and the binding curve was hyperbolic (Figure S5D). The CYT-18 NTDs did not bind appreciably to poly(U)₃₀ at either 25°C or 37°C (Figures 4E and S5E).

Surprisingly, the isolated CYT-18 CTD bound group I and II intron RNAs and poly(U)₃₀ more strongly than did the CYT-18 NTDs and with similar affinities for all five RNAs tested (Figure 4). Indeed, the binding curves for the isolated CTD to these radically different RNAs were remarkably similar to each other, each being sigmoidal with K_1/2s = 57–64 nM at 25°C and 51–77 nM at 37°C. These sigmoidal binding curves (i.e., Hill coefficients (n)>1) suggest cooperative binding of two or more CTDs to each RNA. The ability of the isolated CTD to bind similarly to group I and II intron RNAs, as well as unstructured poly(U)₃₀ indicates that it is a non-specific RNA binding domain.

The Non-splicing S. cerevisiae mtTyrRS Binds Group I Introns Non-specifically Via Its CTD

The finding that the CYT-18 CTD is a non-specific RNA-binding domain led us to wonder whether an ancestral Pezizomycotina mtTyrRS might have initially bound group I intron RNAs non-specifically. To address this question, we turned to the S. cerevisiae (Sc) mtTyrRS, which is closely related to CYT-18 but branched from the Pezizomycotina mtTyrRSs prior to the evolution of splicing activity [23]. We compared two constructs that were expressed in E. coli: recombinant wild-type Sc mtTyrRS and a derivative lacking the CTD (Sc NTDs). We confirmed that both proteins are fully active in tyrosyl-adenylation, indicating correct folding of the catalytic domain (Figure S1A). Aminoacylation assays showed that the Sc mtTyrRS has higher activity with E. coli tRNA^Tyr than does CYT-18 (Figure S1B), possibly reflecting that the E. coli tRNA^Tyr and the Sc mt tRNA^Tyr are more similar to each other than to the Nc mt tRNA^Tyr. All three tyrosyl-tRNAs share the same N73 identity element (A73) and anticodon, but differ in the N1-N72 identity element at the end of the acceptor stem (G-C in E. coli tRNA^Tyr and Sc mt tRNA^Tyr, but A-U in Nc mt tRNA^Tyr) and the length of the variable arm (13–14 nt in E. coli tRNA^Tyr and Sc mt tRNA^Tyr, but unusually long at 16 nt in Nc mt tRNA^Tyr) (Figure S6) [49]–[51].

Equilibrium binding assays showed that the Sc mtTyrRS, although incapable of splicing group I intron RNAs [23], can bind both the Nc mt LSU group I intron RNA and Ll.LtrB group II intron RNA with K_ds = 430 and 440 nM, respectively (Figure 5A and 5B), within the range of K_ds for specific binding of CYT-18 NTDs to group I intron RNAs (see above). However, the similar affinity of the Sc mtTyrRS for the group I and group II intron RNAs suggests that this binding is non-specific. Strikingly, the ability of the Sc mtTyrRS to bind group I and II intron RNAs was entirely dependent upon its CTD, with the Sc NTDs protein showing no detectable binding of either intron RNA over the concentration range tested (Figure 5A and 5B).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 5. Equilibrium binding of the non-splicing S. cerevisiae mtTyrRS and its CTD to various RNAs.

(A, B) Binding of Sc mtTyrRS (orange) and Sc NTDs (green) to the Nc mt LSU group I intron and L. lactis Ll.LtrB group II intron, respectively. (C) Binding of the CTD of the yeast mtTyrRS to the Nc mt LSU (blue), Nc ND1m (black), and Twort group I introns (pink); the Ll.LtrB group II intron (green); and poly(U)₃₀ (purple). Binding assays were done at 25°C, as described in Materials and Methods. K_d or K_1/2 values and Hill coefficients (n) are shown in boxes in (A–C) and are the mean for three experiments, with the error bars indicating the standard deviations. The Sc NTDs protein showed no detectable binding (n.b.) over the protein concentration range tested.

https://doi.org/10.1371/journal.pbio.1002028.g005

To investigate if the Sc mtTyrRS CTD is a non-specific RNA-binding domain like CYT-18's CTD, we expressed and purified this domain separately including a small segment of the upstream linker region (denoted Sc CTD). We then assayed equilibrium binding of the Sc CTD to three group I introns (Nc mt LSU, Nc ND1m and Twort), a group II intron (Ll.LtrB), and poly(U)₃₀ at 25°C. These assays showed that the Sc CTD is capable of binding all the RNAs tested with K_d or K_1/2 values ranging from 110 nM to 1 µM (Figure 5C). The Sc CTD had the highest affinity for the Ll.LtrB group II intron RNA (K_1/2 = 110 nM), which it bound in a cooperative manner (n = 1.8), and the lowest affinity for poly(U)₃₀ (K_1/2 = 1 µM; n = 1.6). Notably, for all RNAs tested, the non-specific binding by the isolated Sc mtTyrRS CTD is 1.5- to 15-fold weaker than the binding of CYT-18's CTD to the same RNA (K_1/2s at 25°C = 57–64 nM) (Figure 4). Together, these findings indicate that the CTD of the Sc mtTyrRS is also a non-specific RNA-binding domain and that the Sc mtTyrRS binds both group I and group II intron RNAs non-specifically via its CTD.

Splicing Properties of CYT-18/Sc mtTyrRS Chimeric Proteins

Finally, we investigated whether the Sc CTD could replace the CYT-18 CTD to promote group I intron splicing by making CYT-18/Sc mtTyrRS chimeric proteins. Two chimeric constructs were made differing in whether they contain the flexible linker region from CYT-18 or the Sc mtTyrRS (Figure 6). Chimera 1 consists of the CYT-18 catalytic and α-helical domains fused to the Sc CTD via the Sc mtTyrRS linker region, whereas chimera 2 contains the same CYT-18 NTDs fused to the Sc CTD via the CYT-18 linker, which includes Ins 3. Both chimeric proteins showed tyrosyl-adenylation activity similar to wild-type CYT-18, but displayed differences in aminoacylation activity (Figure 7A and 7B). Chimera 1, which contains both the Sc mtTyrRS linker and CTD, is similar to the yeast Sc mtTyrRS in having higher aminoacylation activity with E. coli tRNA^Tyr than does CYT-18, likely due to its better recognition of the bacterial tRNA (see above). By contrast, chimera 2, which contains the CYT-18 linker followed by the yeast mtTyrRS CTD, has substantially lower aminoacylation activity than CYT-18, indicating that the CYT-18 linker impairs charging of E. coli tRNA^Tyr. The findings for chimera 1 indicate that higher TyrRS activity with E. coli tRNA^Tyr correlates with presence of the yeast CTD and linker, regions of the TyrRS that recognize the tRNA variable arm and anticodon stem, and not with the catalytic domain, which recognizes the acceptor stem [26],[28],[52]. The Sc mtTyrRS linker may contribute to the recognition of E. coli tRNA^Tyr, either by contacting the tRNA directly or by facilitating binding of the CTD to the variable arm and/or anticodon stem.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 6. Sequence alignments showing the junction regions of CYT-18/Sc mtTyrRS chimeric proteins.

CYT-18 and Sc mtTyrRS C-terminal regions starting from the end of the α-helical domain were aligned to the chimeric proteins using the multiple sequence alignment tool, MUSCLE [86]. The CYT-18 sequence is in black, and the Sc mtTyrRS sequence is in green, with regions corresponding to the CYT-18 CTD insertions in red boxes. The secondary structure of the CYT-18 CTD predicted by I-TASSER is shown above the CYT-18 CTD sequence as either black helices or arrows representing β-sheets. The first residues of the CYT-18 and Sc CTD constructs are highlighted in orange, and the last residue of the CYT-18* construct highlighted in blue.

https://doi.org/10.1371/journal.pbio.1002028.g006

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Figure 7. Biochemical analysis of CYT-18/Sc mtTyrRS chimeric proteins.

Chimera 1 consists of the CYT-18 NTDs fused to the Sc mtTyrRS linker region and CTD, while chimera 2 consists of the CYT-18 NTDs and linker region (including Ins 3) fused to Sc CTD. Tyrosyl-adenylation, aminoacylation, and RNA-splicing assays were done at 30°C, as described in Materials and Methods. (A) Tyrosyl-adenylation activity is displayed as a bar graph showing the mean for three experiments, with the error bars indicating the standard deviation. (B) Aminoacylation assay showing the formation of [³H]-Tyr-tRNA^Tyr over a 60-min time course (black open circles, wild-type CYT-18; purple open squares, chimera 1; pink open diamonds, chimera 2; black closed circles, no protein). (C, D) End-point splicing assays of ³²P-labeled precursor RNAs (200 nM) containing the Nc mt LSU and ND1m group I introns, respectively, with 100 nM protein and 1 mM GTP for 60 min at 30°C in splicing reaction medium containing 25 or 100 mM KCl. Additional end-point splicing assays with ³²P-labeled precursor RNA at these protein and RNA concentrations at 25°C and 37°C are shown in Figure S7A and S7B. (E, F) Splicing time courses of ³²P-labeled precursor RNA containing the ND1m intron (200 nM) with 100 nM protein and 1 nM GTP at 30°C in splicing reaction medium containing 25 mM or 100 mM KCl, respectively. The plots show disappearance of precursor RNA as a function of time (black open circles, wild-type CYT-18; purple open squares, chimera 1; pink open diamonds, chimera 2). (G) End-point splicing assays with unlabeled precursor RNA containing 200 nM Nc mt LSU intron and [α-³²P]GTP (500 nM; 3,000 Ci mmol⁻¹) with 500 nM protein. Reactions were incubated for 60 min at 30°C and 37°C. Darker exposures of the same gels are shown below. Minor labeled products in the CYT-18 lanes, including one co-migrating with precursor RNA and others migrating above precursor RNA (not shown), appear in time-course experiments after the 5′-labeled intron products and likely reflect secondary reactions catalyzed by group I intron RNAs (see [87]). The left panel shows splicing reactions for the same concentrations of wild-type CYT-18 protein and ³²P-labeled precursor RNA at 30°C run in parallel as a control. Abbreviations: E1-E2, ligated exons; E1-I, 5′ exon+intron; I, excised intron; I-E2, intron+3′ exon; P, precursor RNA.

https://doi.org/10.1371/journal.pbio.1002028.g007

To determine whether the Sc mtTyrRS CTD could function in splicing, we compared the ability of the chimeric proteins to splice the Nc mt LSU and ND1m group I introns, which do and do not require the CTD for splicing, respectively [30]. Group I introns splice via two sequential transesterification reactions initiated by the addition of guanosine nucleotide to the 5′ end of the intron, resulting in ligated exons and excised linear intron RNA with a non-coded G residue at its 5′ end [53]. The ability of the chimeric proteins to splice the Nc mt LSU and ND1m group I introns was assayed by using 200 nM ³²P-labeled precursor RNA containing the introns, 100 nM protein, and unlabeled GTP at three different temperatures (25°C, 30°C, and 37°C) at either 100 mM KCl (the standard condition for CYT-18) or a lower salt concentration, 25 mM KCl (Figures 7C–7F, S7A, and S7B). The assays showed that the chimeric proteins could splice the Nc ND1m intron, which does not require the CTD, but could not splice the Nc mt LSU intron, which requires the CTD, under all conditions examined. The inability of the chimeric proteins to splice the Nc mt LSU intron was additionally confirmed by splicing assays done with higher protein concentration (500 nM; protein excess conditions) to compensate for potentially weaker binding of the intron RNA by the Sc CTD (Figure S7C), and by using a more sensitive assay in which [α-³²P]GTP is incubated with unlabeled precursor RNA to label the 5′ end of the intron RNA during the first step of splicing (Figures 7G and S7D).

Notably, although the chimeric proteins were capable of splicing the ND1m intron (Figures 7D and S7B), they did so at a slower rate than full-length CYT-18, with the rate decreasing further at higher salt conditions (Figure 7E and 7F). The slower rate of ND1m intron splicing by the chimeric proteins is similar to that found previously for the CYT-18 NTDs alone [30], suggesting that it reflects a lack of contributing but nonessential interactions with the CTD. Interestingly, chimera 2 has higher splicing activity with the ND1m intron than does chimera 1, the reverse of what was found for TyrRS activity (Figure 7B). This finding suggests that the longer CYT-18-linker region, which is present in chimera 2 but not chimera 1, contributes to splicing activity. This contribution could involve either specific or non-specific interaction of Ins 3 with the group I intron RNA or increased conformational flexibility of the CTD due to expansion of the linker. Considered together, the findings for chimera 1 and chimera 2 indicate that although both the Sc mtTyrRS and CYT-18 CTDs bind group I intron RNAs non-specifically, the Sc CTD lacks further adaptations required for group I intron splicing activity.

Recombinant Plasmids

Recombinant plasmids used for protein expression in E. coli are derivatives of the phage T7 promoter-driven expression vectors pET3a, pET11a, or pET11d (EMD Millipore). pEX560, which expresses a wild-type CYT-18 protein (amino acids 33–669), contains the cyt-18 ORF (nucleotides 97–2,010) cloned downstream of the T7 promoter in pET3a [29]. pCYT18/ΔC-tail, which expresses CYT-18* (C-terminal truncation of the non-essential C-tail; amino acids 584–669), was derived from pEX560 by introducing three stop codons (TAATAGTAG) after Leu583 by site-directed mutagenesis (QuikChange; Agilent Technologies). pHISTEV602 expresses the CYT-18 NTDs (C-terminal truncation of both the CTD and C-tail; amino acids 424–669), with an N-terminal tobacco etch virus (TEV) protease-cleavable 6× His-tag. It was constructed by PCR of pEX560 using primers that amplify nucleotides 97–1,251 of the CYT-18 ORF and append NcoI and BamHI sites, and then cloning the resulting PCR product between the NcoI and BamHI sites of pET11d. pCYT18-CTD, which expresses the CYT-18 CTD (amino acids 448–583) with an N-terminal TEV-cleavable 6× HIS-tag, was constructed by PCR of pEX560 using primers that amplify nucleotides 1,342–1,749 of the CYT-18 ORF and append NdeI and BamHI sites, and then cloning the resulting PCR product between the NdeI and BamHI sites of pET11a. All CYT-18 expression constructs lack the mt targeting sequence (amino acids 1–32). Wild-type CYT-18 and CYT-18* have an extra N-terminal methionine, while CYT-18 NTDs and CTD have an extra N-terminal glycine resulting from TEV-protease cleavage of the N-terminal 6× His-tag.

pHISTEVScTyrRS, which expresses the full-length mature S. cerevisiae mtTyrRS with an N-terminal TEV-cleavable 6× HIS-tag, contains Sc mtTyrRS codons 38–492 (lacking the mt target sequence; amino acids 1–37) cloned between the Nco1 and BamHI sites of pET11d [23]. pHISTEVSc/ΔCTD expresses Sc mtTyrRS lacking the CTD (denoted Sc NTDs) and was derived from pHISTEVScTyrRS by using site-directed mutagenesis to add three stop codons (TAATAATAA) after Asp400. pMAL-ScCTD, which expresses the Sc mtTyrRS CTD (denoted Sc CTD), contains Sc CTD codons 414–492 cloned between the BamHI and HindIII sites of pMAL-c2t [75], a derivative of plasmid pMAL-c2x (New England Biolabs) that expresses the protein with an N-terminal maltose-binding protein tag followed by a TEV-protease site.

Chimeric proteins containing the N-terminal catalytic domain of CYT-18 and the CTD of the Sc mtTyrRS were made by overlap PCR. Chimera 1 contains the CYT-18 NTDs (amino acids 33–417) fused to the Sc mtTyrRS flexible linker and CTD (amino acids 397–492). Chimera 2 contains the CYT-18 NTDs and linker including Ins 3 (amino acids 33–451) fused to the Sc mtTyrRS CTD (amino acids 416–492). The chimeric protein ORFs were cloned between the BamHI and HindIII sites of pMAL-c2t (see above), enabling the expression of fusion proteins with an N-terminal TEV-protease cleavable maltose-binding protein tag.

Recombinant plasmids used for in vitro transcription contain group I or II introns cloned downstream of a phage T3 or T7 promoter. pBD5a contains the N. crassa mt large subunit rRNA-ΔORF (Nc mt LSU) intron cloned downstream of a T3 promoter in pBS(+) [19]. Transcription of pBD5a linearized with BanI yields a 503-nt RNA containing a 65-nt 5′ exon, the 388-nt mt LSU intron, and a 50-nt 3′-exon. pND1m contains the N. crassa NADH dehydrogenase subunit 1-ΔORF (Nc ND1m) intron cloned downstream of a T7 promoter in pUC18 [18]. Transcription of pND1m linearized with NdeI yields a 209-nt RNA containing a 6-nt 5′ exon, the 196-nt ND1 intron, and a 7-nt 3′ exon. pTWORT-P2 contains a ribozyme derivative of a group I intron of the Staphylococcus aureus bacteriophage Twort orf142 gene (intron nucleotides 9-250) cloned downstream of a T7 promoter in pUC19 [76]. Transcription of pTWORT-P2 linearized with EarI yields a 242-nt transcript of the Twort ribozyme. pSSltrBΔA contains a derivative of the L. lactis Ll.LtrB-ΔORF intron with a deletion of the branch-point nucleotide to prevent splicing during binding assays cloned downstream of a T7 promoter in pUC19 [77]. Transcription of a DNA template made by PCR of the pSSltrBΔA plasmid (forward primer 5′-ATGAATTCTAATACGACTCACTATAGGGTTATAATTATCCTTACACATCCATAAC and reverse primer 5′-CGCTGCAGAATTGATATCAAAAATGATATG) yields an 807-nt RNA containing a 28-nt 5′ exon, the 749-nt intron, and a 30-nt 3′ exon.

Protein Expression and Purification

Proteins were expressed from the recombinant plasmids indicated above in E. coli HMS174(DE3) (CYT-18, CYT-18*, and CYT-18 NTDs); BL21(DE3) (CYT-18 CTD, chimera 1, and chimera 2); or Rosetta 2(DE3) (EMD Millipore) (Sc mtTyrRS, Sc NTDs, and Sc CTD). Overnight cultures of fresh transformants were inoculated into LB media, and the proteins expressed via auto-induction [78]. Cells expressing CYT-18 and CYT-18* were grown at 35°C overnight with shaking at 260 rpm. Cells expressing all other proteins were grown at 37°C for 4 h then shifted to 25°C overnight with shaking at 260 rpm.

Wild-type CYT-18 and CYT-18* were purified as described [22],[27]. Briefly, cells were lysed by incubation with lysozyme at 1 mg/ml for 30 min followed by polyethyleneimine precipitation to remove nucleic acids, and ammonium sulfate precipitation [27]. The ammonium sulfate pellet was dissolved in 500 mM KCl, 25 mM Tris-HCl (pH 7.5) and then dialyzed overnight in 25 mM KCl, 25 mM Tris-HCl (pH 7.5). The protein was purified from the dialysate by using a HiTrap SP XL cation exchange column (GE Healthcare Life Sciences), followed by a size-exclusion column (HiLoad 16/60 Superdex 200; GE Healthcare Life Sciences) [22].

The 6× HIS-tagged proteins CYT-18 NTDs, CYT-18 CTD, Sc mtTyrRS, and Sc NTDs were purified similarly, except that the ammonium sulfate pellet was dissolved in 500 mM KCl, 25 mM Tris-HCl (pH 7.5), and 30 mM imidazole, and the proteins were purified by nickel-affinity chromatography using a HisTrap HP column (GE Healthcare Life Sciences) [23], followed by TEV protease-cleavage of the 6× HIS-tag in dialysis buffer (500 mM KCl, 25 mM Tris-HCl [pH 7.5], 5 mM DTT) to remove imidazole. The proteins were then further purified by an additional round of nickel-affinity chromatography, followed by size-exclusion chromatography (HiLoad 16/60 Superdex 200; GE Healthcare Life Sciences).

The maltose-binding protein (MalE) fusions MalE-ScCTD, MalE-chimera 1, and MalE-chimera 2 were purified by polyethyleneimine precipitation of nucleic acids, as described above for CYT-18, and then loaded onto an amylose affinity column (New England Biolabs) in buffer containing 25 mM Tris-HCl (pH 7.5), 500 mM KCl, 1 mM DTT, 1 mM EDTA, and 10% glycerol followed by elution with 10 mM maltose in the same buffer. The proteins were further purified using a heparin-sepharose column (HiTrap heparin HP column; GE Healthcare Life Sciences) in 300 mM KCl, 25 mM Tris-HCl (pH 7.5), 1 mM DTT, and 1 mM EDTA and eluted with a salt gradient of 300 mM to 1.5 M KCl in the same buffer. The final purification step was size-exclusion chromatography (HiLoad 16/60 Superdex 200; GE Healthcare Life Sciences) in 25 mM Tris-HCl (pH 7.5), 200 mM KCl, and 10% glycerol.

Proteins used for SAXS were stored in buffer containing 100 mM KCl, 5 mM MgCl₂, 10 mM Tris-HCl (pH 7.5), 5% glycerol at −80°C. Proteins used for biochemical assays were dialyzed into 100 mM KCl, 25 mM Tris-HCl (pH 7.5), and 50% glycerol and stored at −80°C. Protein yields ranged from 14 to 44 mg/l (monomer concentrations), and all proteins were >99% pure as judged by SDS-polyacrylamide gels stained with Coomassie blue. Protein concentrations were determined by measuring A₂₈₀ under denaturing conditions (6 M guanidine hydrochloride). Concentrations of wild-type CYT-18, the Sc mtTyrRS, and C-terminal truncations of these proteins refer to the homodimer, while CTD concentrations refer to the monomer.

Preparation of RNA Substrates for SAXS and Biochemical Assays

Intron-containing RNA substrates for SAXS and biochemical assays were transcribed from the linearized recombinant plasmids indicated above. The Twort intron for SAXS was synthesized by large-scale in vitro transcription reactions (10–30 ml) with T7 polymerase at 37°C in reaction buffer containing 40 mM Tris-HCl (pH 8.1), 1 mM spermidine, 10 mM DTT, 8 mM NTPs, and 15 mM MgCl₂. Transcription reactions were incubated at 37°C for 8 h and terminated by adding 50 mM EDTA followed by extraction with phenol-chloroform-isoamyl alcohol (25∶24∶1; phenol-CIA). The RNA was then purified through a 5-ml HiTrap desalting column (GE Healthcare Life Sciences) and a size exclusion column (HiLoad 16/60 Superdex 200; GE Healthcare Life Sciences). T7 RNA polymerase for the large-scale transcriptions was expressed with an N-terminal 6× HIS-tag from pRC9 and purified as described [79].

³²P-labeled Nc mt LSU, Nc ND1m, and Twort RNAs for equilibrium-binding assays were synthesized by using a MAXIscript transcription kit (Life Technologies), with the concentration of unlabeled UTP changed from that recommended in the manufacturer's protocol (0.5 mM) to 10 µM UTP to obtain higher specific activity transcripts (300 Ci/mmol). The Ll.LtrB group II intron was synthesized by using a mutant T7 polymerase that can read through a T7 polymerase transcription termination site within the intron [80] in reaction medium containing 40 mM Tris-HCl (pH 7.9), 6 mM MgCl₂, 10 mM DTT, 2 mM spermidine, 1 mM GTP, 1 mM CTP, 1 mM ATP, 250 nM UTP, and 1 µM [α-³²P]UTP (3,000 Ci mmol⁻¹; Perkin Elmer). After transcription and DNase treatments (MAXIscript transcription kit; Life Technologies), transcripts were purified by extraction with phenol-CIA, followed by gel filtration through two consecutive 1-ml Sephadex G-50 columns (Sigma-Aldrich).

Intron-containing RNA substrates for splicing reactions were transcribed from linearized DNA template using a MEGAscript transcription kit (Life Technologies) with 1 µCi [α-³²P]UTP (3,000 Ci mmol⁻¹; PerkinElmer) added for standard ³²P-labeled substrates and 3 µCi [α-³²P]UTP (3,000 Ci mmol⁻¹) added for higher specific activity subtrates (Figures 7C, S7A, and S7C). The Nc mt LSU intron substrate was synthesized by in vitro transcription of pBD5a (BanI digested) using a MEGAscript T3 kit, while the Nc ND1m intron substrate was synthesized by in vitro transcription of pND1m (NdeI digested) using a MEGAscript T7 kit. The intron RNAs were purified as described above.

The poly(U)₃₀ oligonucleotide used for binding assays was synthesized and HPLC-purified by Integrated DNA Technologies. The oligonucleotide was dissolved in 10 mM HEPES (pH 7.5), 1 mM EDTA and stored at a concentration of 25 µM. For equilibrium-binding assays, 25 pmoles of the oligonucleotide was 5′-end labeled with [γ-³²P]ATP (3,000 Ci mmol⁻¹; PerkinElmer) using T4 kinase (New England Biolabs) and then purified by phenol-CIA extraction followed by desalting through a Sephadex G-25 column.

SAXS Data Collection and Analysis

Proteins and RNAs used for SAXS analysis were prepared as described above. RNA-protein complexes were formed by mixing protein dimer and RNA at a 1∶1 molar ratio in 1.2 ml of 100 mM KCl, 5 mM MgCl₂, 10 mM Tris-HCl (pH 7.5), and 5% glycerol. After incubation at room temperature for 15 min, RNP complexes were purified by size-exclusion chromatography (Hi-Load 16/60 Superdex 200 column; GE Healthcare Life Sciences) in the same buffer. RNP complexes and proteins for SAXS were concentrated by using Amicon Ultra-4 centrifugal filter units (EMD Millipore) and frozen for storage at −80°C. The size-exclusion chromatography column buffer was used as a solvent blank for SAXS.

SAXS data were collected on beamline 12-ID-C at the Advanced Photon Source (Argonne, Illinois). Each sample had 20 1-s exposures taken at a sample-to-detector distance of 2.0 m, covering a momentum transfer range of 0.007<q<0.35 Å⁻¹. Samples were continuously passed through the beam using a flow-cell to minimize radiation damage. The 20 consecutive exposures were compared and showed no change in scattering intensity, indicating no radiation damage. Radially averaged scattering data were buffer subtracted and analyzed by using ATSAS [42] and IGOR-Pro (WaveMetrics). Scattering curves were displayed as the scattering intensity (I(q)) as a function of momentum transfer q = (4πsinθ)/λ, where λ is the wavelength of the incident X-ray beam and θ is half the angle between the incident and scattering radiation. SAXS data were obtained for least three different concentrations of each protein and checked for aggregation and interparticle interference by examination of the Guinier region [81]. Guinier plots (log(I(q)) versus log(q)) were checked for linearity in the Guinier region, a diagnostic of sample quality. For globular proteins, the Guinier approximation is valid for qR_g<1.3. The q range used for SAXS analysis was 0.015<q<0.3 Å⁻¹ for CYT-18 protein constructs and 0.02<q<0.3 Å⁻¹ for CYT-18+Twort complexes. The I(0) (extrapolated forward scattering at zero angle) and R_g (radius of gyration) were evaluated using the Guinier approximation for scattering intensity (I(q)) according to the equation:I(0) and R_g were also computed from the scattering curve by using the indirect Fourier transform program AUTOGNOM, which additionally provides an estimate of the maximum particle dimension (D_max) from the distance distribution function P(r) [42]. The R_g values determined by using the Guinier approximation were consistent with those determined by AUTOGNOM. Molecular weights were calculated by comparing the extrapolated forward scattering at zero angle, I(0), with that of a protein standard, bovine serum albumin (BSA), by using the equation:where MM_p and MM_st are the molecular weights of the protein sample and protein standard, respectively, c_p and c_st are their concentrations in g/l, and I(0)_p and I(0)_st are the forward scattering intensities of the protein and standard, respectively. Agreement with the calculated molecular weights of the samples indicates sample quality and monodispersity [81]. Experimental scattering curves were compared with theoretical scattering curves calculated by the program CRYSOL (for q_max<0.3) from the crystal structures of those macromolecules with known atomic structures (CYT-18 NTDs, CYT-18 NTDs+Twort, CYT-18 CTD homology model) [43].

SAXS Ab Initio Shape Reconstructions

Ab initio shape reconstructions were done by using DAMMIN (for q_max<8/R_g) and GASBOR, which use simulated annealing methods to build low resolution protein models from dummy atoms or residues, respectively [45],[46]. The program DAMMIN uses dummy atoms packed into a sphere with the beads determined to be either protein or solvent. The final DAMMIN model was obtained by using the DAMAVER program suite to align ten models from independent DAMMIN runs and produce an average model. The latter was further refined by using DAMMIN to produce the final model [82]. GASBOR represents the protein as a chain-like ensemble of dummy residues equal to the number of residues in the protein. The final GASBOR model was chosen as the one with the lowest NSD value after running DAMSEL to compare ten models from independent GASBOR runs [82]. No symmetry was specified for the building of CYT-18* or CYT-18 CTD ab initio models, while P2 symmetry was specified for the CYT-18 NTDs models based on prior knowledge from the CYT-18 NTDs crystal structure. DAMMIN and GASBOR produced similar models of CYT-18* with or without P2 symmetry enforced.

Rigid-Body Modeling

Rigid-body models of CYT-18* by itself and of CYT-18* and the CYT-18 NTDs bound to Twort RNA were built by using the program CORAL [48]. This program employs a simulated annealing method to place high resolution models of individual components in orientations that minimize the discrepancy between the calculated SAXS profile and the experimental SAXS data, with distances between the structured components constrained by randomized dummy residue linkers chosen from a generated library of non-clashing loop structures. To build models of CYT-18*, a homology model of the CYT-18 CTD (amino acids 448–583) was generated by I-TASSER [47], using the A. nidulans CTD NMR structure (PDB:2KTL) as a template for modeling [37]. The confidence (C-score) and TM-scores of the CYT-18 CTD homology model, which are indicators of model quality, are high at 0.98 and 0.85, respectively. This CYT-18 CTD model and available high-resolution crystal structures for CYT-18 NTDs+Twort RNA (PDB:2RKJ) were used for rigid-body modeling. The final CORAL models were chosen from among ten independently derived models based on the best fit to the experimental scattering data as indicated by a low χ value [48].

Ensemble optimization analysis to characterize the flexibility of CYT-18*+Twort system was conducted by using the program, EOM [83],[84]. This program generates a random pool of 10,000 structures and creates an optimized ensemble from this pool, such that the average scattering pattern of the ensemble fits the experimental SAXS data. Comparison of the shape of the R_g and D_max distributions of the optimized ensemble with those of the random pool provides information about the size and flexibility of the structure, with a broad peak resembling that of the random pool suggesting a flexible, extended structure and a peak narrower than the random pool suggesting a more rigid structure.

Tyrosyl-Adenylation and TyrRS Assays

Tyrosyl-adenylation assays were done by incubating 100 nM protein in a 50-µl reaction containing 5 mM ATP, 100 mM KCl, 10 mM MgCl₂, 144 mM Tris-HCl (pH 7.5), 2 mM DTT, 0.1 mg/ml BSA (New England Biolabs), 0.1 unit of yeast inorganic phosphatase (New England Biolabs), and 5 µCi of L-[3,5-³H]-tyrosine (53 Ci mmol⁻¹; Amersham Biosciences Corp.) [30]. Reactions were initiated by adding protein and incubated at 30°C for 10 min. Reactions were terminated by adding 1 ml of reaction medium and immediately filtering through a nitrocellulose membrane to trap protein bound tyrosyl-adenylate. Radioactivity was measured by Beckman Coulter LS 6500 scintillation counter using Ready Protein scintillation cocktail (Beckman).

Aminoacylation assays were done as described previously with protein concentrations normalized to tyrosyl-adenylation activity [23]. Reactions of 120 µl contained 100 nM protein and 6 µM E. coli tRNA^Tyr (Sigma-Aldrich) in 100 mM KCl, 15 mM MgCl₂, 50 mM Tris-HCl (pH 7.5), 5 mM ATP, and 10 mM L-tyrosine (a 1∶10 mixture of L-[3,5-³H]-tyrosine and unlabeled L-tyrosine). Reactions were initiated by adding protein and incubated at 30°C. For time courses, 20-µl portions were removed after times ranging from 2 to 60 min, and the reaction was terminated by precipitation with 0.8 ml of a solution containing 10% trichloroacetic acid and 20 mM sodium pyrophosphate. Reactions were filtered through Whatman 3 MM filter paper to collect the precipitates, and the filters were washed three times with 1 ml of a solution containing 5% trichloroacetic acid and 20 mM sodium pyrophosphate followed by 2 ml of 95% ethanol. The filters were then dried and quantified by using a Beckman Coulter LS 6500 scintillation counter as above.

Equilibrium-Binding Assays

³²P-labeled RNAs (5 pM; 300 Ci/mmol) were incubated with increasing concentrations of protein in a 50-µl reaction containing 100 mM KCl, 5 mM MgCl₂, 20 mM Tris-HCl (pH 7.5), 5 mM DTT, 0.1 mg/ml BSA, and 10% glycerol at either 25°C (Figures 4 and 5) or 37°C (Figure S4). Binding reactions were initiated by adding 10 µl protein and terminated after 30 min by filtering 10 µl of the reaction through a nitrocellulose membrane (Amersham Hybond ECL nitrocellulose; GE Healthcare Life Sciences) backed by a nylon membrane (Amersham Hybond-N+; GE Healthcare Life Sciences). The nitrocellulose membrane retains protein-bound RNA and the nylon membrane retains free RNA. The end point (30 min) was chosen after determining that incubations times of 20, 30, or 60 min gave indistinguishable results for all proteins assayed. After application of samples, the membranes were washed three times with 20-µl wash buffer containing 100 mM KCl, 5 mM MgCl₂, and 20 mM Tris-HCl (pH 7.5), then dried and quantified using a PhosphorImager and the program ImageQuant (GE Healthcare Life Sciences).

RNA Splicing Assays

Splicing time courses for the Nc mt LSU and Nc ND1m introns were done by pre-incubating ³²P-labeled precursor intron RNA (50 or 200 nM; 0.13–0.4 Ci mmol⁻¹) with protein (25 or 100 nM) in a 100-µl reaction containing 100 mM KCl, 5 mM MgCl₂, 20 mM Tris-HCl (pH 7.5), 1 mM DTT, 0.1 mg/ml BSA, and 10% glycerol for 10 min on ice, followed by 5 min at reaction temperature. Reactions were initiated by adding 1 mM GTP-Mg²⁺. Portions (8 µl) were removed at different times, and the reaction terminated by adding 50 mM EDTA, followed by phenol-CIA extraction and mixing 10 µl of sample with 10 µl of 2× gel loading dye (95% formamide, 0.02% SDS, 0.02% bromophenol blue, 0.01% xylene cyanol, and 1 mM EDTA). End-point splicing assays were done similarly in reaction medium containing 25 or 100 mM KCl for 60 min. Splicing assays comparing wild-type CYT-18 and chimera CYT-18/Sc mtTyrRS proteins were also done with higher concentrations of ³²P-labeled precursor RNA (200 nM, 0.13–0.4 Ci mmol⁻¹) and protein (100 nM or 500 nM dimer) and with 200 nM unlabeled precursor, 500 nM protein, and 500 nM [α-³²P]GTP (3,000 Ci mmol⁻¹; PerkinElmer). In all cases, samples were analyzed by electrophoresis in a denaturing 4% polyacrylamide gel, which was dried and quantified with a PhosphorImager, and data were analyzed by using ImageQuant TL.